ID: 1013594215

View in Genome Browser
Species Human (GRCh38)
Location 6:111646270-111646292
Sequence CCTTATTCAGTAAGTCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013594210_1013594215 -6 Left 1013594210 6:111646253-111646275 CCTTCTGCCTGAGAAAGCCTTAT No data
Right 1013594215 6:111646270-111646292 CCTTATTCAGTAAGTCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013594215 Original CRISPR CCTTATTCAGTAAGTCTGGG AGG Intergenic
No off target data available for this crispr