ID: 1013599244

View in Genome Browser
Species Human (GRCh38)
Location 6:111688905-111688927
Sequence GACTGCCCAGATCCACTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013599241_1013599244 8 Left 1013599241 6:111688874-111688896 CCCTTGGAGCATGCAGGTATATC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1013599244 6:111688905-111688927 GACTGCCCAGATCCACTGACTGG 0: 1
1: 0
2: 1
3: 13
4: 149
1013599239_1013599244 22 Left 1013599239 6:111688860-111688882 CCGGGGTGAGGGGGCCCTTGGAG 0: 1
1: 0
2: 3
3: 32
4: 294
Right 1013599244 6:111688905-111688927 GACTGCCCAGATCCACTGACTGG 0: 1
1: 0
2: 1
3: 13
4: 149
1013599242_1013599244 7 Left 1013599242 6:111688875-111688897 CCTTGGAGCATGCAGGTATATCA 0: 1
1: 0
2: 1
3: 7
4: 123
Right 1013599244 6:111688905-111688927 GACTGCCCAGATCCACTGACTGG 0: 1
1: 0
2: 1
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013599244 Original CRISPR GACTGCCCAGATCCACTGAC TGG Intronic
900743792 1:4346462-4346484 CACTGGCCAGATGCACTGAATGG + Intergenic
901703217 1:11056399-11056421 GACTGCCCAGATTCACAAGCTGG - Intronic
902243312 1:15102797-15102819 GACTGCCCAGAGCCACACAGTGG - Intronic
902527042 1:17065961-17065983 GAGTCCCCAGAGCCAATGACTGG + Intergenic
903804441 1:25994639-25994661 GACTCCCCAGATTCACTCAGTGG - Intronic
905905506 1:41615546-41615568 GACTGCCCAGAAACAGTGGCAGG + Intronic
905928151 1:41766774-41766796 GTCTGGCCAGATCCACTTAATGG + Intronic
907308652 1:53527299-53527321 GAGTGCACAGATCCCCTGAGCGG - Intronic
908144657 1:61226989-61227011 AACTGCACAGCTACACTGACCGG + Intronic
908806597 1:67938702-67938724 GTGTGCCCTGATCCAATGACCGG + Intergenic
910528231 1:88205738-88205760 GACTGCCAAGGTCCCCTGAAGGG + Intergenic
919659857 1:200233906-200233928 TCCTGCCCAGATTCACTGAATGG + Intergenic
922846227 1:228687169-228687191 CACTGGCCCGCTCCACTGACCGG + Intergenic
1062924973 10:1309480-1309502 GACTTCCCAGGACCACTCACAGG - Intronic
1063091157 10:2867161-2867183 GTCTGCGCACATCTACTGACTGG - Intergenic
1064301574 10:14127527-14127549 GACGGCCCAGATTCACTTCCTGG + Intronic
1067776203 10:49166565-49166587 GACTGCCAAGAGCAACTGAAAGG + Intronic
1069098645 10:64290703-64290725 GACAGCCCACATTCAATGACTGG + Intergenic
1069590495 10:69638769-69638791 GACTCCCCACAACCTCTGACAGG + Intergenic
1069995794 10:72341341-72341363 GGCTGCCCAGATCCACTGAGGGG - Intronic
1070719215 10:78744855-78744877 GAAAGCCCACATCCAGTGACTGG - Intergenic
1070830338 10:79414178-79414200 AACTGCCCAGATGGAATGACAGG + Intronic
1070834864 10:79441895-79441917 GGCTGCCCAGAGCCCCTGCCAGG - Intronic
1075118216 10:119644790-119644812 TGCTGCCCAGATCCACTTTCAGG - Intergenic
1077977263 11:7260953-7260975 GACTGTGCACATCCACAGACTGG - Intronic
1078906126 11:15689510-15689532 AACTGCCCAGGTCCTCTGATAGG + Intergenic
1080608572 11:33885049-33885071 GACTGCCCATCACCTCTGACTGG + Intronic
1082847186 11:57735856-57735878 GCCTGGCCAGATCCACTGCATGG + Intronic
1088053967 11:105553133-105553155 GACTGGCCAGAACCACTCCCAGG + Intergenic
1089035496 11:115385762-115385784 GACTGCCCAGACCAGCTAACTGG + Intronic
1089633692 11:119798872-119798894 GGCTGGCCAGGTCCATTGACTGG + Intergenic
1091430304 12:428025-428047 GACAGCCCATATCCAGTGCCTGG - Intronic
1093137815 12:15473037-15473059 GCCTGCTCAGACCCAGTGACAGG + Intronic
1100284642 12:93153601-93153623 GGCAGCCCATATCCAGTGACTGG + Intergenic
1101997320 12:109534492-109534514 GACTGGCCAGATCCCCTCCCTGG + Intronic
1103009681 12:117448501-117448523 GGCTGACCACATCAACTGACTGG + Intronic
1105599562 13:21874647-21874669 GACCGCCTAGATGCCCTGACAGG + Intergenic
1108228975 13:48318295-48318317 CACTGCCCAGATGCACTTCCTGG - Intronic
1111148374 13:84215278-84215300 GACAGCACACATCCAGTGACTGG + Intergenic
1112071057 13:95850929-95850951 GGCAGCCCATATCCAATGACTGG + Intronic
1112780716 13:102897902-102897924 GGCAGCCCATATCCAATGACTGG - Intergenic
1116153425 14:41171458-41171480 CACTGACCAGATACACTAACTGG + Intergenic
1119177683 14:72581179-72581201 GAAGGCCCAGATCCACTAAGTGG - Intergenic
1119178242 14:72585597-72585619 GACAGCCCACATCCAATGACTGG - Intergenic
1119549917 14:75501385-75501407 GGCAGCCCATATCCAGTGACTGG + Intergenic
1120295319 14:82633095-82633117 GAGTGTTCAGATCCACTGAGAGG - Intergenic
1122407989 14:101511829-101511851 GGCAGCCCACATCCAGTGACTGG + Intergenic
1123492690 15:20795228-20795250 GACTGCCCAGATTCACTTTCTGG - Intergenic
1123549191 15:21364320-21364342 GACTGCCCAGATTCACTTTCTGG - Intergenic
1124094047 15:26632111-26632133 GTCTTCACAGATCCAGTGACAGG - Intronic
1125315443 15:38426462-38426484 GACACCCCAGATACCCTGACTGG + Intergenic
1126193050 15:45899113-45899135 GACAGCATAGATACACTGACTGG - Intergenic
1126780682 15:52136632-52136654 GGCTTCCCAGGACCACTGACGGG + Intronic
1127113065 15:55695645-55695667 GATTTCCCAGAGCTACTGACTGG - Intronic
1127189940 15:56518765-56518787 GACTGAACAGATCCACCTACAGG - Intergenic
1128048307 15:64639582-64639604 GTCTGCCCTAATCCAGTGACTGG - Intronic
1128114428 15:65096470-65096492 TCCACCCCAGATCCACTGACTGG + Intronic
1128426917 15:67551238-67551260 GACTTAGCAGATCCACTGTCAGG + Intronic
1129603864 15:77015324-77015346 GACTGCCCAAAGCCACTCAATGG - Intronic
1202957527 15_KI270727v1_random:91542-91564 GACTGCCCAGATTCACTTTCTGG - Intergenic
1132934240 16:2472928-2472950 GACTTCCCAGATCCCCAGACAGG + Intronic
1133108720 16:3532856-3532878 GAGTGCACAGAACCACTGAGGGG - Intronic
1134093376 16:11403274-11403296 GCCTCCCCAGAACCAATGACTGG - Intronic
1138384833 16:56629099-56629121 GTCTGCCCAGTGTCACTGACAGG + Intergenic
1139723256 16:68874324-68874346 GACTGCCCTCGTTCACTGACTGG - Intronic
1142435341 16:90053140-90053162 GACTGGCCGGAACCACTGCCTGG + Intergenic
1144646387 17:16977107-16977129 GACTACACAGATACAATGACCGG - Intergenic
1145984173 17:29033336-29033358 AATTGCTCAGATCCACAGACAGG - Intronic
1146282623 17:31554797-31554819 GACAGCCCACATCCAGTGAGTGG - Intergenic
1148194245 17:45701786-45701808 GACTCACCAGATCCAATGATCGG + Intergenic
1149036038 17:52135322-52135344 GACTGGCCAGAACCACTGCATGG - Intronic
1149412076 17:56419125-56419147 GGCTGCTCCTATCCACTGACTGG - Intronic
1152526167 17:80889438-80889460 GGCTTCCCAGGTCCTCTGACCGG - Intronic
1153165831 18:2261306-2261328 GACTGCTGAGACCCACTGGCAGG - Intergenic
1154450235 18:14469766-14469788 GACTGCCCAGATTCATTTTCTGG - Intergenic
1155423447 18:25680850-25680872 AACTGCACAGGTCCACTTACAGG + Intergenic
1157445508 18:47743692-47743714 CACTGCACAGATCCACTTACAGG + Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1159136326 18:64341250-64341272 GCCTGCCCAGATCCAGGGAATGG - Intergenic
1160229629 18:77037440-77037462 GACTGGCCAGAGCCACAGAGAGG + Intronic
1160415789 18:78709770-78709792 GCTAGCCCAGAACCACTGACAGG - Intergenic
1164080372 19:21857120-21857142 CACTGCCCACAGCCACTGGCTGG + Intergenic
1165527813 19:36370750-36370772 GGCTGCCCAGAACCACTGCATGG + Intronic
1166959754 19:46490248-46490270 GACTGCCAAGTTCCACGCACGGG - Intronic
1167443725 19:49525300-49525322 GTCTGCCCAGATCGCCTGCCTGG + Intronic
925312951 2:2900177-2900199 GACTGGCCAGAACCACTCCCTGG - Intergenic
932483237 2:72062553-72062575 GACTGGCCAGAACCACTCAGTGG - Intergenic
932779673 2:74552382-74552404 GGCTGCCCACATCCTCTGCCGGG - Exonic
932942733 2:76188065-76188087 GTCTGTCCAGAGCCACGGACTGG + Intergenic
934710920 2:96513432-96513454 GACAACTCAGATACACTGACAGG - Intergenic
934887899 2:98040698-98040720 GGCAGCCCTAATCCACTGACCGG - Intergenic
935211712 2:100944432-100944454 GACTGCCCACCTCCACAGGCAGG + Intronic
938481180 2:131662938-131662960 GACTGCCCAGATTCCCTTTCTGG + Intergenic
942802352 2:179890222-179890244 CACAGCCCATATCCAGTGACTGG - Intergenic
945838932 2:214865772-214865794 GACAGCCCATATCCAATAACTGG + Intergenic
946194039 2:218022693-218022715 TGCTTCCCAGAGCCACTGACTGG - Intergenic
947579597 2:231306813-231306835 CACTGCCCAGATCCTCTGTGTGG - Intronic
1173034244 20:39393618-39393640 GACAGCCCACATTCAGTGACTGG + Intergenic
1173178405 20:40783056-40783078 GTCAGCCCACATCCAATGACCGG - Intergenic
1173536767 20:43820750-43820772 GACTCCCCAGATGCTCTGAGTGG - Intergenic
1176445950 21:6820595-6820617 GACTGCCCAGATTCACTTTCTGG + Intergenic
1176824118 21:13685628-13685650 GACTGCCCAGATTCACTTTCTGG + Intergenic
1181638035 22:24183326-24183348 GAGGGCTCAGACCCACTGACTGG + Intronic
1185266996 22:49909607-49909629 CACTGCCCAGAACCACCGCCTGG + Intronic
949544461 3:5060704-5060726 GGCAGCCCACATCCAGTGACTGG + Intergenic
949966572 3:9361808-9361830 GACTGGCCAGAACCACTCCCTGG - Intronic
952969866 3:38644048-38644070 GAATGCCCAGATCATGTGACTGG - Intronic
956933915 3:74078007-74078029 GACAGCCCAGATTCACAGAGTGG - Intergenic
963606106 3:147412805-147412827 CTCTGCCCAGTTCCACTGAGTGG - Intronic
969246805 4:5939883-5939905 GACTGGCCAGAACCACTGCATGG - Intronic
969858100 4:10015986-10016008 ATCTGCCCAGATCCACGGCCTGG - Intronic
974041696 4:56863340-56863362 GAAAGCCCACATCCAGTGACTGG + Intergenic
974965524 4:68756381-68756403 GACAGCCCATATCCAATGCCTGG + Intergenic
975000296 4:69217607-69217629 GACAGCCCATATCCAATGCCTGG + Intergenic
975005467 4:69277599-69277621 GACAGCCCATATCCAATGCCTGG - Intergenic
975013885 4:69386586-69386608 GACAGCCCATATCCAATGCCTGG - Intronic
975015145 4:69405935-69405957 GACAGCCCATATCCAATGCCTGG - Intronic
975421302 4:74167265-74167287 GAATCTCTAGATCCACTGACTGG + Intronic
977467044 4:97395802-97395824 GACCAGCCAGATCCACTGAAAGG - Intronic
983470680 4:168150791-168150813 GACTGGCCAGAACCACTAAGCGG + Intronic
987857154 5:23435264-23435286 AACTGCCCATATCCAATGACTGG + Intergenic
989760984 5:45016097-45016119 ACCTGCCCAGATCCACTTCCAGG - Intergenic
990957125 5:61353022-61353044 GAATGCACAGATCAACAGACGGG - Intronic
994791613 5:104234009-104234031 GACTACTCATATCCACTGATAGG - Intergenic
995481193 5:112594928-112594950 CACTGCCCAGATCCCCTGCAGGG + Intergenic
1001711124 5:173778982-173779004 AACTGCACAGGTCCACTTACAGG - Intergenic
1002555076 5:180030896-180030918 AACTGTCCAGATCCACTTACAGG + Intronic
1004210004 6:13630605-13630627 GACTTCACAGATCCCCTGAAAGG - Intronic
1006503929 6:34476116-34476138 TACTGGGCAGATCCACTGACTGG - Intronic
1007661348 6:43488718-43488740 GACTGAGCACAGCCACTGACAGG - Intronic
1011335097 6:86251484-86251506 GAATGCCCTGAACCACTGAAGGG + Intergenic
1013599244 6:111688905-111688927 GACTGCCCAGATCCACTGACTGG + Intronic
1015685252 6:135851695-135851717 CAGTGCCCAGACCAACTGACTGG - Exonic
1016066985 6:139694135-139694157 GATTGCCCAGAACCAATGATGGG + Intergenic
1017381130 6:153831526-153831548 GACTTCCCTGGTCCACTGGCTGG + Intergenic
1017975115 6:159350318-159350340 GACTGCCCAGAACCACTCCATGG + Intergenic
1018855039 6:167669066-167669088 GACTGCCTACAGCCACTGAAGGG + Intergenic
1019024274 6:168943986-168944008 GACCACCTAGACCCACTGACTGG + Intergenic
1023837240 7:44075486-44075508 CACTGCCCAGTTCAGCTGACAGG - Intronic
1023877283 7:44293928-44293950 CACTGCCCAGACCCACTGCCAGG + Intronic
1024477525 7:49829477-49829499 GAATGCCCAGATACCCTGCCAGG - Intronic
1026304806 7:69131544-69131566 GCCTGCCCAGATCTACTCAATGG + Intergenic
1030502531 7:110377670-110377692 GACAGCTCACATCCAATGACTGG + Intergenic
1030905352 7:115174462-115174484 GACTGCCCAGCTCCATGGCCTGG + Intergenic
1032147084 7:129393783-129393805 TAGTGCCCAGATCCACTAAAAGG - Intronic
1034401442 7:150864185-150864207 GACAGCCCAGAGCGACAGACAGG + Intergenic
1034523654 7:151640355-151640377 GATTGCCGAGAGCCACTGAATGG - Intronic
1040071398 8:43191642-43191664 GAAAGCCCAGAACCTCTGACTGG - Intronic
1041968232 8:63705545-63705567 GCCTGCCCAGCTCAACTGTCAGG - Intergenic
1046836391 8:118806250-118806272 GCCAGCCCACATCCAATGACTGG + Intergenic
1049225657 8:141449383-141449405 GACTGTCCTGATTCACAGACAGG + Intergenic
1055017650 9:71635809-71635831 GAGTGCCCTGCCCCACTGACGGG - Intergenic
1055376787 9:75657383-75657405 GGCAGCCCACATCCAGTGACTGG + Intergenic
1058304595 9:103422767-103422789 GACACACCAAATCCACTGACCGG - Intergenic
1062395255 9:136350227-136350249 GGCTGCACAGATCCCCTGATGGG + Intronic
1062424005 9:136497770-136497792 GACTGCACAGATCCCCTCTCTGG - Intronic
1062591745 9:137277592-137277614 GCTTGCCCAGATCCCCTGGCCGG - Intergenic
1203523243 Un_GL000213v1:63930-63952 GACTGCCCAGATTCACTTTCTGG - Intergenic
1187011546 X:15285082-15285104 CAGTGCCCAGAGACACTGACAGG + Intronic
1188199978 X:27285329-27285351 GACTGTCCAGGACCACTGGCAGG + Intergenic
1189234713 X:39478126-39478148 CTCTGGCCAGATCCACTGAGGGG + Intergenic
1192244701 X:69362709-69362731 GACTCCGCAGATCCAGGGACAGG - Intergenic
1196258276 X:113548425-113548447 GACTGCCCAGTGTCACTGAGTGG + Intergenic
1198175331 X:134149085-134149107 CACTGCATAGATCCACAGACAGG + Intergenic