ID: 1013599441

View in Genome Browser
Species Human (GRCh38)
Location 6:111690649-111690671
Sequence AACATTTATCACTATGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 292}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013599438_1013599441 1 Left 1013599438 6:111690625-111690647 CCAGATATACCAACAGTAACAAG 0: 1
1: 0
2: 3
3: 4
4: 97
Right 1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG 0: 1
1: 1
2: 2
3: 29
4: 292
1013599439_1013599441 -8 Left 1013599439 6:111690634-111690656 CCAACAGTAACAAGCAACATTTA 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG 0: 1
1: 1
2: 2
3: 29
4: 292
1013599437_1013599441 20 Left 1013599437 6:111690606-111690628 CCAAGAACTTAGTATTGTACCAG 0: 1
1: 0
2: 0
3: 10
4: 162
Right 1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG 0: 1
1: 1
2: 2
3: 29
4: 292
1013599435_1013599441 22 Left 1013599435 6:111690604-111690626 CCCCAAGAACTTAGTATTGTACC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG 0: 1
1: 1
2: 2
3: 29
4: 292
1013599436_1013599441 21 Left 1013599436 6:111690605-111690627 CCCAAGAACTTAGTATTGTACCA 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG 0: 1
1: 1
2: 2
3: 29
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013599441 Original CRISPR AACATTTATCACTATGTGCT GGG Intronic
904155308 1:28478147-28478169 AACATTTATCTTTCTGTGCCTGG + Intronic
904284689 1:29446456-29446478 AACCTTTCTCACTGTGTGTTGGG - Intergenic
905112709 1:35608493-35608515 AACATTTATCATTTTGTGTTGGG - Intronic
905802376 1:40853139-40853161 AATATTTCTTACTATGTGCGAGG + Intergenic
905918511 1:41702745-41702767 ATCATTTATTAATATCTGCTGGG - Intronic
909740551 1:79024479-79024501 AATATTTATCTCTCTGTGCCTGG - Intergenic
909937387 1:81568835-81568857 AACATTTTTACCTATGTTCTTGG + Intronic
910581738 1:88835067-88835089 AACATTTATAAATATTTGCTGGG + Exonic
910605441 1:89078657-89078679 AACATTTATCTTTCTGTGCCTGG - Intergenic
911343341 1:96666813-96666835 AAAATTTATCTGTCTGTGCTTGG + Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
911973525 1:104464869-104464891 AACATTTATGACCTTCTGCTGGG - Intergenic
912616412 1:111104657-111104679 AACATTTATTTCTTTGTGCTGGG + Intergenic
913424793 1:118716007-118716029 AATATTTGTCTCTCTGTGCTTGG - Intergenic
914390977 1:147222971-147222993 AACATGTAACACTATGTTCCTGG + Intronic
915808673 1:158882155-158882177 AAAATTTATTAATATCTGCTTGG - Intergenic
915880046 1:159660189-159660211 AACATTTGTCTTTCTGTGCTTGG + Intergenic
916244945 1:162677900-162677922 ATTATTTATACCTATGTGCTGGG + Intronic
917919423 1:179738019-179738041 CAGATTTATCACTCTGTGCCTGG - Intergenic
917950644 1:180029837-180029859 AACAGTTGTCACTAGGTGCTGGG - Intronic
918094012 1:181319713-181319735 ATCATTTATCTCTATCTGCATGG - Intergenic
919477679 1:198049254-198049276 AACATTTGTCTTTCTGTGCTGGG + Intergenic
920050310 1:203160837-203160859 AACATTTATTTCTATGTGCTGGG - Intronic
920595389 1:207264139-207264161 AACATTTATCTTTCTGTGCCTGG - Intergenic
921203935 1:212831981-212832003 CCCATTTATCACTATCTGATCGG + Intronic
924759192 1:246968473-246968495 AACAGTTTGCACTGTGTGCTTGG - Intronic
924789644 1:247233334-247233356 GACATTTATCTCTCTGTGCCTGG - Intergenic
1064277594 10:13920901-13920923 ATCAATTCTCACTATGTGCCAGG + Intronic
1064839975 10:19580715-19580737 AATAGTTATCATTTTGTGCTTGG + Intronic
1065137564 10:22687266-22687288 AACATTTTTCTCTCTGTGCCTGG - Intronic
1066553271 10:36582874-36582896 AACATTTGTCACATTGTACTAGG - Intergenic
1067750333 10:48967508-48967530 AATAATCACCACTATGTGCTGGG - Intronic
1068018826 10:51554711-51554733 TACATTCCTCACTGTGTGCTAGG + Intronic
1068465427 10:57383924-57383946 AACATTCATCATTATGTATTTGG - Intergenic
1068798017 10:61105529-61105551 AACACTTATTACCATCTGCTGGG - Intergenic
1069537571 10:69266088-69266110 CACATTTAGCCCTATGTGGTAGG - Intronic
1071266481 10:83969088-83969110 AACATTTATACCTCTGTTCTGGG - Intergenic
1071623893 10:87148252-87148274 AACATTCAACATTACGTGCTGGG - Intronic
1073772255 10:106747810-106747832 AACATTTATTTCTTTGGGCTGGG - Intronic
1074461542 10:113642643-113642665 AGCATTCATCACTATGAGCTGGG + Intronic
1074955680 10:118386522-118386544 AGCATTTTACACTTTGTGCTTGG + Intergenic
1078043623 11:7892862-7892884 AACATTTATCTCTATAGGCATGG - Intergenic
1079120079 11:17676419-17676441 AACATATATTACTAAGTGATAGG + Intergenic
1079373096 11:19868730-19868752 AACTTTTGGCACTATGTGGTTGG + Intronic
1079982072 11:27161787-27161809 TACATATATTACTATGTGGTAGG + Intergenic
1080332657 11:31157579-31157601 AATATTTATCCTTTTGTGCTTGG - Intronic
1081236592 11:40654266-40654288 GACATTTTGCACTGTGTGCTGGG + Intronic
1081590498 11:44419608-44419630 TAGAGTTATTACTATGTGCTAGG + Intergenic
1084677266 11:70642952-70642974 AACATGTATTTCTTTGTGCTGGG - Intronic
1085332591 11:75666606-75666628 ACTAATTACCACTATGTGCTAGG + Intronic
1085979062 11:81700016-81700038 AAAATTTATTATTATGTCCTTGG + Intergenic
1086269175 11:85039544-85039566 AACATATATAACTATGAGATAGG - Intronic
1086472965 11:87136417-87136439 AACATTTATAACTATGCCCGTGG + Intronic
1086491666 11:87362387-87362409 AACATTTAGCAGCATGTGGTTGG + Intergenic
1086642282 11:89174581-89174603 AAGATTTAGGGCTATGTGCTAGG - Intergenic
1087031187 11:93706160-93706182 AACATTTAAGACTATGCACTTGG - Intronic
1087528413 11:99348405-99348427 AAGAGTTATCAATATGTTCTAGG - Intronic
1088444679 11:109912916-109912938 AACACTTAACACTATGTACTTGG - Intergenic
1091362997 11:134993075-134993097 AACATTTATTAATAGGTGCTTGG - Intergenic
1092800981 12:12166423-12166445 AATATTTATCACTCTGTGTTGGG - Intronic
1093653242 12:21668136-21668158 AAAGTTTATTACTGTGTGCTAGG + Intronic
1093735231 12:22613566-22613588 AACATTTATGACCATGTGAGAGG + Intergenic
1094130441 12:27069042-27069064 GACATTTGTCACTGTGTCCTTGG + Intergenic
1095643494 12:44512975-44512997 AGCATTTATTACTTTGTGGTGGG - Intronic
1097995624 12:65884911-65884933 CACATATAGCACTATGTGCCAGG - Intronic
1098498869 12:71167074-71167096 TATAATCATCACTATGTGCTGGG + Intronic
1098942782 12:76557066-76557088 AACATTTATAGCAATGTTCTTGG - Intronic
1099101805 12:78450893-78450915 TACATTAATCACTAGGTTCTTGG - Intergenic
1099703763 12:86123568-86123590 AACATTTATTACTGAGTGCTTGG + Intronic
1100541813 12:95564375-95564397 CACTTATATCACTATTTGCTAGG - Intergenic
1100572124 12:95852660-95852682 AACAATTATCCCTATGTCATGGG + Intergenic
1101305486 12:103523864-103523886 AACACTTATCTCTATGGTCTTGG - Intergenic
1101795824 12:107972647-107972669 AATATTTATTACTGTGTGTTGGG - Intergenic
1102195629 12:111023326-111023348 ATAATTAATCACTATGTGCTAGG - Intergenic
1102339528 12:112110816-112110838 AGCATTTATCACCATGTAATAGG - Intergenic
1102502457 12:113361704-113361726 AACATTTATGATTTGGTGCTTGG + Intronic
1102659008 12:114508750-114508772 GACATTTTTCACCATGAGCTGGG + Intergenic
1103257979 12:119559378-119559400 AACATTGATCACTTTGTGTTTGG + Intergenic
1103394703 12:120598699-120598721 AGCATTTATCACTGTGTGCCAGG - Intergenic
1104062461 12:125280236-125280258 AACATTTATTTCTTTGTGTTGGG - Intronic
1104545503 12:129709057-129709079 AAAATATATCACTCTGAGCTTGG - Intronic
1108102552 13:46972378-46972400 AACATTTGTCAGAATGTGATGGG - Intergenic
1108558187 13:51616848-51616870 AACACTTAGAACTATGTGCCAGG - Intronic
1108801769 13:54105361-54105383 TACAGCTCTCACTATGTGCTAGG - Intergenic
1109118161 13:58417480-58417502 AACATATATTACTATGTACAAGG - Intergenic
1109646709 13:65267850-65267872 AATATTTATCTTTCTGTGCTTGG + Intergenic
1110773697 13:79380612-79380634 AACATTTATTTCTTTGTGTTGGG + Intronic
1111156514 13:84334821-84334843 AACATTTGTCCTTCTGTGCTTGG - Intergenic
1111825430 13:93261804-93261826 AACATTTTTCACTATATACCAGG - Intronic
1111914726 13:94349029-94349051 TCCATTCATCACTATGTGCCTGG - Intronic
1113304923 13:109067280-109067302 AACATTTATCAGTATTTACTAGG + Intronic
1114136219 14:19854821-19854843 AACATTTATCATTTTTTGTTGGG + Intergenic
1114719431 14:24864695-24864717 AACATATATCACTAGGTTTTTGG + Intronic
1115163268 14:30419337-30419359 AACATTTTCTACCATGTGCTAGG - Intergenic
1117116756 14:52521762-52521784 AGCAGTATTCACTATGTGCTAGG + Intronic
1117701212 14:58415386-58415408 AACATTGATTAATATGTGTTAGG + Intronic
1120099698 14:80430488-80430510 TGGATTTATCATTATGTGCTTGG - Intergenic
1122730910 14:103797053-103797075 AACATCTATCACTCTGGCCTGGG + Intronic
1122832970 14:104411843-104411865 AACATTTATCATTTTGTTTTTGG - Intergenic
1124360175 15:29030902-29030924 ACCTTTTATCATTATTTGCTTGG + Intronic
1124993606 15:34700479-34700501 AATATTTGTCATTCTGTGCTTGG + Intergenic
1126296405 15:47141630-47141652 AACATTTATTTCTTTGTGTTGGG - Intergenic
1126546583 15:49880779-49880801 AACATTTATCAGCATGTCATTGG - Intronic
1127115320 15:55720832-55720854 AACATTTATGAATTTGTGTTGGG + Intronic
1127359554 15:58232796-58232818 AGCATTTGCCACTATGTGCCAGG + Intronic
1127572784 15:60260609-60260631 AATATTTAGTACTAGGTGCTAGG - Intergenic
1127678804 15:61272653-61272675 AACATTTCTCACTTTGTTCACGG - Intergenic
1131606390 15:93908198-93908220 AACCATTATCACTAGGTGGTAGG - Intergenic
1132276699 15:100571818-100571840 AACATTTCTGAGAATGTGCTGGG - Intronic
1134200397 16:12193133-12193155 AACATTTATCATAATGTTTTTGG + Intronic
1135695018 16:24577938-24577960 AACATTTGTTACTATGTGCAAGG - Intergenic
1135925981 16:26694585-26694607 AACACTTTGCACTGTGTGCTTGG - Intergenic
1137315299 16:47313682-47313704 AACATTTTTTTTTATGTGCTTGG - Intronic
1139670599 16:68490489-68490511 AACATTTATCAATGTCTCCTAGG + Intergenic
1141135441 16:81461887-81461909 AACATTCAGCAGTATGTGCTGGG + Intronic
1141263280 16:82473120-82473142 AGCATTTACTACTATGAGCTGGG - Intergenic
1144371418 17:14595101-14595123 AGCATTTGTCATTCTGTGCTTGG - Intergenic
1148517698 17:48236887-48236909 TACATTTCTTACTATGTGCCAGG + Intronic
1148877095 17:50695430-50695452 AACATTTATAAATATGTTATAGG + Exonic
1149417220 17:56471781-56471803 AACATTTAGCACTTTGTGTCTGG - Intronic
1150519801 17:65854094-65854116 AACATTTATCATTGTGTTTTGGG - Intronic
1150767896 17:68016741-68016763 AACATTCAGCACTAAGTGCTCGG + Intergenic
1150794789 17:68228689-68228711 AGCATCTATTATTATGTGCTAGG + Intergenic
1154488836 18:14903266-14903288 AACATTTATTAATAGGTGCCTGG + Intergenic
1154504902 18:15027023-15027045 AACATTTATTAATAAGTGCCAGG + Intergenic
1155509037 18:26559029-26559051 GATATTTATCTCTCTGTGCTTGG - Intronic
1155991374 18:32282448-32282470 AACACTGATCACTGGGTGCTGGG + Intronic
1156069889 18:33194249-33194271 AATCTTTATAACTATATGCTTGG + Intronic
1156814259 18:41290398-41290420 AACATTTAACAAAAAGTGCTGGG - Intergenic
1157012860 18:43672313-43672335 AACATTTGTCACTAGGTGCCGGG + Intergenic
1157893455 18:51441314-51441336 ATCATTTAGCACTATCTTCTTGG - Intergenic
1158030522 18:52958934-52958956 AACGTTTATAAATTTGTGCTGGG - Intronic
1160051153 18:75434811-75434833 AACATTTATAAGTATGTTCAAGG + Intergenic
1162122008 19:8476544-8476566 AACATTAATCTCAATGCGCTGGG - Intronic
1162672608 19:12269657-12269679 AACATTTATAACTATTGGCCAGG - Intronic
1163398839 19:17079592-17079614 AAAATTCAGCAGTATGTGCTTGG - Intronic
1165238465 19:34443389-34443411 AAAGTTTAACACAATGTGCTTGG - Intronic
924968721 2:102781-102803 AATATTTATTTCTTTGTGCTTGG + Intergenic
927301230 2:21518050-21518072 AATATTTATCATTTTGTGGTTGG - Intergenic
927994670 2:27475619-27475641 AACATTTATTATTATGTACCAGG + Intronic
928679311 2:33683008-33683030 AATATTTGTCTCTCTGTGCTTGG + Intergenic
930413582 2:51059493-51059515 TACATTTAACACTATGTAGTTGG + Intergenic
930525484 2:52524556-52524578 AACTTTCATCCCTATGTGCCCGG + Intergenic
932907306 2:75767807-75767829 AACATGTATCAATATGTACCTGG + Intergenic
933279482 2:80317220-80317242 AACATTTATAAAAATGTGCATGG - Intronic
935878499 2:107537255-107537277 AAAATTTAAAAATATGTGCTAGG + Intergenic
936247877 2:110844347-110844369 AACATTTGTAAATTTGTGCTGGG + Intronic
938504097 2:131857219-131857241 AACATTTATTAATAAGTGCCAGG + Intergenic
939944353 2:148390854-148390876 AACAATTATTACTATAGGCTGGG - Intronic
941419768 2:165268882-165268904 AATATTTGTCATTCTGTGCTTGG - Intronic
941788393 2:169523472-169523494 GGCATTCATCACTATCTGCTTGG + Intronic
942177316 2:173346444-173346466 AATATTTATCCTTTTGTGCTTGG + Intergenic
942974303 2:181996426-181996448 AACATTTTCCAACATGTGCTGGG - Intronic
943131547 2:183859852-183859874 AAGTTTTATGACTATGTGTTTGG + Intergenic
943999784 2:194818969-194818991 AAAATTTAGAACTATATGCTAGG - Intergenic
944180945 2:196893334-196893356 AACATTTATTACTCTGAGCCAGG + Intronic
944597838 2:201278078-201278100 ATCATTCGTCACTATGCGCTTGG + Intronic
944864437 2:203846923-203846945 AACATTTAGCAATTTGTGCCAGG - Intergenic
945548409 2:211187689-211187711 AAATTTTATCACCATCTGCTGGG + Intergenic
945738421 2:213630505-213630527 AACATTTATCAGTGTGGGCTGGG + Intronic
946676770 2:222168696-222168718 AACATTTATCTTTCTGTGCCTGG + Intergenic
946787882 2:223266992-223267014 AATAGTTATCCCTATGTCCTGGG + Intergenic
1170586962 20:17742008-17742030 AATATTTGTCATTCTGTGCTTGG - Intergenic
1172685094 20:36747534-36747556 ACTATTTATCCCTATGTCCTTGG + Intergenic
1175747536 20:61468806-61468828 AATATTTATCTCTCTGTGCCTGG + Intronic
1176792953 21:13342113-13342135 AACATTTATTAATAAGTGCCAGG - Intergenic
1176813615 21:13573002-13573024 AACATTTATCATTTTTTGTTGGG - Intergenic
1177390664 21:20465942-20465964 AATATTTATCTTTCTGTGCTTGG + Intergenic
1177534834 21:22411204-22411226 AACATTTATCTTTCTGTGCCTGG + Intergenic
1177747371 21:25234792-25234814 AAAATTTATCACTAGGTAGTTGG - Intergenic
1177992340 21:28052944-28052966 AACATTTATTAATAAGTGCCAGG - Intergenic
1178246218 21:30955277-30955299 AATATGTATACCTATGTGCTAGG - Intergenic
1178471530 21:32897866-32897888 AACATTTGTCATTTTGTGCCTGG + Intergenic
1179319735 21:40278808-40278830 AACATTTATCACTATATGCTAGG - Intronic
1179425182 21:41271821-41271843 AAAAATTATAACAATGTGCTGGG - Intronic
1182160598 22:28117356-28117378 CACATCTATCAGGATGTGCTAGG - Intronic
1182262796 22:29087392-29087414 AACATTTTTCTCTATATTCTTGG - Intronic
1183692916 22:39401115-39401137 ATTATCTATCACCATGTGCTGGG + Intronic
949296379 3:2529201-2529223 AATATTTATCATTCTGTGCCTGG + Intronic
950132291 3:10555485-10555507 CACATTCATCTCTTTGTGCTGGG + Intronic
950681417 3:14587780-14587802 AGCATTTACTACCATGTGCTGGG - Intergenic
951850474 3:27133983-27134005 AATAATTATGACTATTTGCTGGG - Intronic
953712113 3:45282595-45282617 AATATTTGTCTTTATGTGCTTGG - Intergenic
957177571 3:76831081-76831103 AGCATTTATCACAGTTTGCTAGG + Intronic
957918367 3:86715697-86715719 AACAATAATAACTATGTGTTTGG + Intergenic
959726856 3:109552979-109553001 AACATTTATGTCTAAGTGCTGGG - Intergenic
959920620 3:111864118-111864140 TAAATATATCACTATGTACTTGG - Intronic
960184882 3:114626145-114626167 AACATTTAGGAATATGTGGTGGG - Intronic
960245272 3:115393554-115393576 TACATTAATCACTATTTACTTGG + Intergenic
960290239 3:115875488-115875510 CCCAAATATCACTATGTGCTAGG + Intronic
960457773 3:117894359-117894381 AACCTGTATCATTATGTGGTTGG - Intergenic
960646666 3:119892622-119892644 AACAGTTTTTACTAGGTGCTGGG - Intronic
961188302 3:124935179-124935201 AACTTTTGTCACTGTATGCTGGG + Intronic
962499309 3:135973786-135973808 CTAATTTATCACTATGTGCCAGG + Intronic
962558955 3:136585799-136585821 AGAATTTCTCACTATTTGCTAGG - Intronic
963403475 3:144833048-144833070 AACATTTGTCTCACTGTGCTTGG + Intergenic
964840247 3:160985586-160985608 AATATTTATCACCACTTGCTTGG - Intronic
965287695 3:166838366-166838388 AAAATTTATCAATTTGTGTTGGG - Intergenic
965922623 3:173936799-173936821 AGCATTCATCATTATGTGTTAGG + Intronic
965984127 3:174731128-174731150 AACATTTATGACTTTGAGCTGGG + Intronic
966124103 3:176555444-176555466 GTCGTTAATCACTATGTGCTTGG - Intergenic
966133195 3:176667679-176667701 AGAATTTATCACTTTGTGTTAGG + Intergenic
966742026 3:183242789-183242811 AACAGTTTGCACCATGTGCTTGG + Intronic
966855640 3:184192261-184192283 AACATTTATCACTTTATGTTGGG + Intronic
967191211 3:186986339-186986361 AATATTCAACACTATGTGCCAGG - Intronic
970482477 4:16490560-16490582 AACAATGATAACTATTTGCTTGG + Intergenic
971712183 4:30128744-30128766 AGCATTTATCACTCTGAGATGGG + Intergenic
971766106 4:30834103-30834125 AACATATAACACCATGTGCCAGG + Intronic
973646761 4:52957763-52957785 AACATGTAGCTCTAAGTGCTGGG + Intronic
974068661 4:57104100-57104122 AGCATTTGTCATTCTGTGCTTGG + Intronic
975354706 4:73387874-73387896 AATATTAATAACTATGTGATGGG - Intergenic
975400601 4:73933122-73933144 AACATTTGTTACTATGTACAAGG + Intergenic
978714878 4:111829945-111829967 ACCATTTATCACAATCTGATAGG + Intergenic
978997185 4:115171082-115171104 AATATTTAAGACAATGTGCTAGG - Intergenic
979875076 4:125879242-125879264 AGCATTTATCTTTTTGTGCTTGG - Intergenic
981422437 4:144566618-144566640 AACATTTATCGCTAAGTTCTGGG - Intergenic
981680376 4:147390690-147390712 AACATTTATCTCTCTGGGCCTGG + Intergenic
981815757 4:148829325-148829347 AATAATTATTACTATGTGCAGGG - Intergenic
981886464 4:149679268-149679290 AATATTTATCTTTCTGTGCTTGG - Intergenic
982717117 4:158820695-158820717 GACAGTTATCACTGGGTGCTTGG - Intronic
983772827 4:171571900-171571922 AACATTTATCACTGTAACCTGGG + Intergenic
984264372 4:177479048-177479070 AATATTTTTCACTATTAGCTTGG + Intergenic
985179621 4:187243346-187243368 AACACTTATTTCTTTGTGCTGGG + Intergenic
989491969 5:42067450-42067472 AAAATTTATCTTTATGTGCCTGG + Intergenic
990024727 5:51172685-51172707 AACAATTTACAGTATGTGCTGGG - Intergenic
990847585 5:60160976-60160998 AAAATTCATCATGATGTGCTGGG + Intronic
992986954 5:82240408-82240430 AACATTTGTCTTTCTGTGCTTGG - Intronic
993050051 5:82916115-82916137 AACAATTACCATTATGTGGTAGG - Intergenic
993362469 5:86994824-86994846 AACATTTATCAGTTTCTTCTAGG + Intergenic
993456261 5:88130971-88130993 AACAGCTTGCACTATGTGCTTGG - Intergenic
993489269 5:88526350-88526372 AATATTTAACAATATGTTCTGGG + Intergenic
993619802 5:90154698-90154720 AACATTAATAAATATTTGCTGGG + Intergenic
994010328 5:94894828-94894850 AACATTTGTCTCTAGGTGCCAGG - Exonic
995030647 5:107477011-107477033 CATTTGTATCACTATGTGCTAGG + Intronic
995175600 5:109172985-109173007 AAGCTTTATCACTATATGTTTGG + Intronic
996139558 5:119889491-119889513 GACATTTATCTTTATGTGCTTGG + Intergenic
997096384 5:130918119-130918141 AACATTTGTCTCTTTTTGCTTGG - Intergenic
997128954 5:131257423-131257445 AACATGTATATCTCTGTGCTAGG + Intronic
1001715752 5:173814471-173814493 AACATTTATTTCTATGTTATTGG + Intergenic
1003777018 6:9378702-9378724 AATATTTATTACTATGTTATGGG + Intergenic
1004303481 6:14479028-14479050 AACACTTAGCACACTGTGCTGGG + Intergenic
1004618293 6:17311179-17311201 AGTATTCATCATTATGTGCTGGG + Intergenic
1007641832 6:43346858-43346880 AGTATTCATTACTATGTGCTGGG + Intronic
1007748090 6:44055471-44055493 AACACATAGCACTATGTGCCAGG - Intergenic
1008586377 6:52954198-52954220 AACAGTCATCACTATGAGCACGG - Intergenic
1008924048 6:56873607-56873629 AATATTTTTCTCTTTGTGCTTGG - Intronic
1009337475 6:62510187-62510209 ATTATTGATCACTATGTGCCAGG + Intergenic
1011908578 6:92405800-92405822 AGTATTTATCTCTCTGTGCTTGG + Intergenic
1012837110 6:104282795-104282817 AACATTTGTCTTTCTGTGCTTGG - Intergenic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1014389170 6:120839685-120839707 AACATTGATCAGTATGAGATTGG + Intergenic
1015939328 6:138432428-138432450 AACATTGATCACGCTGTGCCTGG + Exonic
1018264874 6:162013586-162013608 CACAGTTATCACTATGCACTTGG - Intronic
1018539170 6:164858907-164858929 AACATATATCAGTCTTTGCTAGG - Intergenic
1021658734 7:22897587-22897609 CACTGTTATTACTATGTGCTAGG - Intergenic
1022054099 7:26711386-26711408 AACATATCTCACTATCTGCAAGG - Intronic
1023749454 7:43357456-43357478 AATATTTATCTTTCTGTGCTTGG - Intronic
1023804142 7:43859323-43859345 AACATCTTGCACTGTGTGCTTGG + Intergenic
1024408334 7:49008771-49008793 AGCATTTAGAAATATGTGCTAGG - Intergenic
1026209023 7:68286694-68286716 AACATTTGTCCTTATGTGCTTGG - Intergenic
1026858923 7:73772275-73772297 AACTTTTATTTCTTTGTGCTGGG + Intergenic
1027945540 7:84740701-84740723 CTCATTTATCTCTATGTACTTGG - Intergenic
1028328824 7:89562564-89562586 AACAGTTGTTACTATGGGCTTGG - Intergenic
1029021441 7:97368980-97369002 AATATTTATGACTGTGTGTTGGG - Intergenic
1030363554 7:108621406-108621428 AACATTGCTTACTATGTGCCAGG + Intergenic
1030956610 7:115860707-115860729 CACATCTAACACTATGTGCCAGG + Intergenic
1031328863 7:120437604-120437626 AACATTTATCTCTAGGGGGTTGG - Intronic
1032555755 7:132833040-132833062 AGTATTTATTACTTTGTGCTAGG + Intronic
1032977471 7:137242032-137242054 AACATTTCTGTCTATGTTCTGGG - Intronic
1033002817 7:137525860-137525882 AACATTTCTGACAAGGTGCTGGG + Intronic
1033476279 7:141696317-141696339 AAAATTCATCACTATTTCCTAGG + Intronic
1033880104 7:145870733-145870755 AACATTTAGAAATATGTTCTTGG + Intergenic
1035792234 8:2317548-2317570 AATGTTTATTACTATGTGATAGG - Intergenic
1035800571 8:2404157-2404179 AATGTTTATTACTATGTGATAGG + Intergenic
1036079492 8:5539531-5539553 AAGATTAATATCTATGTGCTGGG + Intergenic
1036572861 8:9997284-9997306 CTCATTTATCTCTATGTCCTCGG + Intergenic
1041348674 8:56927515-56927537 AGCATTTATCAATATCTGCAGGG + Intergenic
1041681793 8:60601289-60601311 AACATTAATTATTATTTGCTAGG - Intronic
1041992041 8:64005099-64005121 AACATTTGTCTTTCTGTGCTTGG + Intergenic
1041996486 8:64066275-64066297 AATATTTATCTATCTGTGCTTGG - Intergenic
1042460312 8:69058157-69058179 AATATTTAGCACTTTGTGCCAGG + Intergenic
1042634609 8:70859999-70860021 AATATTTATTTCTATGTGTTGGG - Intergenic
1042660679 8:71150926-71150948 ATCATTAATCACTTTGTGCATGG - Intergenic
1043804509 8:84654679-84654701 AACATTTATCTTTCTGTGCCTGG + Intronic
1044327103 8:90870814-90870836 AACATTTATTGCTATGTGCCAGG - Intronic
1044629260 8:94262951-94262973 AATATTTAGCACAATCTGCTTGG - Intergenic
1044993628 8:97818332-97818354 ACCATTCAACACTATGTGTTTGG - Intronic
1045999335 8:108400635-108400657 AACATTTATTTCTTTGTGTTGGG + Intronic
1046801324 8:118431394-118431416 AACTTTTATCACTACTTGCAGGG + Intronic
1046878396 8:119280680-119280702 ATTATATATTACTATGTGCTAGG - Intergenic
1047056350 8:121168863-121168885 AGCAGTTATCACTCTGTGCATGG + Intergenic
1047601598 8:126431219-126431241 AGCATTTATCAGGCTGTGCTTGG + Intergenic
1048286981 8:133149567-133149589 AATATTTAACTCTACGTGCTAGG - Intergenic
1050770238 9:9189697-9189719 ACCATTTATCACTGTATGCTAGG - Intronic
1051110849 9:13633908-13633930 AATATTTATCTTTCTGTGCTTGG - Intergenic
1052009185 9:23385829-23385851 GACATTTATCTCTCTGTGCCTGG - Intergenic
1052319140 9:27149053-27149075 AACCTTTATTACTATGGGCTGGG - Intronic
1053652152 9:40179562-40179584 AACATTGGTCATTATGTCCTGGG - Intergenic
1053874514 9:42529663-42529685 GACATTTTGCACCATGTGCTTGG - Intergenic
1053902546 9:42808876-42808898 AACATTGGTCATTATGTCCTGGG - Intergenic
1054532432 9:66196644-66196666 AACATTGGTCATTATGTCCTGGG + Intergenic
1055727825 9:79250585-79250607 AATATTTATAAATATTTGCTTGG - Intergenic
1056310359 9:85334558-85334580 AACCTTTAGAGCTATGTGCTTGG + Intergenic
1056464868 9:86843638-86843660 CATATTTTTCACTAGGTGCTAGG - Intergenic
1057249393 9:93487921-93487943 AACATTCATCACTCTCTCCTGGG + Intronic
1059391161 9:114000438-114000460 AAAATTTATGACTTTGTGTTGGG - Intronic
1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG + Intronic
1186054757 X:5637641-5637663 GACATTTATCTCTTTGTCCTTGG - Intergenic
1186626092 X:11295428-11295450 AAAATATATCACTATGTATTGGG - Intronic
1187396319 X:18922601-18922623 AACATTTATCATTTTGTGACTGG - Intronic
1188134268 X:26474907-26474929 ACCACTTAAGACTATGTGCTTGG + Intergenic
1188961163 X:36493462-36493484 AATATTTAACAATATGTGGTTGG - Intergenic
1190944511 X:55078218-55078240 AACATTTGTCACTATTTTCACGG - Intronic
1190945754 X:55092151-55092173 AACATTTGTCACTATTTTCACGG - Intronic
1194942243 X:100025136-100025158 AATATTTGTCTCTCTGTGCTTGG - Intergenic
1197098337 X:122621858-122621880 AATATTTATCTTTCTGTGCTCGG - Intergenic
1198018599 X:132636043-132636065 AACATGTATCACAATGTGCTGGG + Intronic
1198527510 X:137516698-137516720 AAAATTTTTTAGTATGTGCTGGG + Intergenic
1198813110 X:140556457-140556479 AATATTTATCTTTCTGTGCTTGG - Intergenic
1199193844 X:145003833-145003855 AACACATAAAACTATGTGCTTGG - Intergenic
1199429679 X:147745071-147745093 ATCATTTTTATCTATGTGCTAGG - Intergenic
1199529267 X:148828779-148828801 AACATATATGACCATGTGCAGGG - Intronic
1199552730 X:149076339-149076361 AACATTTAGCAGCATGTGGTTGG + Intergenic
1200294104 X:154900627-154900649 AACATTTTTCACTAGGTGGAAGG - Intronic
1201616678 Y:15908290-15908312 AATATTCAACACTATGGGCTTGG - Intergenic