ID: 1013607587

View in Genome Browser
Species Human (GRCh38)
Location 6:111764858-111764880
Sequence GCAGGGAAGGGAAGGAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 862
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 786}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013607587_1013607601 27 Left 1013607587 6:111764858-111764880 CCTGAATTCCTTCCCTTCCCTGC 0: 1
1: 0
2: 4
3: 71
4: 786
Right 1013607601 6:111764908-111764930 TGCTGGCAGCTGGAGGCAGGAGG 0: 1
1: 1
2: 9
3: 99
4: 898
1013607587_1013607594 10 Left 1013607587 6:111764858-111764880 CCTGAATTCCTTCCCTTCCCTGC 0: 1
1: 0
2: 4
3: 71
4: 786
Right 1013607594 6:111764891-111764913 TCTCTCTTGTTCCCCTTTGCTGG 0: 1
1: 0
2: 2
3: 37
4: 303
1013607587_1013607600 24 Left 1013607587 6:111764858-111764880 CCTGAATTCCTTCCCTTCCCTGC 0: 1
1: 0
2: 4
3: 71
4: 786
Right 1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG No data
1013607587_1013607596 20 Left 1013607587 6:111764858-111764880 CCTGAATTCCTTCCCTTCCCTGC 0: 1
1: 0
2: 4
3: 71
4: 786
Right 1013607596 6:111764901-111764923 TCCCCTTTGCTGGCAGCTGGAGG 0: 1
1: 1
2: 2
3: 40
4: 288
1013607587_1013607595 17 Left 1013607587 6:111764858-111764880 CCTGAATTCCTTCCCTTCCCTGC 0: 1
1: 0
2: 4
3: 71
4: 786
Right 1013607595 6:111764898-111764920 TGTTCCCCTTTGCTGGCAGCTGG No data
1013607587_1013607602 28 Left 1013607587 6:111764858-111764880 CCTGAATTCCTTCCCTTCCCTGC 0: 1
1: 0
2: 4
3: 71
4: 786
Right 1013607602 6:111764909-111764931 GCTGGCAGCTGGAGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013607587 Original CRISPR GCAGGGAAGGGAAGGAATTC AGG (reversed) Intronic
900173829 1:1283334-1283356 CCAGGGAAGGGAGGGAGTGCTGG + Intronic
900853360 1:5161603-5161625 GCAGGGCAGGGAAGGGAGTGTGG - Intergenic
901081584 1:6586900-6586922 GCAGGGAAGGCAGGGAAGGCAGG - Intronic
901610706 1:10495718-10495740 ACAGGTAAGCGATGGAATTCTGG + Intronic
902632972 1:17716691-17716713 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
903370390 1:22831593-22831615 GCAGAGCAGGGCAGGAATCCAGG + Intronic
903831631 1:26178606-26178628 CCGGGTAAGGGCAGGAATTCAGG + Intronic
904336604 1:29802065-29802087 TCAGGGAGGGGTTGGAATTCTGG - Intergenic
904410467 1:30321975-30321997 GCAAGGAGGGGCTGGAATTCTGG + Intergenic
904464031 1:30697574-30697596 GCAGGGAGGGGCTGGAATTCTGG + Intergenic
905191211 1:36236497-36236519 GAAGGGAGGGGAAGGAAGACTGG - Intronic
905215801 1:36406652-36406674 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
905229642 1:36507216-36507238 GCACGGAAGGGGAGGAATCAGGG + Intergenic
905549155 1:38822354-38822376 GCAGGGAAGGGAATCATCTCAGG + Intergenic
905693391 1:39958449-39958471 GCAGTGGAGGGAAGCAATTAAGG + Intronic
905734934 1:40318142-40318164 GGAGGGAAGGGAAGGCTCTCTGG - Intergenic
906228846 1:44143131-44143153 GTATAGAAGGGAAGGACTTCAGG - Intergenic
906300505 1:44678110-44678132 GTTGGGAAGGGAAGGAAGGCTGG + Intronic
906515185 1:46434845-46434867 CAAGGGAAGGGAAGGATTCCTGG + Intergenic
906531715 1:46527389-46527411 GTTGGGGAGAGAAGGAATTCTGG - Intergenic
906611701 1:47208463-47208485 GGAGGGAAGGGAAGCAAGCCTGG - Intergenic
906772134 1:48494704-48494726 GTAGGGAAGGGAAGGATCTGGGG - Intergenic
907038669 1:51238222-51238244 GCTGGGAAGGAAGGGAATGCTGG - Intronic
907108684 1:51906868-51906890 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
907530018 1:55085731-55085753 CCAGGGTAGGCCAGGAATTCAGG - Intronic
907558057 1:55362347-55362369 GCAGGGAAGGGAATGAGATTAGG + Intergenic
907588116 1:55639687-55639709 GCAGGGAAGTGAAGAAATGCTGG + Intergenic
907911810 1:58833747-58833769 GAAGGGTAGGGAGGGAATTGTGG + Intergenic
907965271 1:59322855-59322877 ACAGGGAAAAGAAGGAATCCAGG - Intronic
908039805 1:60099187-60099209 ACAGAGAAAGGAAGGAATACAGG - Intergenic
909457967 1:75871147-75871169 GCAGGAAAGAGAAGGAATGCAGG + Intronic
910246188 1:85140962-85140984 GCAGGGAAGTGAAGGATTTCAGG - Intergenic
910995559 1:93100990-93101012 CCAGGGAAGGGAAGAAATTGTGG + Intronic
911292833 1:96079102-96079124 GCAGAGAAAAGAAGGACTTCTGG - Intergenic
912371889 1:109179972-109179994 GCAGAGGAGGGAGGGAATGCTGG + Intronic
913004910 1:114620028-114620050 GCAGGGAAGGAAAGGAAGAGTGG + Intronic
913045981 1:115073810-115073832 GTAGGGAAGGAAAGGAAGCCGGG - Intronic
913300064 1:117360921-117360943 GGAGGGAAGGGAAGGAAAGGAGG - Intergenic
913412231 1:118564619-118564641 GCAGGGAAAGGAAGGGCTACAGG + Intergenic
913698164 1:121347888-121347910 GCATGGAAAGGCAGGAATGCAGG + Intronic
914139385 1:144932164-144932186 GCATGGAAAGGCAGGAATGCAGG - Intronic
914675362 1:149903989-149904011 GCAGGGGAGGGAAAGAAACCAGG - Exonic
914775793 1:150733842-150733864 GCAGAGTAGGTAAGGAATACAGG - Intronic
915230697 1:154443428-154443450 ACAGGGCAGAGAGGGAATTCAGG - Intronic
915683379 1:157605101-157605123 TCAGGGAAGGGAAGAATTTGTGG - Intergenic
915756657 1:158267497-158267519 GTGGGGAAGGGAAGGAAGTGGGG + Intergenic
916560439 1:165930163-165930185 GGAGGGAAGGGAAGGGGTTGGGG + Intergenic
917206586 1:172580191-172580213 GCAAGGAAGGCAAGGAAGGCAGG - Intronic
917881573 1:179342248-179342270 GAAGGGAAGGGAAGGGAATGGGG - Intronic
917978877 1:180257109-180257131 GCAGGGAAGGAGAGGACTTGAGG + Intronic
918008254 1:180562229-180562251 GCAGACAAGGGAAGTAACTCAGG + Intergenic
918495111 1:185126661-185126683 GTAGAGAGGGGAAGGTATTCTGG + Intronic
918565040 1:185919145-185919167 GAAGGGAAGGGAAAGAAATATGG + Intronic
918795537 1:188889804-188889826 GAAGGGAAGAAAAGGAATACAGG + Intergenic
919749225 1:201026168-201026190 GGAGGGAAGGAAAGGAAAGCTGG - Intergenic
920029083 1:203025883-203025905 GCAGGGTAAGGGAGCAATTCAGG + Intergenic
920061733 1:203231458-203231480 GCAGGGAAAGGGAGGACTTAGGG - Intronic
920365570 1:205446635-205446657 GGAGTTAAGGGAAGGAAATCAGG + Intronic
920485563 1:206366538-206366560 GCATGGAAAGGCAGGAATGCAGG + Intronic
920737083 1:208542613-208542635 GCAGAGAAGGGGAGGAAGTCTGG - Intergenic
920983631 1:210862982-210863004 GAAGGTAAGAGAAGGGATTCAGG + Intronic
921465674 1:215484164-215484186 AGAGGGAAGAGAAGGAAGTCAGG + Intergenic
921653481 1:217706426-217706448 GAAGGGAAGTGATGGGATTCTGG + Intronic
922188608 1:223297622-223297644 GCAGGGGAGGGAAGGCTCTCTGG - Intronic
922458558 1:225796880-225796902 GGAGGGAAGGAAAGGAAGGCAGG + Intergenic
922575766 1:226659736-226659758 GCAGGGAAGGGAAAGGAAGCTGG + Intronic
923615515 1:235534030-235534052 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
923678243 1:236098477-236098499 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
923678260 1:236098534-236098556 GGAGGGAAGGGAAGGAAGGAAGG + Intergenic
923885508 1:238150893-238150915 GAAGGGAAGGGAAGGAAAGGAGG - Intergenic
924574849 1:245270277-245270299 GAAGGGAAGGGAAGGAAAGAAGG - Intronic
924827105 1:247551176-247551198 GGAAGGAAGGAAGGGAATTCTGG + Intronic
1062815558 10:497366-497388 GCAGGCAGGGGAAGGAATACAGG + Intronic
1062955531 10:1538147-1538169 ACAGGGAAGGGAAGGGAGGCAGG - Intronic
1063410663 10:5834137-5834159 CCAGGAAAGGGAAAGAATTTAGG + Intronic
1063785993 10:9383010-9383032 GCCAGGAAGAGCAGGAATTCTGG - Intergenic
1063916282 10:10886132-10886154 GGAGGGAAGGGTAGGAATGAAGG - Intergenic
1064114706 10:12568196-12568218 GAAGGGAAGGGAAGGAAAGAGGG - Intronic
1064902828 10:20313183-20313205 GCAGGAAAGTGATGGGATTCAGG - Intergenic
1064996322 10:21299796-21299818 GCAGAGAAGAGAAGGACTGCAGG + Intergenic
1065169215 10:23010523-23010545 ACAGGGAAGGGAAGGGAGACAGG - Intronic
1065198129 10:23286546-23286568 GGAGGGAAGGGAAGGAAGGGAGG + Intronic
1065202873 10:23331152-23331174 GAAGGGAAGGGAAGGGAACCGGG + Intronic
1065263824 10:23954581-23954603 GAAGGGAAGGGAAGGAAGGAAGG + Intronic
1065450135 10:25848345-25848367 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
1065811943 10:29450624-29450646 GGAGGGAGGGGAAGGAATCAGGG - Intergenic
1065885370 10:30072135-30072157 GCAGGGAAGGGAAGGGAAGAAGG + Intronic
1065933547 10:30500183-30500205 GGAGGGAAGGGAAGGAAGGAGGG + Intergenic
1065992876 10:31030266-31030288 GCAGTGAAGGGAAGGAAGAAAGG - Intronic
1066022485 10:31318544-31318566 GAAGGGAAGGGAAGGGAGTCCGG + Intronic
1066523374 10:36247929-36247951 GAAGGGAAGGGAAGGAAAGAAGG - Intergenic
1066625517 10:37401943-37401965 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1067724550 10:48760051-48760073 GGAGGGAAGGGAAGAAAACCAGG + Intronic
1067845135 10:49713538-49713560 CCAGGGCAGGGAAGGAACCCAGG + Intergenic
1068024615 10:51627862-51627884 GAAGGGAAGGGAAGGAAGGAAGG - Intronic
1068269196 10:54697738-54697760 GCAAGGAAGGCAAGGAAGGCCGG + Intronic
1068388381 10:56360717-56360739 GCAAGGAAGGGGAAGAATGCTGG + Intronic
1069362713 10:67661317-67661339 GGAAGGAAGGGAAGAAAGTCAGG + Intronic
1069449074 10:68501589-68501611 GAAGGGAAGGGAAGGAATGTTGG + Intronic
1069785029 10:70982285-70982307 GAAGGGAAGGGAAGGTCTTAGGG - Intergenic
1069813118 10:71177161-71177183 GCAGGGAAGGCAAGGGCTTTGGG + Intergenic
1070065294 10:73027751-73027773 GGAGGGAAGGGAAGGAAGGAAGG + Intronic
1070405473 10:76090836-76090858 GCTGGGAAGAGAAGGAAATGGGG + Intronic
1070487009 10:76941154-76941176 GGAGGGAAGGGAAGGAAGGAAGG + Intronic
1070511688 10:77167122-77167144 GCAGGGAAGGGTAGGAAGGAGGG - Intronic
1070765180 10:79052324-79052346 GTAGGAAACGGAATGAATTCAGG + Intergenic
1070826265 10:79392062-79392084 GCAGGGAAGGGAAGCTAGACGGG - Intronic
1070832114 10:79424497-79424519 GAAGGGGAGGGAATGGATTCTGG - Intronic
1071699978 10:87921209-87921231 GCAGGCAAGGCAAGGAAGGCAGG - Intronic
1072532147 10:96329764-96329786 GAAGGGCAGGGAAGGGATCCTGG + Intronic
1072628461 10:97129626-97129648 GCAGGGGAGGGAAGGTATGGCGG - Intronic
1072636236 10:97180191-97180213 GCAGGGATGTGAAGGAAATTTGG - Intronic
1072680402 10:97501711-97501733 TCAGAGAAGGGAAAGAAATCAGG - Intronic
1073085626 10:100886754-100886776 GCAGGGAATTGGAGGAATTTGGG - Intergenic
1073491500 10:103855763-103855785 GCAGGGAAGGGAAGGGAGGGAGG + Intergenic
1073626564 10:105103575-105103597 GGAGGGAAGAGAAGAAACTCTGG + Intronic
1073662242 10:105489232-105489254 GAAGGGAAGGGAAGGAAGGGAGG + Intergenic
1074218200 10:111408935-111408957 GAAGGGAAGGGCTGAAATTCAGG - Intergenic
1074845009 10:117390031-117390053 CCAGGGAAGGTAAGTAACTCTGG + Intergenic
1075403980 10:122182139-122182161 GCAGAGCAGGGAAAGAACTCTGG + Intronic
1075482712 10:122796280-122796302 GGAGGGAAGGGAAGGAAGGAAGG + Intergenic
1075906948 10:126089786-126089808 GCATGGAAGGAAGGGAGTTCAGG - Intronic
1076012937 10:127004906-127004928 GCAGGGAGGGCAAGGTAGTCTGG - Intronic
1076210083 10:128633032-128633054 CCAGGGAAGGGAACAAATTGAGG + Intergenic
1076462779 10:130657669-130657691 GCAGGGGAGTTAAGGAAATCAGG + Intergenic
1077420009 11:2445591-2445613 GCAGAGGAGGGAAGGAAGTGGGG + Intronic
1077459887 11:2703787-2703809 GCAGGGTAGGGAGAGAATTGAGG - Intronic
1077630423 11:3807896-3807918 TCAGGGTAGGGAGGGAACTCTGG + Intronic
1078136115 11:8653163-8653185 GCAGGGAGGGGAAGAATTTGTGG - Intronic
1078347319 11:10562247-10562269 GCAGAGAAGGGAAGGAAGATGGG + Intronic
1078421161 11:11214133-11214155 GGAAGGAAGGGAAGGAATGTGGG + Intergenic
1078923621 11:15854368-15854390 GGAGGGAAGGGAAGGAAGGAAGG + Intergenic
1079075930 11:17385722-17385744 GCAGGGGAGGGACGGAAGGCTGG - Intergenic
1079327982 11:19510871-19510893 GCAAGGAAGGGGAGGACTTAGGG + Intronic
1079613504 11:22462373-22462395 GAGGAGCAGGGAAGGAATTCAGG - Intergenic
1080021809 11:27569430-27569452 GCAGGGCAGAGATGGAAGTCAGG - Intergenic
1080050205 11:27851835-27851857 GGAAGGAAGGGAAGGAATGAAGG - Intergenic
1080438555 11:32268957-32268979 GGAGGGAAGGGAAGGAAAGTGGG + Intergenic
1080941377 11:36922086-36922108 GCTAGGAAGGGAAGGGAATCAGG - Intergenic
1081003821 11:37708708-37708730 GAGGGGAAGGCAAAGAATTCTGG - Intergenic
1081849637 11:46265995-46266017 GCAGGGCAGGGAAGGAAGCTGGG + Intergenic
1081862164 11:46339451-46339473 TGAGGGGAGGGAAGGAGTTCCGG - Intronic
1082608109 11:55266892-55266914 GAATGGAAGGAAATGAATTCAGG + Intronic
1083174334 11:60939753-60939775 GCAGGCAAGGAAAAGAATGCTGG + Intronic
1083328459 11:61885652-61885674 GCAGGGCAGGGAGGGATTTTGGG + Intronic
1084360669 11:68666986-68667008 GCAGGGAAGACAAGGAGTGCGGG + Intergenic
1085105354 11:73837749-73837771 GCAGGAAAGGAAAGGAAGTTAGG - Intronic
1085392312 11:76188808-76188830 GCAGAGGAGGGAAGGAGTGCTGG + Intronic
1085401850 11:76240205-76240227 GCGGGGAAGGGAAGAAATGGAGG + Intergenic
1085596098 11:77811578-77811600 GCAGGCAAGGGAAGGAAGATGGG + Intronic
1086020280 11:82220118-82220140 GTAGGGCAGGGAAGACATTCAGG - Intergenic
1086314910 11:85581043-85581065 TCAGGGAAGGGAAGAAATAGGGG + Intronic
1086702498 11:89915640-89915662 GAATGGAAGGAAATGAATTCAGG - Intronic
1086703669 11:89928810-89928832 GAATGGAAGGAAATGAATTCAGG + Intergenic
1086823325 11:91463844-91463866 GCAGGGTAGGGAAGGAAATGGGG - Intergenic
1087203856 11:95373408-95373430 GCAGGGAGGAGAGGGAATTCTGG + Intergenic
1087230610 11:95657696-95657718 GGAGGAAAGGGAAGGAATAAAGG - Intergenic
1088164108 11:106911075-106911097 GGAAGGAAGGGAAGGAATAAAGG + Intronic
1088457079 11:110043975-110043997 GAAGGGAAGGGAAGGAAGGAGGG + Intergenic
1088895109 11:114072537-114072559 GCAGGAAAGGGAAGGAGCTCTGG - Intronic
1089291190 11:117438838-117438860 GAAGATAGGGGAAGGAATTCTGG - Intronic
1089614390 11:119687066-119687088 GCATGGAAGGGAAGCAGGTCAGG + Intronic
1089615449 11:119692318-119692340 GGAGGGAAGGGAAGGGAAGCAGG - Intronic
1089620463 11:119719281-119719303 GCAGGGGTGGGAAGAGATTCTGG + Intronic
1090078433 11:123594185-123594207 GAGGGGATGGGAAGGAAGTCTGG + Intronic
1090262541 11:125331769-125331791 GCAGGGAAGGCAAGAAGTGCAGG - Intronic
1090569550 11:128031266-128031288 GAAGGGAAGGGAAGGAGTCTGGG + Intergenic
1090648251 11:128783939-128783961 GAAGGGAAGGGAAGGAAGATAGG + Intronic
1090959910 11:131546946-131546968 GAAAGGGAGGGAAGGAACTCAGG - Intronic
1091844235 12:3643051-3643073 GAAGGGAGGTGAAGGGATTCGGG + Intronic
1092140523 12:6180424-6180446 AAAAGGAAGGGCAGGAATTCAGG + Intergenic
1092161046 12:6315733-6315755 GGAGGGAGGGGCAGGATTTCAGG + Intronic
1092277790 12:7075325-7075347 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1092597382 12:10022405-10022427 GCAGGGAAAGGAAGGAAGGAAGG - Intergenic
1092981586 12:13799866-13799888 GCAGGGCAGGGAGAGAACTCAGG + Intronic
1093096082 12:14973719-14973741 GCTGGGAAGGGAAGTACTGCTGG - Intronic
1093108412 12:15118140-15118162 GCAGGCAAGGGAAGGAAATGGGG - Intronic
1093269456 12:17041481-17041503 GGAGGAAGGTGAAGGAATTCTGG - Intergenic
1094544670 12:31393357-31393379 GCCAGGAAGGGAGGGAGTTCTGG - Intronic
1094716767 12:33021701-33021723 GAAGGGAAGGGAAGGGAATAGGG - Intergenic
1095275853 12:40282006-40282028 GAAGGGAAGGGAAGGGAAGCGGG - Intronic
1095399826 12:41801323-41801345 GAAGGGAAGGGAAGGAAGGGAGG + Intergenic
1095506253 12:42902240-42902262 GCAGGGCAGGGAAGGAAACCTGG - Intergenic
1095540559 12:43304429-43304451 GAAGAGAAGGGAAGTACTTCAGG - Intergenic
1095817104 12:46435826-46435848 GCAGGGATTGGAGGGAAGTCAGG + Intergenic
1095946564 12:47757246-47757268 GCAGGGAGGGGAAAGAATGGTGG - Intronic
1096487754 12:51995057-51995079 GATGGGCAGGGAAGGAATCCTGG + Intronic
1096656659 12:53096725-53096747 GGAGGGAAGGAAACGGATTCTGG + Intergenic
1097101268 12:56591299-56591321 GCTGGGAAGGGAGGGAAAGCTGG - Exonic
1097181030 12:57172002-57172024 GGAGGGGAGGGCAGGAATGCAGG - Intronic
1098417210 12:70247890-70247912 TCAAGGAAGTGAAGGAATACAGG - Intronic
1099134894 12:78885263-78885285 GGAGGGAAGGGAAGGAAGGAGGG + Intronic
1099274501 12:80558054-80558076 GAAGGGAAGGGAAGGAAGGGAGG - Intronic
1099802724 12:87476964-87476986 GCAAGGAGGGGAAGGAATAAAGG - Intergenic
1100009847 12:89939988-89940010 ACAGGGAAGGGAAAGCAGTCAGG - Intergenic
1100200699 12:92294910-92294932 GCACAGAAGGGAAGGCAGTCAGG - Intergenic
1100312573 12:93410922-93410944 GGAGGGAAGTGAAGCAGTTCTGG - Intronic
1101140690 12:101792629-101792651 TGAGGGAAGGGAGGGAATTGAGG - Intronic
1101502630 12:105318462-105318484 GATTGGAAGGGAAGGAATTCTGG - Intronic
1101741090 12:107500608-107500630 GCAGGGCAGGGAGGAAACTCTGG - Intronic
1101925975 12:108971681-108971703 GAAGGGAAGGAAGGTAATTCAGG + Intronic
1102022403 12:109692992-109693014 ACAGGGAAGGGAAGGAAGCCAGG - Intergenic
1102588614 12:113940704-113940726 GCAGGGAAGGGAAGGAGCCCAGG - Intronic
1102768405 12:115452332-115452354 GCTGGGGAGGGAGGGAATTTAGG - Intergenic
1103664497 12:122552241-122552263 CCAGGGAGGGGAAGGGATTCTGG + Intronic
1103956788 12:124581925-124581947 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
1103984815 12:124760244-124760266 GCAGGGGAGGGGAGGAAGTGAGG + Intergenic
1104134484 12:125924230-125924252 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1104374468 12:128251678-128251700 GCAGGGAAGGGAAAGCCTGCAGG - Intergenic
1105709089 13:22988572-22988594 GGAGGGAATGGAAGGAAGTGTGG + Intergenic
1106304813 13:28500336-28500358 GCAGAGAAGAGAAGGCATTCTGG + Intergenic
1106524093 13:30524497-30524519 GCAGGAGAGGGAATGAATGCAGG + Intronic
1106551801 13:30778244-30778266 GCAGCAAAGGGAGGTAATTCAGG + Intergenic
1107318271 13:39158214-39158236 GAGGGAGAGGGAAGGAATTCAGG + Intergenic
1107780775 13:43899903-43899925 GCAGGGAAGGGTAGAAGTTTTGG + Intergenic
1108075309 13:46673254-46673276 GCAGGGAACGGAAAGAACACAGG - Intronic
1108436557 13:50406706-50406728 GAAGGGAAGGGAAGGAAGGAAGG - Intronic
1108798297 13:54061104-54061126 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1109138211 13:58680250-58680272 GCAGGGAAGGCTAGCAAGTCAGG - Intergenic
1109281096 13:60356478-60356500 GGAGGGAAGGAAAGGAATGAAGG + Intergenic
1109865727 13:68260746-68260768 GCTGGGAAGAGAAGGAACCCAGG + Intergenic
1110303492 13:73956941-73956963 GGAGGGAAGGGAAGGAAAAAAGG + Intronic
1111203360 13:84969628-84969650 GCTGGGAAGGGAAGGAAGGAAGG - Intergenic
1111776020 13:92662852-92662874 GCAAGGAAGAGAAGGAAGTCAGG - Intronic
1112727938 13:102326685-102326707 GAAGGGAAGGGAAGGAAGGAAGG + Intronic
1112849351 13:103685659-103685681 GAAGGGAAGGGAAGGAGCCCTGG + Intergenic
1112859673 13:103814826-103814848 GCACTGGAGGGAAGAAATTCTGG + Intergenic
1113381604 13:109810790-109810812 GCAAGGCTGGGAAGGAATGCTGG - Intergenic
1113735317 13:112674264-112674286 GCTGAGAAAGGAAGGAAATCTGG + Intronic
1114979149 14:28140614-28140636 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1115389932 14:32842798-32842820 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
1115518474 14:34209058-34209080 GCAGGGGAGGGAAGGAAGAGGGG - Intronic
1115939227 14:38589964-38589986 GAAGGGAAGGGAAGGAAGAAAGG + Intergenic
1116174336 14:41447861-41447883 GAAGAGAAGAGAAGGTATTCAGG + Intergenic
1116284180 14:42950511-42950533 GGAGGGAAGGGAAGGAAGGAAGG + Intergenic
1117968171 14:61226881-61226903 GAAGGGAAGGCAAGGAATGATGG - Intronic
1118120163 14:62830919-62830941 GCGAGGAAGGGAAGGAAGTAAGG - Intronic
1118133228 14:62991328-62991350 GAAGGTTAGAGAAGGAATTCTGG + Intronic
1118893539 14:69927972-69927994 GCAGGGAAGAGAAGGCAGTGGGG + Intronic
1118997465 14:70849659-70849681 GGAGGGAAGAGATCGAATTCTGG + Intergenic
1119199941 14:72744752-72744774 GCAGGGACAGAAAGGAATACAGG + Intronic
1119484148 14:74977474-74977496 GCAGAGAAGGGAAGGAGCTTGGG - Intergenic
1119764343 14:77179069-77179091 GGAGGGAAGGGAAGGAAGGGAGG - Intronic
1119889295 14:78170684-78170706 GCGGGGAAAGGAAGGCAGTCAGG + Intergenic
1120187950 14:81414095-81414117 GGAGGGAGGACAAGGAATTCTGG + Intronic
1120315090 14:82882084-82882106 GCACAGTAGGGCAGGAATTCTGG - Intergenic
1120522961 14:85546299-85546321 AAAGGGAAGTGAAGGAATTAAGG - Intronic
1120583915 14:86287362-86287384 GAAGGGAAGGGGAGGAATGAAGG + Intergenic
1120880737 14:89413740-89413762 GAAGGGAAGGGAAGGAAGAAGGG + Intronic
1120938153 14:89918959-89918981 GCATGAAATGGAAGGCATTCTGG + Intronic
1121623706 14:95369511-95369533 GCAAGGCAGGGCAGGAACTCAGG - Intergenic
1121830024 14:97043489-97043511 GCTGGGAAGTGAAGGAAGTCAGG + Intergenic
1121850288 14:97215602-97215624 GGAGGGAAGGGAAGGAAGGAAGG + Intergenic
1122496560 14:102160443-102160465 GCAGAGATGGGAAGGAATTGAGG + Intronic
1122771155 14:104098554-104098576 GGTGGGAAGGGAAGGAAGTACGG + Intronic
1122874091 14:104655239-104655261 GGAGGGAAGGGAAGGAAGGATGG + Intergenic
1124069525 15:26378543-26378565 GGAAGGAAGGGAAGGAAATAAGG - Intergenic
1124097908 15:26666616-26666638 GCAGGGCAGGGCAGGAACTAGGG + Intronic
1124436519 15:29653583-29653605 GCAGGAAGGAGAAGGAATGCAGG - Intergenic
1124969821 15:34476349-34476371 GCAAGGAAGACAAGGAAGTCAGG - Intergenic
1125021333 15:34989588-34989610 GAAGGGAAAGGAAAGACTTCTGG + Intergenic
1125685358 15:41560193-41560215 TCAGGGAAGGGAAGGGAAACGGG + Intronic
1125750094 15:42022000-42022022 GCAGGGCAAGGAAGGAAGCCAGG - Intronic
1126000507 15:44205134-44205156 GAAGGGAAGGGAAGGAAGGTAGG + Intergenic
1126490436 15:49230439-49230461 GCAAGGAAGGAGAGGAAATCAGG - Intronic
1126893456 15:53232480-53232502 GCTGGGTAGGGAAGGAGTTAGGG + Intergenic
1127267546 15:57374170-57374192 GAAGGGAAGGGAAGGAAACGGGG - Intergenic
1127340474 15:58038132-58038154 GAAAGGAAGGGAAGGAAGTAGGG - Intronic
1128019824 15:64380844-64380866 ACAGGGCAAGGAAGAAATTCGGG + Intronic
1128070292 15:64791537-64791559 GAAGGGAAGGGAAGGAGCTTAGG - Intergenic
1129054448 15:72808986-72809008 ACAGGGAAGGGGAGGAAGTCAGG + Intergenic
1129153745 15:73704733-73704755 GGAGGCATGGGCAGGAATTCTGG + Intronic
1129550656 15:76445540-76445562 TCAGGTGAGGGCAGGAATTCAGG + Intronic
1129740674 15:77988107-77988129 GCAGGGAAGGGGAGGGCTCCAGG + Intronic
1130090410 15:80816232-80816254 GCAGAGAAGGGAAGCATTTAGGG - Intronic
1130256767 15:82329411-82329433 GCAGGGAAGGGGAGGGCTCCAGG + Intergenic
1130531623 15:84751023-84751045 GCAGGTAAGGCAAGGCTTTCTGG + Intronic
1130598182 15:85260577-85260599 GCAGGGAAGGGGAGGGCTCCAGG - Intergenic
1130735536 15:86544584-86544606 GCAGGCAAGAGAAGGAATACAGG + Intronic
1131160874 15:90104015-90104037 GCAGAGAAGGGAAAGAGGTCAGG - Intergenic
1131701529 15:94942467-94942489 GCAGGGAAGGGAAGGGAGTTGGG - Intergenic
1131760387 15:95616460-95616482 GGTGGGAAGGGAAGGAAGGCAGG - Intergenic
1132119680 15:99166273-99166295 GCAGTTAGGGGAAGGAATCCTGG - Intronic
1132189498 15:99839404-99839426 GCAAGAAAGAGAAGGAAGTCAGG + Intergenic
1132404106 15:101532046-101532068 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1133056402 16:3147565-3147587 GCAGGGAAGGGCAGGTACCCGGG - Intronic
1133272696 16:4618212-4618234 GCTGGGGAGGGAAGGGAGTCAGG + Intronic
1133402651 16:5500090-5500112 GGAGGGAAGGGAGGGAATGGAGG - Intergenic
1133465275 16:6021276-6021298 GCAGGGAAGGGATGGCAGGCTGG - Intronic
1133819761 16:9226126-9226148 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1133819768 16:9226150-9226172 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1133819775 16:9226174-9226196 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1133852349 16:9517338-9517360 ACTGGGAGGTGAAGGAATTCTGG - Intergenic
1134003729 16:10803470-10803492 GCAGGGAGGGAAAGGAGCTCAGG + Intronic
1134128062 16:11629980-11630002 GGAGGGAAGAGAAGGAGTTCGGG + Intronic
1134324429 16:13193999-13194021 GCAGGGTAGGGGAGGAATGTTGG - Intronic
1134348770 16:13416804-13416826 GGAAGGAAGGGAAGGAATGAAGG + Intergenic
1135953723 16:26938547-26938569 CCAAGGAAGGGAAGGAAATATGG - Intergenic
1136010803 16:27362540-27362562 GGAGGGAAGGGAGGGCATTGTGG + Exonic
1136393716 16:29981552-29981574 GCAAGGAAGTCAAGGAATTGGGG + Intronic
1136730337 16:32405915-32405937 GAAGGGAAGGGAAGGGAATATGG - Intergenic
1136730345 16:32405941-32405963 GAAGGGAAGGGAAGGGATGAAGG - Intergenic
1137608179 16:49800868-49800890 ACAGGGAAGGGAAGGAAAAAGGG + Intronic
1137642331 16:50043622-50043644 GAAGAGAAGGAAAGAAATTCTGG - Intergenic
1137705152 16:50530273-50530295 GCAGGGAAGGGAAGCAGATCCGG + Intergenic
1137721569 16:50630498-50630520 GAAGGGGAGGGAAGGGATTCTGG + Intronic
1137824092 16:51474988-51475010 GAAGGGAAGGGAAGGAAAGGGGG - Intergenic
1138506262 16:57479818-57479840 GGAGGGAAGGGAAGGAAGAAGGG - Intronic
1139131181 16:64148191-64148213 GGAGGGAAGGGAAGGAAGGAAGG - Intergenic
1139388819 16:66592308-66592330 GAAGGGAAGGGAAGGAAGGAGGG + Intergenic
1139665728 16:68454108-68454130 GCAGGGAGGGCAAGCAATGCTGG + Intergenic
1139679572 16:68550818-68550840 GAAGGCAAGGGACTGAATTCAGG + Intronic
1140211995 16:72977792-72977814 GGAGGGGAGAGATGGAATTCAGG + Intronic
1140463300 16:75159230-75159252 GAAGGGAAGGGAAGGAAGGAAGG - Intronic
1140765771 16:78155286-78155308 GAAGGGAAGGGAAGAAAGTATGG + Intronic
1140884368 16:79229757-79229779 GAAGTGAAGAGAAGGAATCCCGG - Intergenic
1140963347 16:79939132-79939154 GCAGGCAAGGGAAGAAAATAAGG + Intergenic
1141090840 16:81129342-81129364 GGAGGGAAGGGAAGGAAGGAAGG - Intergenic
1141130904 16:81435902-81435924 GCAATGAAAGGAAGGAATTGGGG - Intergenic
1141181173 16:81754243-81754265 GGAGGGAAGGGAAGGAGGTGGGG - Intronic
1141461774 16:84182109-84182131 CCAGAGAAGGGCAGGAATTTGGG - Intronic
1202996063 16_KI270728v1_random:111392-111414 GAAGGGAAGGGAAGGGAATATGG + Intergenic
1203022750 16_KI270728v1_random:423734-423756 GAAGGGAAGGGAAGGGAATATGG + Intergenic
1142787522 17:2235773-2235795 GAAGGGAAGGGAAGGAATCCTGG + Intronic
1142950018 17:3471181-3471203 GGAGGGAAGGGAAGGAAGGAAGG + Intronic
1143035281 17:3991885-3991907 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1143100062 17:4499783-4499805 GAAGGGAAGGGAAGGAGGCCCGG - Intronic
1143223923 17:5283886-5283908 GAAGGGAAGGGAAGCATTTTTGG + Intronic
1143296713 17:5876718-5876740 GCAAGGAAGCCAAGGATTTCAGG - Intronic
1143456224 17:7069725-7069747 GGCGGGATGGGAAGGATTTCAGG + Intergenic
1144561011 17:16320300-16320322 GAAGGGAAGGGAAGGAAGGAAGG + Intronic
1144572029 17:16406320-16406342 GGAGGGAAGGGAAGGAAGGAAGG + Intergenic
1144719624 17:17459658-17459680 GAAGGGGAGGGAAGAAAGTCTGG - Intergenic
1145090366 17:19980802-19980824 TCGGGGAAGGGCAGGAATTATGG - Intergenic
1145817470 17:27805891-27805913 GCAGGGAAGGGAGGGTGTTCTGG - Intronic
1145924434 17:28635159-28635181 GCAGCGCAGGGAAGGGGTTCCGG + Exonic
1146506652 17:33411536-33411558 GAAGGGAAAGGAAGGTATTATGG + Intronic
1146567712 17:33927797-33927819 GCAGGGGAGGGCAGGAACTGTGG - Intronic
1146623808 17:34420866-34420888 GGAGGGAAGGGAAGGATCCCAGG - Intergenic
1146829830 17:36058822-36058844 GCTGGGCAGGCAAGGGATTCTGG + Intergenic
1147242466 17:39099468-39099490 GCAGGATAGGGAAGGAAATAAGG + Intronic
1147332234 17:39705852-39705874 GCAGTGACCGGCAGGAATTCTGG + Intronic
1148157536 17:45432360-45432382 GCAGAGAAGGGGAGGGATTGGGG + Intronic
1148208929 17:45796505-45796527 GGAGGGAAGGGAAGGCAGGCAGG + Intronic
1148339616 17:46865504-46865526 GCTGGGTAGGGAAGGAAGGCTGG + Intronic
1148396213 17:47310080-47310102 TCAGGGTAGGGAAGGACTTAAGG + Intronic
1148581523 17:48747309-48747331 TCCGGGGAGGAAAGGAATTCGGG + Intergenic
1148598950 17:48879526-48879548 GCTGGGGAGGAAAGGCATTCGGG + Intergenic
1148706390 17:49637154-49637176 GCAGGGCAGGGCAGAGATTCCGG + Intronic
1149331577 17:55588101-55588123 CCAGGGAATGGGAGGAGTTCAGG - Intergenic
1149533553 17:57414928-57414950 ACAGAGAAGGGAAGGATGTCAGG + Intronic
1149551209 17:57541384-57541406 GGAAGAAAAGGAAGGAATTCAGG + Intronic
1149602182 17:57900092-57900114 GCAGTGCAGGGAAGGACCTCAGG + Intronic
1150198066 17:63321841-63321863 GCAGGGCAGGGATGGGAATCTGG + Intronic
1150432744 17:65131558-65131580 GCAGAGAAGGGCAAAAATTCTGG - Intergenic
1151335396 17:73436669-73436691 GCCGGGAAGGGAAGGCAAGCAGG - Intronic
1151440001 17:74122368-74122390 GGATGGAAGGGAAGGAGTTAAGG - Intergenic
1151719240 17:75846199-75846221 ACAGGGAAGGGAAGGAAGGGTGG + Exonic
1151770435 17:76156896-76156918 GGAGGGAAGGGAAGGGATTATGG - Intronic
1151926461 17:77201202-77201224 GCAGGGTATGGAAGGCATTTGGG - Intronic
1152023468 17:77794022-77794044 GGAGGGAAGTGATAGAATTCAGG + Intergenic
1152241176 17:79161985-79162007 ACAGGGATGGGAGGAAATTCAGG + Intronic
1152360386 17:79830676-79830698 TCAGGGAAGAGAAGGAAAGCAGG - Intergenic
1152375785 17:79918335-79918357 GTAAGGATGGGAAGGAAGTCAGG - Intergenic
1152431878 17:80252841-80252863 CCAGGGAAGAGAAGGAAGCCAGG + Exonic
1152635589 17:81429370-81429392 GCAGGGAGGGGAGGGGATCCCGG - Intronic
1152786649 17:82251489-82251511 GCAAGGAACGGCAGAAATTCAGG + Exonic
1152800237 17:82327429-82327451 ACAGGGAAGGGAAGGAGGGCAGG - Intronic
1153166409 18:2266708-2266730 GAAGGGAAAGGAAGAAATACAGG + Intergenic
1153741769 18:8137505-8137527 GAAGGGAAGGGAAGGAAGTTGGG - Intronic
1153880916 18:9421219-9421241 GGAAGGGAGGGAAGGAATCCTGG - Intergenic
1153969815 18:10215964-10215986 GAAGGGAAGGAATGGAAGTCTGG + Intergenic
1154937874 18:21079203-21079225 GCAAGGAAGGGAAGCAGTTCCGG - Intronic
1155058215 18:22204218-22204240 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1155070766 18:22314025-22314047 CCAGGGAAGGGAAGGAGTTGGGG + Intergenic
1155922151 18:31614186-31614208 GGAGGGAAGGGAAGGAAGGGAGG + Intergenic
1156497202 18:37533783-37533805 GCAGAGATGGGGAGAAATTCGGG + Intronic
1157558831 18:48632095-48632117 GCAGGGATGGGGAGGAACTTCGG + Intronic
1158200105 18:54930602-54930624 GAAGGGAAGGGAAGGAAGGAAGG - Intronic
1158321694 18:56270636-56270658 GAAGGGAAGGGAAGGAAAGAAGG + Intergenic
1158842847 18:61406728-61406750 GGAGGAAAGCGGAGGAATTCAGG + Intronic
1159229547 18:65588272-65588294 CAAGGGGAGGGAAGGCATTCTGG - Intergenic
1159442041 18:68493811-68493833 GGAAGGAAGGGAAGGAATGGAGG + Intergenic
1159549545 18:69880175-69880197 GAATGGAAGGGAAGGAAAGCGGG + Intronic
1160211342 18:76882800-76882822 GCAGGGCAGGAAAGGAAAACAGG + Intronic
1160241119 18:77123986-77124008 GCTGGGAAGGGATGGAGCTCAGG - Intronic
1160585719 18:79912172-79912194 GCAGGGAGGGGACGGAAAACAGG + Intronic
1161900552 19:7115921-7115943 GCCGGGAAGGGGAGGGAGTCAGG - Intronic
1161903094 19:7134327-7134349 GCAGGGAAAGGCAGGAAATCTGG - Intronic
1161913882 19:7214760-7214782 AAAGGGAAGGGAAGGAACTTTGG - Intronic
1163040451 19:14598374-14598396 GAAGGGAAGGGAAGGAAGGAAGG - Intronic
1163188012 19:15653302-15653324 GGATGGAAGGGTAGGAATTAGGG - Intronic
1163228447 19:15980803-15980825 GGAGGAAAGGAAAGGAAATCTGG + Intergenic
1163517673 19:17774828-17774850 GCCTGGGAGGGAAGGAATCCTGG - Intronic
1163677558 19:18662940-18662962 GCAGGGAAGGAAAGGGGTCCAGG - Intronic
1163762697 19:19146059-19146081 GCGAGGAAGGGAAGGAAGCCAGG + Intronic
1164149725 19:22540836-22540858 GGAAGGAAGGGAAGGAAATGAGG + Intergenic
1164408114 19:27972781-27972803 GCAACGAAGGGAAGGAGTGCTGG + Intergenic
1164680507 19:30131063-30131085 GAAGGGAAGGGAAGGGAGTGAGG - Intergenic
1164680533 19:30131136-30131158 GAAGGGAAGGGAAGGGAGTGAGG - Intergenic
1164686354 19:30169020-30169042 TCAGCGAAGGGAAGGAAGGCAGG + Intergenic
1164932934 19:32189110-32189132 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
1166294063 19:41880443-41880465 GAAGGGAAGGGAAGGAAGGAAGG + Intronic
1166343940 19:42153912-42153934 GCAGGGAAGGGAAAGAAGGCAGG - Intronic
1166366742 19:42281720-42281742 GCAGGGAGGGGCGGGAATCCGGG - Intronic
1166402703 19:42495454-42495476 GCAGGGGAGGCAAGGAGCTCGGG + Intergenic
1166520708 19:43478383-43478405 TCTGAGAAGGGAAGGAACTCAGG + Intronic
1166676687 19:44745528-44745550 GGAGGGAAGGGAAGGGAGGCTGG - Intergenic
1166744130 19:45131976-45131998 GCAGGCCAGGGATGGAACTCAGG + Intronic
1166776160 19:45314112-45314134 GAAGGGAAGGGAAGGAAGGGAGG + Intronic
1166900984 19:46062710-46062732 GTAGGGAAGGCAAAGAACTCAGG + Intronic
1167056418 19:47113671-47113693 GAATGGGAGGGAAGGAATTCAGG + Intronic
1167240805 19:48342119-48342141 GGAGGGAAGGGAAGGAAAAGAGG + Intronic
1168056195 19:53866572-53866594 CCAGGGCAGGGAAGGGATGCAGG - Intronic
925199180 2:1952697-1952719 GGAGGGAAGGGAAGGAAGAAAGG - Intronic
925199184 2:1952714-1952736 GGAGGGAAGGGAAGGAAGGAGGG - Intronic
925199190 2:1952731-1952753 GGAGGGAAGGGAAGGAAGGAGGG - Intronic
925199238 2:1952873-1952895 GGAGGGAAGGGAAGGAAGGAGGG - Intronic
925199255 2:1952926-1952948 GGAGGGAAGGGAAGGAAGGAGGG - Intronic
925794724 2:7529499-7529521 TCAGGGCAGGGATGGATTTCTGG - Intergenic
925873825 2:8294470-8294492 GAAGGGAAGGGAAGGGGTTTAGG + Intergenic
926368227 2:12153206-12153228 GAAGGGAAGGAAAGGAATGAAGG - Intergenic
928593780 2:32841800-32841822 GCAGGAATGAGAAGGAATTCAGG - Intergenic
929407527 2:41659908-41659930 GAAGGGAAGGGAAGGAAAAAGGG + Intergenic
929488513 2:42375867-42375889 GAAGGGATGTGTAGGAATTCTGG - Intronic
929553807 2:42911269-42911291 GCAGGGAAGGAAGGGTATTTGGG + Intergenic
929981663 2:46687048-46687070 GGAGGAAGGGGAAGGAATTCTGG + Intergenic
930207035 2:48597942-48597964 GCGGGGAAGGAAAGGAATGAGGG + Exonic
930746232 2:54885940-54885962 GCAAGGAAGAGATGGAATTTTGG - Intronic
931083244 2:58799673-58799695 ATAGGGAAGGGAAGAAAATCTGG + Intergenic
931453192 2:62385815-62385837 GCATGGAATAGAAGGAGTTCAGG + Intergenic
932075264 2:68656522-68656544 AGAGGGAAGGGAAGGACTTAAGG - Intergenic
933059972 2:77725147-77725169 GGAGGGAAGGGAAGGAAGGGAGG + Intergenic
933059979 2:77725165-77725187 GGAGGGAAGGGAAGGAAGGGAGG + Intergenic
933211793 2:79579219-79579241 GAAGGGAAGGGAAGGGATAGAGG - Intronic
933512325 2:83256685-83256707 GCAGAGAAGGGAAGGAATGATGG + Intergenic
934049888 2:88201014-88201036 ACAGGGAAGGGAAGGAAAAGAGG + Intergenic
934315375 2:91913261-91913283 GAAGGGAAGGGAAGGGAATATGG + Intergenic
934886294 2:98028466-98028488 TCAGGGAAGAGAAGGAATCATGG - Intergenic
935550782 2:104451260-104451282 GTAGGGAGGGAAAGGAAGTCAGG + Intergenic
936258692 2:110938284-110938306 GCAGGGGAGGAAAGGAATAAAGG + Intronic
936520906 2:113211648-113211670 GAAGGGAAGGGACAGAAATCCGG + Intergenic
936673164 2:114683477-114683499 GAAGGGAAGGGAAGGAAAGGAGG - Intronic
936894186 2:117407969-117407991 GGAAGGAAGGGAAGGAAGTGAGG - Intergenic
937320177 2:120956325-120956347 TCATGGAAGGGAGGGAAGTCAGG + Intronic
937674373 2:124573220-124573242 TCAGAGAAAGGAAGGAATGCAGG + Intronic
937942949 2:127302406-127302428 GCAGGGATGGGAAGGAAGAAGGG - Exonic
938237808 2:129720941-129720963 GCAGGGAAGGGCCGGAGTACTGG - Intergenic
938370989 2:130768300-130768322 GCTGGGAAGGGCAGGAATCCAGG + Intergenic
938714579 2:134007987-134008009 GAAGGGAAGGGAAGGGAAGCAGG + Intergenic
939432613 2:142130596-142130618 GCAGGAAAGCCAAGGAAGTCAGG + Intronic
940072562 2:149705325-149705347 GCTGGGAAGGGAAGGAAGGAGGG - Intergenic
940962507 2:159801067-159801089 GCAGGCAAGGGACTGAAGTCTGG - Intronic
941700372 2:168597854-168597876 GGAGGGAAGAGAAGGCACTCTGG - Intronic
942482293 2:176402805-176402827 GCAGGGAAGGGAAGGCAGGAAGG - Intergenic
942767129 2:179470071-179470093 GTAGGGAAGGCAAGGAATTCAGG - Intronic
942994817 2:182248593-182248615 GCAGGGAAGGGAAGTAAAGAAGG + Intronic
943444167 2:187962799-187962821 GCAGGGAAGGCCAGGCATCCAGG - Intergenic
944006947 2:194921103-194921125 GCAGGGACAGGAAGGCATTTTGG - Intergenic
944242761 2:197501282-197501304 GGAGGGAAAAGAAGTAATTCTGG + Intronic
944632076 2:201637409-201637431 GCAAGGAAGGGAATGCAGTCAGG - Intronic
945510445 2:210695054-210695076 GAAGGGAAGAGAAGGAAGTCAGG - Intergenic
947105117 2:226661090-226661112 TTAGGGAAGGAAAGGAATTAAGG + Intergenic
947268400 2:228306712-228306734 ACAAGGAAGGGAAGCAGTTCTGG - Intergenic
947641987 2:231712042-231712064 GAAGGGGAAGGAAGGAATTGGGG + Intronic
947691034 2:232135833-232135855 GTAGGGAAAGGAAGCACTTCAGG + Intronic
947827643 2:233117383-233117405 GCAGGGAAGCGAATGAACTGGGG - Intronic
948199608 2:236120188-236120210 GCAGGGAAGAGAAGGAACGGTGG + Exonic
948430540 2:237915769-237915791 GCTGGGGTGGGAAGGGATTCAGG - Intergenic
948585440 2:239016056-239016078 GCAGGGATGCGATGGAATGCCGG - Intergenic
1168744062 20:221310-221332 GCAGGGAAGGGAAGGAAGGGAGG + Intergenic
1168744069 20:221328-221350 GGAGGGAAGGGAGGGAATGGAGG + Intergenic
1168887855 20:1272698-1272720 GCAGAGAAAGGAAGGAAGGCTGG + Intronic
1169557826 20:6768489-6768511 GCAGGGAAGGGAAGGGAGAAAGG - Exonic
1169827119 20:9781602-9781624 GGAGGGAAGATCAGGAATTCAGG - Intronic
1169934278 20:10866157-10866179 GAAGGGAAAGGAAGGCAGTCAGG + Intergenic
1170334486 20:15253153-15253175 GCAGGAAAGGGAAGGTTTTTGGG + Intronic
1170632982 20:18080989-18081011 GCAGGGAAGGGAAGGAAGGAAGG + Intergenic
1170920868 20:20678396-20678418 GCATGGAGTGGAAGGAATTCAGG - Intronic
1170982678 20:21229406-21229428 GTGGGGAAGAGAAGGAATTTGGG - Intronic
1171046313 20:21811567-21811589 GCAGGGAAGGGGAGGAACCTTGG + Intergenic
1171486155 20:25487978-25488000 GCAGGGAGGGGAAGAAATGGAGG + Intronic
1172011664 20:31849340-31849362 CCAGGGATGGGAAAGAATACAGG - Intronic
1172013593 20:31860730-31860752 ACAGGGAAGGGAAGGGAGTCGGG + Intronic
1172030484 20:31978771-31978793 ACACGGAAGGGAAGGAAATGGGG - Intronic
1172800351 20:37571989-37572011 ACAGGGAAGGGGAGGAAGCCAGG + Intergenic
1173154010 20:40592575-40592597 GCAGGAAAGGGGATCAATTCAGG + Intergenic
1173664381 20:44754350-44754372 TAAGGGAAGGGAAGAATTTCCGG + Intronic
1173687012 20:44931004-44931026 GGAGGGAAGGGAAGGAAGGGAGG - Intronic
1173892176 20:46521077-46521099 GGAGGGGAGGGAAGGAATGGAGG + Intergenic
1173906830 20:46635566-46635588 GCAGGGTAGGGAGGGAGTTGGGG - Intronic
1173995875 20:47338326-47338348 GCAGGAAAGGGATGGACTGCAGG - Intronic
1174416348 20:50369738-50369760 GCAGGGAAGGGCAGGTGCTCAGG - Intergenic
1174448695 20:50607291-50607313 ACAGGGAAGGGTGGGAATCCAGG + Intronic
1174846097 20:53944645-53944667 GCAGGAAAGGGAGGGAATAGAGG - Exonic
1174909187 20:54588006-54588028 GAAGGGAAGGGAAGGAAGAGTGG - Intronic
1175767286 20:61600271-61600293 GCTGGGAAAGCAAGGAATCCCGG - Intronic
1175806295 20:61830998-61831020 GCAGGGAAAGGGAAGAACTCTGG + Intronic
1178621887 21:34184522-34184544 CCAGGGAAAGGAAAGAAGTCGGG - Intergenic
1179263700 21:39782877-39782899 GCTGGGAAGGGGAGGTAGTCGGG - Intronic
1180109002 21:45639024-45639046 ACAGAGAAGGGGCGGAATTCTGG + Intergenic
1180542139 22:16459119-16459141 GAAGGGAAGGGAAGGAAAGAAGG + Intergenic
1180542147 22:16459145-16459167 GAAGGGAAGGGAAGGGAATATGG + Intergenic
1181278463 22:21702267-21702289 GCAGGGAAGGCACGGGTTTCTGG + Intronic
1181460776 22:23084782-23084804 GCTGGGAAGGCAGGGAAGTCAGG + Intronic
1181855461 22:25778291-25778313 GCAGGCTAGGGAAGAAACTCAGG + Intronic
1181878825 22:25961023-25961045 GAAGGGAAAGGAAGGAATTAAGG + Intronic
1182126096 22:27816877-27816899 GGAGGGAAGGGAAGGAAAAGGGG - Intergenic
1182317851 22:29459822-29459844 GCAGGGCAGGGCAGGGATGCTGG - Intergenic
1182449940 22:30413740-30413762 TCAGGGAAGTGTAGGACTTCTGG + Intronic
1183196486 22:36357277-36357299 GCAGGGAAGGGAAGAGATGGTGG + Intronic
1183437270 22:37803384-37803406 GCGGGGAAGGGAAGCAATGGGGG - Intergenic
1183580790 22:38725460-38725482 GCATAAAAGGGAAAGAATTCAGG + Intronic
1184553246 22:45216865-45216887 GGAGGGAAGGGAGGGAAGGCAGG - Intronic
1185130535 22:49036189-49036211 GCAGGGGAGGGCTGGAATTCAGG - Intergenic
1185174150 22:49310294-49310316 GGAGGGAAGGGAAGGAAGGGAGG + Intergenic
1185276562 22:49952417-49952439 GCAGGGACGGGAGGGAGCTCTGG + Intergenic
949736632 3:7179908-7179930 TCTGGGAAGGGAAAGAAGTCTGG - Intronic
950314846 3:11992186-11992208 ACAGGGAAGGAAAGGAAGCCAGG - Intergenic
950450446 3:13062195-13062217 GAAGGGAAGGGAAGGGAAGCTGG - Intronic
951816888 3:26763982-26764004 GAAGGGAAGGGAAGGAAAGGAGG + Intergenic
952413745 3:33072113-33072135 GAAGGGAAGGGAAGGCATGCAGG - Intronic
953930781 3:47004759-47004781 GCAGGGAGGGGAAGGGAGTGAGG - Intronic
953983033 3:47422169-47422191 GCAGGGAGGGGTAGGAAGACAGG + Intronic
954332685 3:49899274-49899296 TCAGGGAAGGGAAGGAGTCAGGG + Intronic
954840559 3:53507999-53508021 GCAGGGCAGGGATAGAATGCTGG - Intronic
955000712 3:54924883-54924905 CCAGGGAAAGGAGTGAATTCTGG + Exonic
955589226 3:60516024-60516046 GCGGGGAAGGCAGGGAAATCTGG + Intronic
955696341 3:61641212-61641234 GGAGGGAGGGGGAGGAAATCTGG - Intronic
955721527 3:61886538-61886560 GCAGGGCGGGGAAGGCATACAGG - Intronic
955874598 3:63476218-63476240 GAAGGGAAGGGAAGGAAGGAAGG + Intronic
955874641 3:63476351-63476373 GAAGGGAAGGGAAGGAAGGAAGG + Intronic
956617764 3:71190039-71190061 GCTTGGAAGGGAAGAAATCCCGG - Intronic
956666005 3:71642651-71642673 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
957027078 3:75194012-75194034 GTAGGGAGGGGAACAAATTCTGG + Intergenic
957036637 3:75299233-75299255 GCAGGGGAGGGAAAGAACTTTGG + Intergenic
957957049 3:87201165-87201187 GAAGGTAAGGGCATGAATTCAGG - Intergenic
958053237 3:88376015-88376037 GGAGGGAAGGGAAGGCTCTCTGG - Intergenic
958117101 3:89234737-89234759 GGAGGGAAGGGAAGGAAAGAAGG - Intronic
958137833 3:89519330-89519352 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
959444919 3:106427216-106427238 GAAAGAAAGGGAAGAAATTCTGG - Intergenic
959467021 3:106700759-106700781 GAAGGGAAGGGAAGTAAGGCAGG + Intergenic
960287660 3:115847680-115847702 GCAGGAAAGGGAATGAGTGCAGG - Intronic
960393238 3:117104981-117105003 AAAGGCAAGGGAGGGAATTCAGG - Intronic
960900959 3:122553983-122554005 GCAGGGAAGGGGAAGGAGTCAGG - Intronic
961059603 3:123817411-123817433 GCAGGTAGGGAAAGGAATTTGGG - Intronic
961121662 3:124376481-124376503 GTGGGGAAGGGGATGAATTCTGG - Intronic
961636354 3:128335407-128335429 GCAGGTATGGGAAGGAAGTGAGG + Intronic
961674004 3:128554097-128554119 GGAGAGAAGGTAAGGATTTCAGG + Intergenic
961813903 3:129538029-129538051 GAAGGAAAGGGAATGAATACTGG - Intergenic
962041026 3:131707619-131707641 GCAGTTAAGGGAATGAACTCTGG - Intronic
962076610 3:132088730-132088752 GAAGGGAAGGGAAGGGAAGCGGG + Intronic
962213786 3:133502263-133502285 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
962298478 3:134215283-134215305 GGAGAGAAGGGAAGGAAATGAGG + Intronic
963180280 3:142348120-142348142 GCATGGCAGGGAATGAATACTGG + Intronic
964107573 3:153055799-153055821 GGAAGGAAGGGAAGGAAGCCAGG + Intergenic
964665537 3:159167970-159167992 GCAGGGAAGGTAAGGAAGATTGG + Intronic
964697873 3:159530292-159530314 GCTGGGAAGGGAAGGATCTAAGG - Intronic
964738590 3:159942107-159942129 GAAGGGAAGGGAAGGAAGGAGGG + Intergenic
964829462 3:160867523-160867545 GGAGGGAAAGGAAGGAAGCCAGG - Intronic
965845559 3:172957343-172957365 GGAGGGAAGGGAAGCTTTTCTGG - Intronic
965857886 3:173111073-173111095 GCAGGGCTGAGATGGAATTCAGG - Intronic
966785851 3:183622028-183622050 GGAGGGAAGGGGAGGCATTGAGG - Intergenic
966910719 3:184558418-184558440 GAAGGGAAGGGAAAGACTTGGGG - Intronic
967084939 3:186086006-186086028 GCAGGGCAGGGCAGGGCTTCTGG - Intronic
967316123 3:188153782-188153804 GCAGGCAAAGTCAGGAATTCAGG + Intronic
967756125 3:193171014-193171036 GCAGGTGAGGGAAGGTGTTCAGG - Intergenic
967971706 3:195004180-195004202 GGAGGGAAGGGGAGGATATCAGG + Intergenic
968123427 3:196142107-196142129 GGAGGGAAGGGAGGGAAATGAGG + Intergenic
968206890 3:196811198-196811220 GGAGGGAAGGGAAGGAAGGGAGG - Intronic
968206915 3:196811256-196811278 GGAGGGAAGGGAAGGAAGGGAGG - Intronic
968222552 3:196949034-196949056 GAAGGGAAGGGAAGGAAGGAAGG - Intronic
968270930 3:197403210-197403232 GAAGGGAAGGTAACGAATGCTGG - Intergenic
968333488 3:197892544-197892566 GGAGGGAGTGGAAGGAATTAGGG - Intronic
968750402 4:2386052-2386074 GAAGGGAAGGGAAGAAATTGTGG - Intronic
968762397 4:2449471-2449493 GCAGTAAAGGGAAGGAGGTCAGG - Intronic
969172544 4:5375878-5375900 GGAGGGCAGGGAAGGAAGTAGGG + Intronic
969315135 4:6377343-6377365 GCAGGGCAGGGACAGAATCCAGG + Intronic
969345938 4:6570033-6570055 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
969387620 4:6865778-6865800 GCAGGGGAGAGAGGGAATTAGGG - Intronic
970146700 4:13043710-13043732 GCAGGGGAGGGAAGGGAAACAGG - Intergenic
971127504 4:23770529-23770551 GAGGGGAAGGGTAGGAAATCTGG - Intronic
971139695 4:23910921-23910943 GGAGGGGAGGGCATGAATTCTGG - Intergenic
971176430 4:24286786-24286808 GCAGCGTAGGTGAGGAATTCGGG + Intergenic
971311731 4:25530906-25530928 GTAGGTAAGGGTAGGAATGCAGG + Intergenic
972993378 4:44850069-44850091 TAAGGGAAGGGAAGGAAGTTGGG + Intergenic
973621337 4:52729045-52729067 TGAGGTCAGGGAAGGAATTCTGG - Intronic
973837050 4:54820004-54820026 TCTGGGAAGAGCAGGAATTCTGG + Intergenic
975190408 4:71453890-71453912 GAAAGGAAGGGAAGGAAATGAGG + Intronic
975357662 4:73426816-73426838 GCAGGGAAGGGTAGGAATGATGG - Intergenic
976431473 4:84966799-84966821 CGAGGGAAGGGAAGGAAGTAAGG - Intergenic
976484878 4:85590288-85590310 GAAGGGAAGGGAAGGAAAGAAGG - Intronic
976699114 4:87950197-87950219 GCACTGAAGGGAAGGAGATCTGG - Intergenic
976699184 4:87950683-87950705 GCACTGAAGGGAAGGAGATCTGG + Intergenic
976862834 4:89687401-89687423 GAAGGGCAGGGAATGAATTTGGG - Intergenic
977593086 4:98848628-98848650 GTGGGGAAGGCAAGGAGTTCAGG + Intergenic
977947614 4:102931341-102931363 GAAGGGAAGGGAAGGGAATATGG + Intronic
978361420 4:107934242-107934264 GCAGGGTAGGGAAGCATCTCAGG - Intronic
978454089 4:108868765-108868787 GAAGGGAAGGGAAGGAAGAAAGG + Intronic
978663617 4:111155734-111155756 GCAAGGAAGGGAAGGAAAACTGG - Intergenic
979472490 4:121116486-121116508 GCAGAGAAAGGAAAGAGTTCAGG - Intergenic
979979542 4:127237582-127237604 GAAGAGGAGGGAAGGAATTGGGG + Intergenic
980937726 4:139242158-139242180 GCAAGGAAAGGAAGGAATGAAGG + Intergenic
981288969 4:143051931-143051953 GAAGGGAAGGGAAAGAAAGCGGG + Intergenic
981379659 4:144058188-144058210 GGAAGGAAGGGAAGGAATGAAGG - Intergenic
981409267 4:144409820-144409842 GAAGGGAAGGGAAGGAAGAAGGG + Intergenic
982857936 4:160408585-160408607 GAAGGGAAGGGAAAGAGTTTGGG - Intergenic
983964994 4:173799100-173799122 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
984389014 4:179103001-179103023 GAAGGCAAGGGAGGGGATTCAGG - Intergenic
984908695 4:184652055-184652077 GCCTGGAAGGGGAAGAATTCGGG + Exonic
985478994 5:95577-95599 GCTGGGAAGGGAGGGAATCTGGG - Intergenic
985666091 5:1182090-1182112 GCAAGGAAGAGAAGGCATTCTGG - Intergenic
986094452 5:4541000-4541022 GAAGGGCAGGGAAGGCTTTCTGG - Intergenic
986468373 5:8049986-8050008 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
986660964 5:10059785-10059807 GAAGGGGAGGGAAGGACTTGGGG - Intergenic
987446163 5:18022060-18022082 GTGGTGAAGGGATGGAATTCTGG + Intergenic
987470511 5:18321918-18321940 GCAGGGAAATGAAGGAAATCAGG + Intergenic
988897677 5:35695492-35695514 GCAGGGAAGGGAGGGAGGTAGGG + Intronic
990059928 5:51635144-51635166 TCAGGGAAGGGAAGAAAATATGG + Intergenic
990201325 5:53379062-53379084 ACAGTGAAGGGAAGGAATTAAGG + Intergenic
990456523 5:55994624-55994646 GCAGGAAGGGGAAGGAATGTGGG + Intronic
991368405 5:65892995-65893017 GCAGGGAAGGGATGAATCTCAGG - Intergenic
991718543 5:69474626-69474648 GAAGGGAAGGGAAGGAAAACCGG - Intergenic
992705448 5:79386950-79386972 GAAGGGAAGGGAAGGAAGAAAGG - Intronic
993094528 5:83465952-83465974 GCAGGGAAGGGAAGGAGGATGGG - Intergenic
994407152 5:99359444-99359466 GCATGCAAGTGAAGGAATACAGG + Intergenic
995073152 5:107948375-107948397 GCAAGGAAAGGAAGGAGTCCAGG - Intronic
995958537 5:117810735-117810757 GAAGGGAAGGGAAGGAAAAAGGG - Intergenic
996112403 5:119581185-119581207 GCAGGGAAGAGAATGAAGTTGGG + Intronic
996150979 5:120034711-120034733 GGAGGGAAGGGAACTAATACAGG - Intergenic
996312779 5:122125689-122125711 GCAGCGAAGGGAAGCCATTTGGG + Intergenic
996816638 5:127581801-127581823 GAAGGGAAGGGAAGGAGATCTGG - Intergenic
996856975 5:128019293-128019315 GTTGGGAAAGGAAGGGATTCTGG - Intergenic
997296510 5:132772113-132772135 CCTGGGAAGAGAAGGAATTTTGG + Intronic
997759136 5:136428157-136428179 GAAGGGAAGGGAAGGAAAGGGGG - Intergenic
998186016 5:139980753-139980775 ACAGGGAAGGGAAGGAAACTGGG - Intronic
998325338 5:141275052-141275074 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
998802837 5:145888172-145888194 GCAGGGAGGAGAGGGAACTCAGG + Intergenic
998808371 5:145940547-145940569 GCAGAGAGGGCAAGGAACTCAGG - Intronic
998966324 5:147544717-147544739 TCATGGAAGGGAAGGAACCCAGG - Intergenic
998966772 5:147549501-147549523 GAAGGGAAAGGAAGGAATAAAGG - Intergenic
999118117 5:149182894-149182916 GAAGGGAAGGGGAGGCACTCTGG - Intronic
999389190 5:151177753-151177775 GCAGGGAAGGGGAGGATATGGGG + Intergenic
1000250005 5:159485340-159485362 GCTGGGAACAGAAGGTATTCAGG - Intergenic
1001071787 5:168591805-168591827 CCAGCTAAGGGAAGGCATTCTGG + Intergenic
1001403841 5:171462123-171462145 GCAGGGATGGAGAGGAATGCTGG - Intergenic
1001776036 5:174329717-174329739 GAAGGGAAGGGAAGGGGTGCGGG - Intergenic
1002104733 5:176874472-176874494 GCAGGGAGCGGAAGTAGTTCTGG - Exonic
1002352258 5:178591234-178591256 GCAGGAAAGGGAAGAACTGCTGG + Intergenic
1003031534 6:2605330-2605352 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
1003135054 6:3428507-3428529 GCAGGGCTGGGATGGAGTTCAGG - Intronic
1003319692 6:5039440-5039462 GCAGGGAAGGGGTGGAATGAGGG + Intergenic
1003500875 6:6701790-6701812 GCTGGGAGGAGAAGGAATTATGG - Intergenic
1003701579 6:8471792-8471814 GCAGGGAGGTGAAGGGACTCAGG + Intergenic
1003845178 6:10166467-10166489 AAGGGGAAGGAAAGGAATTCTGG - Intronic
1004351245 6:14892185-14892207 CCACGGGAGGGGAGGAATTCAGG - Intergenic
1004546355 6:16602242-16602264 GCAGGGGTGGGAAAGAATTACGG - Intronic
1005329907 6:24739844-24739866 GCAGGCAAGGGCAGGTATGCAGG - Intergenic
1006299496 6:33186089-33186111 GAAGGGAAGGGAAGGGAGCCTGG - Intronic
1006307259 6:33230714-33230736 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
1006948259 6:37800117-37800139 GCAGGGAAGGTAGGGAAATGAGG - Intergenic
1007478680 6:42135936-42135958 GCATGGCAGGGAAGGAATGTAGG + Intronic
1007591022 6:43021021-43021043 GCTGGGAAGGGAAGGGAATGGGG + Exonic
1007765436 6:44157054-44157076 GCAGGAAAGGGAAGGCATGCTGG - Intergenic
1008676904 6:53828564-53828586 GAAAGGAATGGAAGGAGTTCAGG - Intronic
1010828267 6:80498901-80498923 TCAGGGAAGGGAGGGAACTGGGG - Intergenic
1011698632 6:89935145-89935167 GCAGGGCAGGGAGGGACTTGGGG + Intronic
1011841165 6:91500985-91501007 GAAGGGAAGGGAAGGAAAGAGGG - Intergenic
1013068451 6:106706078-106706100 ACAGGGAAAGGAATAAATTCTGG - Intergenic
1013286721 6:108688339-108688361 GAAGGAAACGTAAGGAATTCTGG - Intergenic
1013607587 6:111764858-111764880 GCAGGGAAGGGAAGGAATTCAGG - Intronic
1013658851 6:112273637-112273659 GGAGGGAAGGGAAGGAAGGAAGG - Intergenic
1015551264 6:134414552-134414574 GAAGGGAAGGGAAGGGAATGGGG + Intergenic
1016863203 6:148742527-148742549 GGAGGGAAGGGTAGGGATTGAGG - Intergenic
1017641582 6:156499258-156499280 GCAGGGAAAGGAAGAAATCAAGG - Intergenic
1017642533 6:156508162-156508184 GCAGGGAGGGCAAGGAATGGGGG - Intergenic
1018260552 6:161966446-161966468 GCTGGCTAGGGAAAGAATTCCGG + Intronic
1018493615 6:164324415-164324437 GCAGGGAGTGGAAGGAAATGGGG - Intergenic
1018733761 6:166672314-166672336 TCAGGGAAGAGAAGGAAAGCCGG + Intronic
1018834004 6:167469929-167469951 GCAGCCAAGGGCAGGCATTCAGG + Intergenic
1019637208 7:2082273-2082295 GGAGGGAAGGGAAGGAGAGCGGG + Intronic
1019989367 7:4681399-4681421 GAAGGGAAGGGAAGGAATGAAGG + Intergenic
1020063569 7:5170390-5170412 GCCGGGGAGGGAAGGAAGTAGGG + Intergenic
1020139387 7:5604278-5604300 GCAGGGAGGGGAAGGAGAGCAGG + Intronic
1020455270 7:8366062-8366084 GCAGTGAAAGGAAAGAATCCAGG - Intergenic
1022274461 7:28841908-28841930 GAAGGGAAGGGAGGGAAGTCAGG + Intergenic
1022445734 7:30469384-30469406 GTAGGGAGGGGAAGGAAGCCGGG - Intronic
1022483421 7:30759182-30759204 GCCCGGAAGGGAAGGACTGCTGG - Intronic
1022810596 7:33864229-33864251 GCAGGGGAGGGTAGGAAGTGTGG + Intergenic
1022871460 7:34484419-34484441 GCAGGGAAGTGAATGAACTCTGG + Intergenic
1022952521 7:35352030-35352052 GCAGGGAAGGCAGGTAAGTCTGG + Intergenic
1022970564 7:35513204-35513226 TCAGGGAAGGGAAACAATTCAGG - Intergenic
1023931886 7:44711255-44711277 GGAGGAAAGGGAGGGAATCCGGG - Intergenic
1023932019 7:44711895-44711917 TCTGGGAAGGGAAGGGACTCAGG - Intergenic
1023935067 7:44734125-44734147 GGAGGGAAGGGAAGGGAATTGGG - Intergenic
1023975418 7:45026060-45026082 GCAGGGAGGGGAAGGATTCCAGG - Intronic
1024725424 7:52189266-52189288 GGAGGGAAGGGAAGGGAGTAGGG + Intergenic
1025603053 7:63017522-63017544 GCAGGGAAGGAAAGGGAGGCAGG - Intergenic
1026072073 7:67130794-67130816 GGAGGGGAGGGAAGGAGTTAGGG - Intronic
1026134363 7:67646524-67646546 GGAGGGAAGGGAGGGAAAGCAGG + Intergenic
1026268514 7:68816422-68816444 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
1026563391 7:71469114-71469136 GCAGAGGAGGGAAGGTGTTCTGG + Intronic
1026704830 7:72681468-72681490 GGAGGGGAGGGAAGGAGTTAGGG + Intronic
1026949724 7:74339034-74339056 GCAGGGGAGGGAAGGGAAGCTGG - Intronic
1027172087 7:75879499-75879521 ACAGGGAAGGGAACAAATTCGGG - Intronic
1027219730 7:76206304-76206326 GAAGGGAAGGGAAGGTGTTTGGG + Intronic
1027812971 7:82929094-82929116 GCAAGAAAGGGAAGTAATTGAGG + Intronic
1027817596 7:82996668-82996690 GAAAGGAAAGGAAGGACTTCTGG - Intronic
1028160373 7:87477383-87477405 CCAGTGAAGGGAAGGAATTTGGG - Intronic
1028278941 7:88896449-88896471 GCAGGGGAGGGAAAGAAATAAGG + Intronic
1028472482 7:91220197-91220219 GAAGGGAGGAGAAGGAATCCCGG - Intergenic
1028491748 7:91420304-91420326 GCAGGTCAAGGATGGAATTCGGG - Intergenic
1029058452 7:97771621-97771643 GCAGGGAAGGAAAGGCTTTGAGG + Intergenic
1029350754 7:100011287-100011309 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1029462734 7:100705780-100705802 GCAGGGAAGGGGCCGAGTTCAGG - Intergenic
1029612786 7:101636291-101636313 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
1029967927 7:104759915-104759937 GCAAGGCTGGGAAGGAACTCAGG + Intronic
1030156371 7:106459970-106459992 GTAGGGAAGGCAAGGCACTCAGG + Intergenic
1030849526 7:114465897-114465919 GGAGGGAAGGGAGTGATTTCTGG - Intronic
1031075121 7:117204490-117204512 GGAGGTAAGGCAAGGAATCCTGG + Intronic
1031363150 7:120871186-120871208 GAAGGGAAGGGAAGAAATAAAGG + Intergenic
1032482269 7:132256548-132256570 GGAGGGAAAGGCAGGAATTTGGG + Intronic
1032501447 7:132403230-132403252 GCAGGGAAGGGCATGGATGCTGG + Intronic
1032679652 7:134168618-134168640 GTAAGGAAGGGAAGGAAGGCTGG + Intronic
1032842654 7:135726569-135726591 GGAGGGAAGGGAAGGGAAGCAGG + Intronic
1033467323 7:141606547-141606569 GCAGGGGAGAGAAGGAATATAGG - Intronic
1033528759 7:142243146-142243168 GCAAGGAAGGGAAGGAGTCAGGG - Intergenic
1034115916 7:148583549-148583571 GCAAGGAAGGGAAGAAATAAAGG + Intergenic
1034434576 7:151057253-151057275 GTATGCAAGGGAAGGGATTCAGG + Intronic
1034460913 7:151197608-151197630 GCTGGGAAAGGAAGGATGTCTGG - Intronic
1034860811 7:154593042-154593064 GCTGGGATGGGAAGGAACACAGG + Intronic
1034897188 7:154885116-154885138 GCAGGGAAGGGCAGGAGTCTAGG + Intronic
1034980661 7:155474000-155474022 TCAGGGAAGGGAAGCTATCCGGG + Intergenic
1035935449 8:3832233-3832255 GCAGGGAAGCGCAGGACTTCAGG - Intronic
1036576574 8:10032989-10033011 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1036782183 8:11657325-11657347 GCAGGGGAGGGAAGGGAGGCAGG + Intergenic
1037275557 8:17174427-17174449 GCAGGTAAGGGAGGAAAATCAGG + Intronic
1037663253 8:20944680-20944702 TCATGGAGGGGAAGGAATCCTGG + Intergenic
1037683337 8:21116985-21117007 GCAGGGAAGAGAATGAAGGCAGG - Intergenic
1037996997 8:23359930-23359952 GCAGTTTAGGGAAGGATTTCTGG - Intronic
1038426621 8:27468189-27468211 GCAGGGCAAGGAAGGAGTACTGG - Intronic
1038573929 8:28687491-28687513 CTAGGGAAGGGAAAGAATTGGGG + Intronic
1039408853 8:37335234-37335256 CCAGGGGAGGGAAGGAAGCCAGG + Intergenic
1040051906 8:43023459-43023481 GAAGGGAAGGGAAGGAAGAAAGG - Exonic
1041180340 8:55240910-55240932 GTAGGAAAGGTAAGGTATTCTGG + Intronic
1041429042 8:57758282-57758304 GCAGGTAAGAGAAGGAAATCTGG + Intergenic
1041572824 8:59356842-59356864 TCTGGGATGGGCAGGAATTCAGG + Intergenic
1041573927 8:59371075-59371097 GGAGGGAAGGGAAGGAAAGAGGG - Intergenic
1042204134 8:66311374-66311396 GCAGGAAAGAGAATGAATGCAGG + Intergenic
1042810464 8:72820042-72820064 GGAGAGATGGGAAGGAAGTCAGG - Intronic
1042902897 8:73746550-73746572 ACAGGGAGGCGAAGGAATTGGGG - Intronic
1043216205 8:77592267-77592289 GCAGGGAAGGGAAGAAATTTGGG + Intergenic
1044055419 8:87563928-87563950 ACAGGGAAGGGGAGGAAATGGGG - Intronic
1044190027 8:89304739-89304761 GCAGGCAAGAGAAGATATTCTGG - Intergenic
1044440960 8:92223033-92223055 TCAGGCAAGAGAAGGAATTAAGG - Intergenic
1045099539 8:98830259-98830281 GAGGGGAAGGGATGAAATTCAGG + Intronic
1045270243 8:100655205-100655227 GCAGGGAGGGAAAGGCTTTCTGG + Intronic
1045707025 8:104936134-104936156 GCAGAGAAGTGAAGGAAGTGAGG + Intronic
1046605435 8:116366155-116366177 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
1047018122 8:120745351-120745373 GCAGGAAATGGATGGAATGCTGG - Intronic
1047484898 8:125320314-125320336 GGAAGGAAGGGAAGGAAGGCAGG + Intronic
1047597636 8:126394856-126394878 GCAGGGAAGGGAGAGAAATGTGG - Intergenic
1047741839 8:127812646-127812668 GAAGGGAAGGGAAGGAAGGGAGG + Intergenic
1047759923 8:127946872-127946894 GCAGGGAAGGGAAGGGAGGAGGG - Intergenic
1047794706 8:128242836-128242858 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1048036519 8:130682654-130682676 GGAGGAAAGGGGATGAATTCTGG - Intergenic
1048278882 8:133089931-133089953 TCAGGGGAGGGAGGGATTTCTGG - Intronic
1048307832 8:133296244-133296266 GCAGGGGAGGGGAGGAAAGCGGG + Intronic
1048551685 8:135439047-135439069 GAAGGGAAGGGAAGGAAAGAAGG + Intergenic
1048988314 8:139747362-139747384 GCCTGGAAGGGAAGGAGTACAGG + Intronic
1049577162 8:143394682-143394704 GCAAGTAAGGGAAGAAATCCAGG + Intergenic
1049803722 8:144529793-144529815 GCAGGGCTGGGCAGGCATTCTGG - Exonic
1050289414 9:4138638-4138660 GCTGGTAAGGGAAGCTATTCTGG - Intronic
1050337179 9:4601174-4601196 GGAGGGAAGGGAAGGAAGGAAGG - Intronic
1050945278 9:11509977-11509999 GCAGGCAAGAGAATGTATTCAGG - Intergenic
1051027519 9:12630927-12630949 GCAGGGATGGGAAGGGAGGCTGG - Intergenic
1051173481 9:14342462-14342484 GGAGGGAAGGGAAGGAAAGAAGG + Intronic
1051214189 9:14778745-14778767 GAAGGAAAGGAAAGGAAGTCAGG + Intronic
1051510073 9:17867949-17867971 GAAGGGAAGGGAGGGAAGGCAGG - Intergenic
1052678924 9:31663265-31663287 GAAGGGAAGGGAAGGAAAGGAGG - Intergenic
1052779370 9:32764992-32765014 GACGGGAAGGAAAGCAATTCGGG + Intergenic
1053024483 9:34718706-34718728 GCAGGGAAGGCAAGGCACACAGG - Intergenic
1053396797 9:37782591-37782613 ACAGAGAAAGGAAGGAACTCCGG + Intronic
1054854174 9:69880280-69880302 GCAGGGAAGGGATGGCATAGTGG - Intronic
1055614832 9:78060761-78060783 GGAGAGAAGAGAATGAATTCAGG - Intergenic
1055848559 9:80596566-80596588 GAATGGAAGGGAAGTAATTCAGG - Intergenic
1056816862 9:89808207-89808229 GCAGGGGAGGGAAGGTCATCTGG - Intergenic
1056827349 9:89885500-89885522 GCAGGGGCAGGAAGGACTTCTGG - Intergenic
1056845935 9:90038075-90038097 GCAGGGAATGGCAGCTATTCTGG + Intergenic
1057007215 9:91571049-91571071 GCAGGGTAGGGCAGTAATTGTGG - Intronic
1057233858 9:93343081-93343103 TCAGGGATGGGAAGGATTTGGGG - Intronic
1057416534 9:94868748-94868770 GCAGGGAAAGGAATGAAATCAGG - Intronic
1057901228 9:98950504-98950526 GAAGGGAAGGGAAGGAAGGAAGG - Intronic
1057901234 9:98950522-98950544 GAAGGGAAGGGAAGGAAGGAAGG - Intronic
1058024439 9:100125543-100125565 GCAGAGAAGGGAAGGCATCTTGG - Intronic
1058393031 9:104519227-104519249 GCAGGGCAGGCAAGAAATTCTGG + Intergenic
1058620508 9:106878124-106878146 GCAGGCAGGGGAGTGAATTCAGG - Intronic
1058740584 9:107938737-107938759 GCAGGGCAGGGAGTGAATTTGGG - Intergenic
1059035363 9:110748387-110748409 GCAGGGAAGGGAAAGACCACAGG - Intronic
1060019166 9:120114309-120114331 GCAGGGAAGGAAAGGAAAGAAGG - Intergenic
1060044011 9:120325760-120325782 CCAGGGAAGGGAAGGGGGTCTGG + Intergenic
1060114251 9:120928474-120928496 CCGGGGAAAGGAAGGGATTCCGG - Exonic
1060119519 9:120975125-120975147 GCAGGGACAGGAAGGAAGTGTGG + Intronic
1060274359 9:122171275-122171297 GCTGGGAAGGGAAGGAGATGGGG - Intronic
1061065854 9:128276903-128276925 GAAAGGAAGGGGAGGGATTCGGG - Intronic
1061271479 9:129546026-129546048 AAAGGAAAGGGAAGGACTTCAGG + Intergenic
1061331878 9:129899781-129899803 GAAGGGAAGGGAAGGAAGGAAGG + Intronic
1061483331 9:130907974-130907996 GAAGGGAAGGAAAGGAAAGCAGG + Intronic
1062111732 9:134785626-134785648 GCAGGATAGGGCAGGAAGTCTGG - Intronic
1062144037 9:134979019-134979041 GCAGGGAGGGGAAGGAAGGAGGG + Intergenic
1062282125 9:135756843-135756865 TCAGGAAAGGGAAGGAGCTCTGG - Intronic
1062320060 9:135986408-135986430 CCAGGGAGGGGAAGGAGATCTGG + Intergenic
1062380388 9:136284137-136284159 GCAGGGAAAGGAGGGAAGGCTGG + Intronic
1203453157 Un_GL000219v1:139956-139978 GAAGGGAAGGGAAGGAAACAAGG - Intergenic
1185501708 X:601774-601796 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1185501741 X:602057-602079 GGAGGGAAGGGAAGGAAGGAAGG - Intergenic
1185547452 X:956709-956731 GAAGGGAGGGCAATGAATTCAGG - Intergenic
1185559496 X:1048573-1048595 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
1185676510 X:1853619-1853641 GGAGGGAAGGGAAGGAAGGAAGG + Intergenic
1185726597 X:2426741-2426763 GAAGGGAAGGGAAGGAAGGAAGG - Intronic
1185824888 X:3240605-3240627 GAAGGGAAGGGAAGGAAGGAAGG - Intergenic
1186310998 X:8319150-8319172 CCAGGGATGGGAGGAAATTCAGG - Intergenic
1187033182 X:15509617-15509639 GAAGGGAAGGGAAGCAAGACAGG + Intronic
1187067784 X:15856792-15856814 GTAGGGAGGGGAAGGAATTGTGG + Intergenic
1187397449 X:18930921-18930943 GCAGGGAGGGGAAGGAGCCCAGG - Intronic
1187415294 X:19087880-19087902 GAAGGGAAGGGAAGGAAAACGGG - Intronic
1187550359 X:20296787-20296809 GCAGAAGAGGGAGGGAATTCTGG + Intergenic
1188145075 X:26602171-26602193 TCAGGGAAAGGCAGGAAATCAGG - Intergenic
1188160037 X:26788574-26788596 GCAGGGAAGATAAGGAAGTGGGG - Intergenic
1188604478 X:32011517-32011539 GCAGGGAAAATACGGAATTCAGG + Intronic
1188752703 X:33923449-33923471 GCAGGGATGGGAAGGATTGAAGG + Intergenic
1188827341 X:34851999-34852021 GGAGGGAAGTGAACGGATTCTGG - Intergenic
1189000291 X:36936984-36937006 GAAGGGAAGGGAAGGAAGGAAGG + Intergenic
1189099332 X:38172672-38172694 ACAGGGAAGGGGAGAAATCCAGG + Intronic
1189331840 X:40148929-40148951 GCATGGAGGGGAAGGACTGCCGG + Intronic
1189593297 X:42538272-42538294 ACAAGGAAGGAAAGGAATTGAGG - Intergenic
1189952596 X:46247842-46247864 GCATGGAAGGGAAGAAATGTTGG + Intergenic
1190079786 X:47347329-47347351 GGAAGGGAGGGAAGGAATCCTGG - Intergenic
1190390637 X:49927998-49928020 GCTGGGAAGGGAAGGAGTTTGGG + Intronic
1190628509 X:52361276-52361298 GCAGTGAAGGCAAGGAATCATGG - Intergenic
1190888222 X:54547722-54547744 GAAGAGGAGGGAGGGAATTCTGG + Intronic
1190970513 X:55343140-55343162 GCGGGGCAGGGAAGGAATGTGGG - Intergenic
1191849857 X:65578230-65578252 GAAGGGAAGGGAAGGACATGGGG - Intergenic
1191850575 X:65582947-65582969 GGAGGGAAAGGCAGGCATTCTGG + Intergenic
1192019459 X:67369890-67369912 GCATGGAGGGAGAGGAATTCTGG + Intergenic
1192153155 X:68724371-68724393 GCAGGGTGGGGAAGGAGTCCCGG - Exonic
1192358483 X:70424244-70424266 GCAGGAAAGGGCAGGACTTGAGG + Intronic
1192775519 X:74240544-74240566 GGAGGGAAGGGAAGGGATGGAGG - Intergenic
1194466227 X:94237783-94237805 TCAGGGAAGTGAGGGAAATCTGG + Intergenic
1194490695 X:94544880-94544902 GAAGGGAAGGGAAGGAAAGAAGG + Intergenic
1194849774 X:98856474-98856496 GCAGGGGTGGGAAGGAACTTGGG + Intergenic
1195041650 X:101020362-101020384 GGGAGGAAGGGAGGGAATTCTGG - Intronic
1195321415 X:103724667-103724689 GCAGCTCAGGGAAGGAGTTCTGG - Intronic
1195455644 X:105066169-105066191 GCAAGGAAGAGATTGAATTCTGG - Intronic
1195683627 X:107566510-107566532 GCAGGGAAGACAAGGCATGCAGG + Intronic
1197499580 X:127227511-127227533 GCAGGGAATGGAATGTAATCTGG - Intergenic
1198851851 X:140973310-140973332 TCAGGATAGGGAAGGAAGTCTGG - Intergenic
1199048099 X:143201889-143201911 GCAGGGGGGGGAAGAAATTATGG - Intergenic
1199620679 X:149697613-149697635 GGTGGGAAGGCTAGGAATTCAGG + Intronic
1199728367 X:150606883-150606905 CCAGGGAAGGGAGGGAACCCAGG - Intronic
1200097252 X:153670079-153670101 GCATCCAAGGGAAGGAAATCTGG + Exonic
1201183041 Y:11368080-11368102 GAAGGGAAGGGAAGGGAATATGG + Intergenic