ID: 1013607589

View in Genome Browser
Species Human (GRCh38)
Location 6:111764866-111764888
Sequence GAGCCACAGCAGGGAAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 870
Summary {0: 1, 1: 0, 2: 6, 3: 92, 4: 771}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013607589_1013607602 20 Left 1013607589 6:111764866-111764888 CCTTCCCTTCCCTGCTGTGGCTC 0: 1
1: 0
2: 6
3: 92
4: 771
Right 1013607602 6:111764909-111764931 GCTGGCAGCTGGAGGCAGGAGGG No data
1013607589_1013607594 2 Left 1013607589 6:111764866-111764888 CCTTCCCTTCCCTGCTGTGGCTC 0: 1
1: 0
2: 6
3: 92
4: 771
Right 1013607594 6:111764891-111764913 TCTCTCTTGTTCCCCTTTGCTGG 0: 1
1: 0
2: 2
3: 37
4: 303
1013607589_1013607596 12 Left 1013607589 6:111764866-111764888 CCTTCCCTTCCCTGCTGTGGCTC 0: 1
1: 0
2: 6
3: 92
4: 771
Right 1013607596 6:111764901-111764923 TCCCCTTTGCTGGCAGCTGGAGG 0: 1
1: 1
2: 2
3: 40
4: 288
1013607589_1013607601 19 Left 1013607589 6:111764866-111764888 CCTTCCCTTCCCTGCTGTGGCTC 0: 1
1: 0
2: 6
3: 92
4: 771
Right 1013607601 6:111764908-111764930 TGCTGGCAGCTGGAGGCAGGAGG 0: 1
1: 1
2: 9
3: 99
4: 898
1013607589_1013607595 9 Left 1013607589 6:111764866-111764888 CCTTCCCTTCCCTGCTGTGGCTC 0: 1
1: 0
2: 6
3: 92
4: 771
Right 1013607595 6:111764898-111764920 TGTTCCCCTTTGCTGGCAGCTGG No data
1013607589_1013607600 16 Left 1013607589 6:111764866-111764888 CCTTCCCTTCCCTGCTGTGGCTC 0: 1
1: 0
2: 6
3: 92
4: 771
Right 1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013607589 Original CRISPR GAGCCACAGCAGGGAAGGGA AGG (reversed) Intronic
900074704 1:803994-804016 GAGCGACTGCAGGAGAGGGAAGG + Intergenic
900266540 1:1759997-1760019 GAGCCACGGCGGGGCCGGGAGGG + Intronic
900280366 1:1863418-1863440 CAGCCACAGTGGGCAAGGGACGG - Intronic
900418493 1:2545793-2545815 GAGCCAGCCCAGGGGAGGGAAGG + Intergenic
900456706 1:2778439-2778461 GATGCACGGCAGGGATGGGAGGG - Intronic
900482943 1:2908154-2908176 GGGACACAGCAGGGCGGGGAGGG - Intergenic
900565373 1:3329369-3329391 GAGACACAGTCGGGAAGGGGTGG - Intronic
900754799 1:4426067-4426089 GAGGCACAGCATGGAAGGGGCGG - Intergenic
901469697 1:9447827-9447849 CATCCACAGCAGGGACGGGATGG - Intergenic
902147487 1:14415746-14415768 GAGTCAGGGAAGGGAAGGGAAGG - Intergenic
902230076 1:15022200-15022222 GAGCCAGGGCAGGGAAGTGATGG - Intronic
902289545 1:15427361-15427383 CAGCCTCAGCAGGGACGGGAAGG - Intronic
902614412 1:17616056-17616078 GAGGCTCATCAGGGAAGGGACGG - Intronic
902696429 1:18143742-18143764 GAGACATAGAAGGGAAGGCACGG - Intronic
902760113 1:18575513-18575535 GAGCCCCAGGAGGCACGGGAGGG + Intergenic
902784733 1:18725534-18725556 GAGGGGGAGCAGGGAAGGGAGGG + Intronic
902807346 1:18869298-18869320 TGGCCACAGCAGGGAAATGAAGG + Intronic
903121442 1:21219159-21219181 AAGCCACAGCAGGGGACTGATGG - Intronic
903625401 1:24726683-24726705 GAGCCAGAACAGTGAATGGAAGG - Intergenic
903779887 1:25814440-25814462 GAAACACAGCCTGGAAGGGAAGG + Intronic
904035403 1:27556175-27556197 CAGCCACAGCCGGGGAGGGTGGG - Intronic
904244476 1:29177255-29177277 GAGTTACTGTAGGGAAGGGAGGG - Intronic
904300258 1:29549526-29549548 GAGAGACAGCAGGGAGGGGAGGG - Intergenic
904457977 1:30658589-30658611 GAGAGACAGCAGGGAGGGGAGGG + Intergenic
904466898 1:30713662-30713684 TGGCCAGAGCAGGGCAGGGATGG + Intronic
904567356 1:31435684-31435706 GAGCCACAGCACTGAGGGCAGGG + Intergenic
904575712 1:31503922-31503944 GAGTCCCTGCAGGGCAGGGAAGG - Intergenic
904585105 1:31575913-31575935 GGGCCCAAGCAGGCAAGGGAAGG + Intergenic
904824164 1:33263983-33264005 AGGCCACAGCAGCAAAGGGAAGG - Intronic
905136515 1:35804680-35804702 CAGCCACAGCAGGAAGTGGAGGG + Intergenic
905514261 1:38550342-38550364 GAGCCTGAGCAGGGAAAGGGAGG - Intergenic
905527359 1:38649169-38649191 GAGTCACAGCTTGGAGGGGATGG - Intergenic
905891875 1:41522931-41522953 CACCCACTCCAGGGAAGGGAGGG + Intronic
906343873 1:45003400-45003422 CAGCCAAACCAGGGCAGGGAAGG + Exonic
906476314 1:46171749-46171771 GAGCCACAGAGGCGAAGAGAGGG + Intronic
906708841 1:47914460-47914482 GAGCCAGAGCAATGTAGGGAGGG + Intronic
906746892 1:48228462-48228484 GCCCCACAGGAGGGAAGGAAAGG - Intronic
907458623 1:54592199-54592221 GGGCCACTGCAGGGCAGCGAGGG + Intronic
907466910 1:54644294-54644316 GAGGGAGAGCAGGGGAGGGAGGG - Intronic
909426168 1:75527300-75527322 GAGAGACAGAAAGGAAGGGAGGG + Intronic
909456406 1:75854580-75854602 AAGCCAGAGCAGGGAGAGGACGG - Intronic
909767297 1:79372193-79372215 GAGGCAGAGAAGGGAAGAGAAGG - Intergenic
910226222 1:84939057-84939079 GACCAACAGCAGAGAATGGACGG + Intronic
910474830 1:87595642-87595664 GAGAAAGAGGAGGGAAGGGAGGG - Intergenic
910680011 1:89853358-89853380 GAGCCCCAGGAGAGAAGTGAGGG + Intronic
911088724 1:94001024-94001046 GAGCATCATCAGAGAAGGGAGGG - Exonic
911228740 1:95336981-95337003 GAGCCAGAGCAGGGCAGGAAAGG - Intergenic
911440669 1:97921511-97921533 CAGCCCCAGCGGGGAGGGGAGGG + Intergenic
912561724 1:110555919-110555941 CAGCTACAGCGGGGAAGGGCAGG - Intergenic
912568807 1:110607192-110607214 GCGCCGCAGCCGGGCAGGGAAGG + Intronic
913004908 1:114620020-114620042 CTTCCACAGCAGGGAAGGAAAGG + Intronic
913168116 1:116208256-116208278 GAAGCTCAGCTGGGAAGGGAAGG - Intergenic
913958451 1:143322539-143322561 CAGCCAAGGCAGGGTAGGGAAGG + Intergenic
914052768 1:144147919-144147941 CAGCCAAGGCAGGGTAGGGAAGG + Intergenic
914126429 1:144818622-144818644 CAGCCAAGGCAGGGTAGGGAAGG - Intergenic
914246417 1:145889126-145889148 GAGCAACAACAAGGAAAGGAAGG + Intergenic
914858105 1:151366626-151366648 GGGCCACAGGAGGGAAGTGTGGG + Intronic
914883911 1:151569631-151569653 CAGCCAGAACAAGGAAGGGAAGG - Intronic
915074596 1:153297907-153297929 GAGACCCAGCAGGGGAGGGAGGG + Exonic
915363613 1:155301074-155301096 GAGCCACAGCATGTAAGCCACGG - Intronic
915528694 1:156491104-156491126 GAGTCCCAGTAGAGAAGGGATGG + Intronic
915557537 1:156668809-156668831 GGGCCACAGCGTGGCAGGGATGG + Exonic
915824297 1:159058473-159058495 CAGCCCCAGCAGGGAGGGGAGGG + Intergenic
916233967 1:162567030-162567052 GAGCAAAAGCAGGGAAGGCATGG - Intronic
917209479 1:172616720-172616742 CAGCCCCAACTGGGAAGGGAGGG - Intergenic
918254837 1:182739859-182739881 GAATCTAAGCAGGGAAGGGAAGG + Intergenic
918602113 1:186375725-186375747 GAGGCTCTGCGGGGAAGGGAGGG + Intergenic
918734645 1:188043604-188043626 GAGGCACAGCAGGGCAGGGGTGG - Intergenic
919163943 1:193868417-193868439 GAGACACAGGAGGCAAGGAATGG + Intergenic
919543046 1:198875186-198875208 GAGAGACAGAAGGGAAGGGCTGG - Intergenic
919741560 1:200984138-200984160 GAGGCACAGCAGGCAGGGGCTGG + Intronic
919831327 1:201542089-201542111 GGCCCACTGAAGGGAAGGGATGG + Intergenic
919876077 1:201869658-201869680 GTGCCACAGCAGGGAAAGCTTGG - Exonic
920039899 1:203088741-203088763 GAGGCCCAGCTGGGCAGGGAAGG + Intergenic
920166625 1:204040940-204040962 GAACCAGAGCAGGGGAGAGAAGG - Intergenic
920380160 1:205530472-205530494 GAACCCCAGCAGGGGAGGCAAGG - Intronic
920519452 1:206612547-206612569 GAACTAAAGCAGGGCAGGGAGGG + Intergenic
920681199 1:208074201-208074223 GAGCCACAGACTGGAAAGGAAGG - Intronic
920692248 1:208155724-208155746 GAGCCAGAGCTGGGCAGGGAGGG - Intronic
920740982 1:208581305-208581327 GAGCTGCAGCGGGGAAGGCAGGG - Intergenic
922091475 1:222399547-222399569 GAGCCACACCATTGGAGGGAAGG - Intergenic
922270550 1:224028899-224028921 GAGCGACTGCAGGAGAGGGAAGG + Intergenic
922586186 1:226736653-226736675 GAGCCACAGCGGGGACTGGCAGG + Exonic
923034314 1:230273545-230273567 GGGCCACAGCAGGGACTGGAAGG - Intronic
923058580 1:230449109-230449131 GAGGCACAGCAGGGTGAGGAGGG - Intergenic
923086001 1:230703980-230704002 GAGGCACAGCAGGGATGGGGAGG + Intronic
923323416 1:232858949-232858971 AAGGGAGAGCAGGGAAGGGAGGG - Intergenic
923914337 1:238485580-238485602 CAGCCCCGGCAGGGAAGGGAGGG + Intergenic
924206208 1:241713521-241713543 GAGAAAAAGCAAGGAAGGGAGGG + Intronic
924224411 1:241908924-241908946 TAGCCACAGCAGTGCAGTGATGG - Intergenic
924399523 1:243663458-243663480 GAGGCAGTGCAGGGAGGGGAGGG + Intronic
924433951 1:244022115-244022137 GTGCCACAGCAGGCAAGGAGAGG - Intergenic
924796387 1:247295625-247295647 GAGGCACAGCAGGCCAGGCAGGG - Intergenic
1062828396 10:588292-588314 CAGCCACAGGAGGGCAGGGAAGG + Intronic
1062834418 10:626493-626515 GACCAACACCAGGGATGGGATGG - Intronic
1063218657 10:3946069-3946091 GAGTCACAGGACGGAACGGATGG + Intergenic
1064414347 10:15135848-15135870 GAAACACAGCAGAGAAGGGAAGG + Intronic
1064697369 10:17981700-17981722 GACACACAGCTGGGAAGTGATGG + Intronic
1064957036 10:20922762-20922784 GAGCAACGGAAGGGATGGGATGG - Intronic
1065198065 10:23286392-23286414 GAGACATAGAAGGGAAGGGGAGG + Intronic
1065805581 10:29390956-29390978 GAGACTCAGGAGGGAGGGGAGGG - Intergenic
1065829556 10:29602382-29602404 GTCCCACAGCAGAGAAGGGAGGG - Intronic
1067077168 10:43194515-43194537 CACACACAGCAGGCAAGGGAGGG + Exonic
1067412765 10:46079324-46079346 GATCCACACCTAGGAAGGGAAGG + Intergenic
1067563922 10:47322998-47323020 GAGCTTCAGCATGGAAGGTAGGG + Exonic
1067568291 10:47353582-47353604 GGGCCACAGCAGGGAAGAAAAGG + Intronic
1067716024 10:48691556-48691578 CAGCCACTGCAGGGAGGGCAAGG - Intronic
1067726885 10:48777178-48777200 CAGCCACACCAGGGAAAAGAGGG - Intronic
1067829178 10:49600281-49600303 GAGCCCCAGCAGAGCAGGGAGGG - Intergenic
1069561971 10:69436855-69436877 GAGTCAGAGAAGGGAATGGATGG + Intergenic
1070079034 10:73167881-73167903 GTGCCACAGCAGAGACGCGAAGG - Exonic
1070175498 10:73966127-73966149 GAACAACTGCAGGGAAGGGAAGG - Intergenic
1070537782 10:77392299-77392321 GAGGCAAGGGAGGGAAGGGAGGG + Intronic
1070672418 10:78387426-78387448 GAGAGACAGCAGGGAAGAGCAGG - Intergenic
1071444368 10:85731927-85731949 GAGAGAGAGAAGGGAAGGGAAGG + Intronic
1071513696 10:86283117-86283139 GGCACACAGCAGGGCAGGGAGGG - Intronic
1071578851 10:86752409-86752431 GAGCTGCAGCAGGACAGGGAAGG + Intergenic
1072752237 10:97989793-97989815 GTCCCACAGCTAGGAAGGGAAGG + Intronic
1073102159 10:101012029-101012051 GAGAGACAGCAGGGGTGGGAGGG + Intronic
1073429279 10:103475911-103475933 GAGGCAGAGCAGGGATCGGAAGG - Intronic
1073431820 10:103492185-103492207 TGGCCACAGCAGGTCAGGGATGG - Intergenic
1073484512 10:103808177-103808199 GGGCCACAGCAGGGAGGAGATGG - Intronic
1073902977 10:108244962-108244984 GAGCCCCAGCTGGGAGGGGATGG - Intergenic
1074607398 10:114987297-114987319 GAGTCACAGAAGGAAAGGGGAGG - Intergenic
1074859745 10:117501407-117501429 GAGCCAAAGCAGGCTAGAGAAGG - Intergenic
1075002975 10:118811326-118811348 AAGCCAGAGCAGGAAAGGGAGGG + Intergenic
1075344328 10:121671027-121671049 GAACCACAGCATGGTAGGCAAGG - Intergenic
1075553797 10:123414104-123414126 GCTCCAGAGCAGGGCAGGGAGGG + Intergenic
1075666978 10:124238411-124238433 GGTCCAAAGCAGGGCAGGGAAGG - Intergenic
1075743186 10:124708385-124708407 GTGCAAAAGCAGGGAAGGGGAGG + Intronic
1076057407 10:127386978-127387000 AAGCCACTGCCGGGAAGGGATGG - Intronic
1076082416 10:127594916-127594938 GAGACTCAGAAGGGAAGGGTGGG + Intergenic
1076199075 10:128543763-128543785 GAGCCACAGCAGGGCTGGACAGG + Intergenic
1076217388 10:128707086-128707108 GAGCTACAGCACAGAGGGGAGGG + Intergenic
1076380812 10:130023542-130023564 GAGGCACACCAGGGTGGGGAGGG - Intergenic
1076623667 10:131808793-131808815 GAGACACAGCTGGGAAGTTAAGG - Intergenic
1076713940 10:132353894-132353916 CACCTGCAGCAGGGAAGGGAAGG - Intronic
1076723972 10:132404874-132404896 GAGCCACAGCGGGTGAGGGAAGG - Exonic
1076869440 10:133186161-133186183 GAGCCACAGCCGGGAGGGGCTGG + Exonic
1077422714 11:2460507-2460529 GAGCCACAGGAAAAAAGGGAAGG - Intronic
1077466257 11:2735147-2735169 GCGCCGCAGCAGGACAGGGAGGG + Intronic
1077468164 11:2743537-2743559 GAACTTGAGCAGGGAAGGGAAGG + Intronic
1077503098 11:2918021-2918043 CAGCCGCAGCAGGGAGGCGATGG - Exonic
1077535822 11:3123571-3123593 CAGCCAGAGCAGGGCAGGGCGGG - Intronic
1077635589 11:3839851-3839873 GTGCCAGAGCTGGGAAGGGAAGG + Intronic
1077870911 11:6260449-6260471 GAGCCACAACAGAGAAGGGAAGG + Intronic
1078307395 11:10203917-10203939 GAGTCCCAGCATGGAATGGAGGG + Intronic
1078355486 11:10628987-10629009 GAGCAGCAGCAGGGAGGGGTTGG - Intronic
1078797909 11:14611760-14611782 GAGAGAGAGCATGGAAGGGAGGG - Intronic
1078855176 11:15201145-15201167 GAGCCTGAGCAGGAAAGGCAGGG + Intronic
1080037271 11:27722548-27722570 GGGCCAAGGCAGGGACGGGAGGG + Intergenic
1080889903 11:36400482-36400504 AAGGAACAGCAGGTAAGGGAAGG + Intronic
1081551976 11:44121858-44121880 GAGCCCCAGAAGTGAAAGGAAGG - Intronic
1081773371 11:45663144-45663166 GATCCACAGCGGGCAAGGGAGGG + Intronic
1083308804 11:61774171-61774193 GGGGCTCAGCAAGGAAGGGAGGG + Intronic
1083328457 11:61885644-61885666 GAGACACAGCAGGGCAGGGAGGG + Intronic
1083617237 11:64032361-64032383 GAGGCACAGCAAGGCTGGGATGG + Intronic
1083656255 11:64231059-64231081 GATCCTCAGCAGGGAAGGCGAGG - Intronic
1083767721 11:64849851-64849873 GAGCTGCTTCAGGGAAGGGAGGG + Intergenic
1083880035 11:65543821-65543843 GAGCCATGGCAGGTGAGGGAAGG - Intronic
1083897835 11:65629033-65629055 GGCCCACAGCAGGTATGGGAGGG + Intronic
1084483356 11:69434564-69434586 CAGCCAGAGCAGGGAAGGGTCGG - Intergenic
1084630866 11:70348429-70348451 CAGCCACAGCAGGGAAAGGGCGG - Intronic
1084689839 11:70718645-70718667 ATGTCACAGCAGGGCAGGGAGGG + Intronic
1084714807 11:70866949-70866971 GAGCCACAGCGAGGGAGTGAAGG - Intronic
1084913575 11:72410675-72410697 GGGCAGCAGCAGGAAAGGGAAGG + Intronic
1085036036 11:73300643-73300665 AAGGCAGAGCAGGGAGGGGAAGG + Intergenic
1085698801 11:78728480-78728502 GAGCAGAAGCAAGGAAGGGAGGG - Intronic
1085810920 11:79680290-79680312 CCACCACAGCAGGGAAGGTAGGG - Intergenic
1085829622 11:79885473-79885495 GAGCCAAGGCAGGCAAGAGAGGG + Intergenic
1086560833 11:88167235-88167257 GAGCCACAGCATAAAGGGGAAGG + Intronic
1086988733 11:93279275-93279297 GGGCCAAAGGAGGTAAGGGAAGG + Intergenic
1088081713 11:105924651-105924673 GAGCCAGAGGACGGAAAGGAAGG + Exonic
1088226541 11:107626537-107626559 GGGGGACAGGAGGGAAGGGAGGG - Intronic
1088676296 11:112196951-112196973 GAGGGAAAGAAGGGAAGGGAAGG - Intronic
1088706350 11:112467760-112467782 GGGACACAGCAGGGAAGGCAGGG + Intergenic
1088762998 11:112949866-112949888 GAGCAAGAGGTGGGAAGGGAAGG + Intergenic
1088995265 11:114990304-114990326 GAGGCACAGCAGGGATGAGAAGG + Intergenic
1089037746 11:115413129-115413151 GAGACACAGGAGGGAAGAGAGGG + Intronic
1089225547 11:116917684-116917706 GAGCGACAGGAAGGGAGGGAGGG + Intronic
1089255252 11:117190592-117190614 GAGAGAGAGAAGGGAAGGGAGGG - Intronic
1089372193 11:117969343-117969365 CAGGCCCAGCAGGGAAGGAAGGG - Intergenic
1089506894 11:118969477-118969499 GAGCAAAGGAAGGGAAGGGAAGG + Intergenic
1089787666 11:120919806-120919828 GGGAGACAACAGGGAAGGGAGGG + Intronic
1090205713 11:124882959-124882981 GAGCCACAGGAGGCACTGGAGGG - Intergenic
1090234987 11:125140443-125140465 GAGACAGAGGAGGGAGGGGAGGG - Intergenic
1090423708 11:126592812-126592834 TGGTCACAGCAGGGAAGGGCTGG + Intronic
1090730478 11:129569379-129569401 GAGCCTGAGCAGGGTAAGGAGGG + Intergenic
1090919392 11:131194759-131194781 TAGCAACTGAAGGGAAGGGACGG + Intergenic
1091143209 11:133253869-133253891 GAGCAGGAGAAGGGAAGGGAAGG - Intronic
1091588968 12:1831754-1831776 GATGCAGAGCAGGGAGGGGAGGG - Intronic
1091714385 12:2766682-2766704 GAGCCACTGCAGGGAACCCAGGG - Intergenic
1092071694 12:5636699-5636721 GAGGCACAGGAGGAAAGGGGAGG + Intronic
1092280204 12:7092463-7092485 CATGCACAGCAGGGAGGGGAGGG + Intronic
1092286218 12:7130523-7130545 GGGGTACAGCAGGGCAGGGACGG - Exonic
1092579163 12:9820406-9820428 GAGCCACAGCAGGGGGTGGCTGG - Intergenic
1092613057 12:10191668-10191690 AAGTCATAGCAGGCAAGGGAAGG - Exonic
1092888017 12:12942333-12942355 AAGCCAAAGGAGGGAAGGGCTGG + Intronic
1094047413 12:26182643-26182665 AAGCCACTGGAGGGGAGGGAAGG - Intronic
1094266293 12:28564369-28564391 GAACCACACCAAGGAAGAGAGGG - Intronic
1095863900 12:46950371-46950393 CAGCCACTGCAGGGAAAGGATGG + Intergenic
1096537007 12:52281364-52281386 GAGCCCCAGGAGGGCAGTGAAGG + Intronic
1096549430 12:52362540-52362562 GAGCCAGGGCAGGGAGAGGAGGG + Intronic
1096579632 12:52576324-52576346 CAGCCACAGCAAGGATGGGCAGG + Intergenic
1096805961 12:54141239-54141261 GCGCCAAAGCTTGGAAGGGAGGG + Intergenic
1097008132 12:55933352-55933374 AAACCAGAGGAGGGAAGGGAAGG + Intronic
1099769177 12:87030052-87030074 GAGCCACAGCTGGAAAGGATGGG + Intergenic
1100367756 12:93937099-93937121 GAACCACAGAGGGGAAGGGAAGG + Intergenic
1101217206 12:102596231-102596253 GTGCCCCAGCTGGGAGGGGAGGG + Intergenic
1101363026 12:104045442-104045464 GAGCCACTGCAGGGCAGGCAAGG + Intronic
1101444605 12:104728728-104728750 GAGGCCCAGCAGGGTAGGGTGGG - Intronic
1101794461 12:107960176-107960198 GGACCGCAGCAGGCAAGGGAAGG - Intergenic
1102420619 12:112800285-112800307 GAGCCACACCTGGGAAGTGGGGG + Intronic
1102575944 12:113856190-113856212 GAGTAAAGGCAGGGAAGGGATGG + Intronic
1102823379 12:115926661-115926683 AGGCCATGGCAGGGAAGGGAAGG + Intergenic
1103160841 12:118727924-118727946 TACCCACAGCAGGGAGGGGCTGG + Intergenic
1103293273 12:119864852-119864874 GGGCCAAGGGAGGGAAGGGAAGG - Intronic
1103403541 12:120659324-120659346 GAGGCGCAGGAGGGGAGGGAAGG - Intronic
1104281387 12:127381199-127381221 GAGCCTCCGCGGGGAGGGGAGGG + Intergenic
1104398405 12:128455103-128455125 TAGTCACAGCAGAAAAGGGAAGG - Intronic
1104517576 12:129442254-129442276 GATTCAGAGCAGAGAAGGGAAGG + Intronic
1104956885 12:132471100-132471122 GAGAGAGAGAAGGGAAGGGAAGG + Intergenic
1106312879 13:28569055-28569077 AAGCCACTGCAGGGCCGGGAGGG - Intergenic
1108614124 13:52114842-52114864 CTGCCACAGCAATGAAGGGATGG + Intronic
1110367921 13:74708550-74708572 GAGCCTCTGCAGGGAATGGGAGG + Intergenic
1111546267 13:89741184-89741206 CAGCCACACCTGGGAGGGGAGGG - Intergenic
1112708431 13:102099120-102099142 GACCCTCAGCTGAGAAGGGATGG - Intronic
1112806404 13:103167791-103167813 TAGACACAGCAGGGAGGAGAAGG + Intergenic
1113513180 13:110871971-110871993 GAAAGACGGCAGGGAAGGGAGGG + Intergenic
1113659349 13:112094981-112095003 GAACAAGAGAAGGGAAGGGAAGG - Intergenic
1113920268 13:113904055-113904077 GAGCCGCAGCCTGGAAGGGTGGG + Intergenic
1114181741 14:20373637-20373659 AAGAGACAGCAGGGAAGGGGAGG + Intronic
1114204754 14:20558499-20558521 GAGGAAAAGCAGGGAGGGGAGGG - Intronic
1115721634 14:36167987-36168009 GGCCAACAGCAGGGGAGGGAGGG - Intergenic
1115758028 14:36549163-36549185 GGGGTACAGCAGGGAAGGGGGGG + Intergenic
1117214489 14:53536521-53536543 GAGCCACAGCAGGAAGAAGAGGG - Intergenic
1117864325 14:60129700-60129722 GTGCCACAGAAGGGAAGAAAAGG + Intronic
1118161994 14:63299860-63299882 GAGCAAGGGCAGGGCAGGGAGGG - Intergenic
1118348957 14:64960051-64960073 GAGTCACAGCAGGAAGAGGATGG - Intronic
1118905065 14:70017847-70017869 GAGCCAGAGCATGTGAGGGAAGG + Intronic
1119054704 14:71407501-71407523 GAGGGAAAGGAGGGAAGGGAGGG - Intronic
1119160003 14:72444677-72444699 GACCCACAGAAGGAAAGCGAAGG - Intronic
1119431880 14:74573730-74573752 GAGTTCCAGCAGGAAAGGGATGG - Intronic
1119727235 14:76928872-76928894 GAGACACAGGAGGGAAGGAAAGG + Intergenic
1121426587 14:93856568-93856590 GGGACAGAGTAGGGAAGGGAAGG + Intergenic
1121444544 14:93970209-93970231 GAGACACAGCTGGGAAGGCGGGG + Intronic
1121867564 14:97377196-97377218 GAGCAAAAGCAGGGCAAGGACGG - Intergenic
1122783964 14:104155484-104155506 GTGCCACAGCAGCAAACGGAAGG - Intronic
1122935388 14:104953607-104953629 GACACAGAGCAGGGAAGGGAAGG - Exonic
1122969665 14:105147461-105147483 GGGCCACAGCAGGGGTGGGTGGG - Intronic
1123039528 14:105484819-105484841 AAGCAACAGCAGGGAAGGCCAGG + Intergenic
1123108273 14:105852982-105853004 GAGCCCCAGCAGGGAAGGCAGGG - Intergenic
1123216466 14:106813303-106813325 CAGCCACAGCCGGGGAGGCAGGG - Intergenic
1124102465 15:26708617-26708639 GAGTCATCGCAGGGAAGAGAAGG + Intronic
1124181490 15:27479859-27479881 GAGCTCCAGCAGAGAGGGGATGG + Intronic
1124372075 15:29109729-29109751 GTCACACAGCAGGGAAGGTATGG - Intronic
1124560751 15:30771245-30771267 GAGCCCCATCAGGGCAGGGCTGG - Intronic
1125109971 15:36021171-36021193 GAAACACAGCAGAGTAGGGAAGG - Intergenic
1125584033 15:40807707-40807729 GGGGCAGGGCAGGGAAGGGAAGG + Exonic
1126373503 15:47971509-47971531 GAGACAAAGCATGGATGGGAAGG - Intergenic
1127565546 15:60184646-60184668 ATGCCACAGCAGGGAGGGTAGGG + Intergenic
1127842855 15:62845760-62845782 GTTCCCCAGCAGAGAAGGGATGG + Intergenic
1127858465 15:62972702-62972724 GAGCTAAAGCAGGGATGAGAAGG - Intergenic
1127988108 15:64090753-64090775 GGGCCTTAGCTGGGAAGGGAGGG + Intronic
1128345114 15:66848576-66848598 CAGCCAGAGAAGGGAAGGAAGGG + Intergenic
1128729382 15:70010547-70010569 GCTCCACAGCAAGGAAGGGGTGG + Intergenic
1128742066 15:70090599-70090621 GATCCAGAGCGGGGAGGGGAGGG + Intronic
1128994915 15:72289026-72289048 GAGAGACAGCAGGGAAGGAGGGG + Intronic
1129356570 15:74995897-74995919 GAGCCACAGATGGGAATGGGGGG - Intronic
1129445280 15:75612751-75612773 GAGACGCAGAAGGGAAGGGTAGG - Intronic
1129650449 15:77483526-77483548 GAGTCACAGCAGGGCAATGATGG - Exonic
1129659342 15:77544285-77544307 GAGCCAGGGCAGGGCAGGGCAGG - Intergenic
1129692851 15:77723649-77723671 CAGGCTCAGCAGGGCAGGGAGGG + Intronic
1129799728 15:78405293-78405315 CAGCCACTGCAGGGAGGGTATGG + Intergenic
1130229634 15:82086849-82086871 GAGCCACTGGAGGGTTGGGATGG + Intergenic
1130650697 15:85760594-85760616 GAGCCCCAGCAGGGCAGGCCAGG + Exonic
1131071837 15:89471034-89471056 GAGAGAAAGAAGGGAAGGGATGG + Intergenic
1131332536 15:91515068-91515090 GAGCCCCAGCAGGAGAGAGAAGG - Intergenic
1131522251 15:93125459-93125481 GAGCTACAGGAGGGGAGGGTGGG + Intergenic
1131689750 15:94813947-94813969 GAGCCACATCAAGAAAGGGAGGG + Intergenic
1132000006 15:98168920-98168942 GAGATACAGCAGGGCAGGGTGGG - Intergenic
1132145717 15:99428265-99428287 GAGCCTCAGGAGGTAAAGGACGG - Intergenic
1132233244 15:100200374-100200396 CAGCCACAGCAGGGGTGGGGAGG + Intronic
1132391121 15:101438904-101438926 GAGCAACAGCAGGGGAAGGTGGG + Intronic
1132469812 16:96088-96110 AGGCCACGGCAGGGAAGTGAAGG + Intronic
1132544819 16:528164-528186 GAGCCAGGGCAGGGACGGCAGGG + Intronic
1132831795 16:1932120-1932142 CAGCCACAGCAGTGCAGGGGTGG - Intergenic
1133213104 16:4273779-4273801 GGGCCCCGGCAGGGAGGGGAGGG + Intergenic
1133575864 16:7088920-7088942 GAACCAGAGCAGGGACTGGAGGG - Intronic
1134919993 16:18107218-18107240 GCTTCACAGCAGGGAAGTGATGG - Intergenic
1136088964 16:27904661-27904683 GAGCCTCAGGAAGGAAGGGGAGG - Intronic
1136248797 16:28990164-28990186 GAAACACACCAGGGCAGGGAGGG - Intronic
1136505838 16:30702581-30702603 GAGGGAAGGCAGGGAAGGGAGGG - Intronic
1136560799 16:31038205-31038227 GAGGCACAGCAGAGAGGGGCTGG - Intronic
1136624929 16:31456607-31456629 CTCCCCCAGCAGGGAAGGGAAGG + Intergenic
1136922377 16:34343819-34343841 GAGCAGCAGATGGGAAGGGAGGG - Intergenic
1136982196 16:35067987-35068009 GAGCAGCAGATGGGAAGGGAGGG + Intergenic
1137608177 16:49800860-49800882 AAGGCAAAACAGGGAAGGGAAGG + Intronic
1137615194 16:49842221-49842243 GAGGAAGAGAAGGGAAGGGAAGG + Intronic
1138358883 16:56409330-56409352 GAGCCACAGCAGGCATGGTCAGG - Intronic
1138597104 16:58034931-58034953 GAGCGACAGGAGGGGAGGGTGGG - Intronic
1139142226 16:64280426-64280448 CTTCCACAGCATGGAAGGGAAGG + Intergenic
1139959991 16:70711994-70712016 GGGCCACAGCATGGCTGGGAGGG + Intronic
1140249726 16:73285544-73285566 GAGCCACAGATGGCAAGAGAGGG - Intergenic
1140277038 16:73518929-73518951 GAGGCAAAGCAGCGAAGGCAAGG + Intergenic
1140463322 16:75159298-75159320 GAGGGAAAGGAGGGAAGGGAGGG - Intronic
1140626867 16:76804632-76804654 GAGACACAGCCAGGAAAGGAGGG + Intergenic
1140843600 16:78865440-78865462 AAGCCTCAGCAAGGAAGAGAAGG - Intronic
1141139364 16:81487208-81487230 GAGGCTCAGGAGGCAAGGGAGGG - Intronic
1141140235 16:81492655-81492677 GAGGCAAAACAGGGGAGGGAAGG + Intronic
1141280838 16:82628252-82628274 GAGCCAGGGCAGGGCAGGGCCGG + Intronic
1141466150 16:84206976-84206998 GTGCCGCTCCAGGGAAGGGATGG + Intergenic
1141652419 16:85400187-85400209 AAACCTCAGCAGGGAGGGGAGGG - Intergenic
1141688810 16:85585216-85585238 GACACACAGCAGGGCAGGCAGGG - Intergenic
1141793291 16:86251167-86251189 GAGAGAGAGCAGGGGAGGGAGGG - Intergenic
1141944366 16:87299175-87299197 GAGCCACTGCAGGGACAGGCTGG - Intronic
1142115445 16:88353886-88353908 GGCCAACAGCAGGGAGGGGAGGG - Intergenic
1142247398 16:88976323-88976345 GGGCCGCAGCCGGGAAGTGATGG - Intronic
1142355548 16:89599886-89599908 GAGGGACAGCAGGGACAGGATGG + Intergenic
1142697327 17:1640658-1640680 CGGCCACAGCTGGGAAGAGAAGG + Exonic
1142768472 17:2079680-2079702 GACCCACAGCAGGGCTGGGGAGG + Intronic
1143003812 17:3813572-3813594 GTGTCTCAGCAGGGAAGGGCAGG - Intronic
1143097227 17:4484759-4484781 GGGCTACAGCAGGGGATGGAAGG - Intronic
1143101410 17:4506612-4506634 GAGACACAGCAGGGAGGAGGGGG + Intronic
1143347749 17:6262375-6262397 AAGCCTCTGCAGTGAAGGGAGGG + Intergenic
1144739361 17:17572614-17572636 GTGACACAGCAGGCAAGGGGAGG - Intronic
1145252823 17:21305686-21305708 GAGCCCCAACACGGAAGGCATGG - Intronic
1145276981 17:21437394-21437416 GAGCCACTGCAGGTTTGGGAGGG + Intergenic
1145314811 17:21723287-21723309 GAGCCACTGCAGGTGTGGGAGGG + Intergenic
1145323752 17:21782230-21782252 GAGCCCCAACATGGAAGGCATGG + Intergenic
1145713253 17:26995224-26995246 GAGCCACTGCAGGTGTGGGAGGG + Intergenic
1145748252 17:27336472-27336494 GAACCACAGCAAAGCAGGGAGGG + Intergenic
1146272135 17:31491450-31491472 GAGGAAGAGCAGGGAAGGGGAGG + Intronic
1146936104 17:36813540-36813562 CAGCCTGAGAAGGGAAGGGAGGG + Intergenic
1147165755 17:38592348-38592370 GAGGCAGGGCAGGGAAGTGAGGG - Intronic
1147338986 17:39742724-39742746 GTCCCTCAGAAGGGAAGGGAGGG + Intronic
1147478717 17:40738648-40738670 GAGCCAAGGCAGGGTAGGGTAGG - Intergenic
1147527094 17:41235979-41236001 GAGAGAGAGAAGGGAAGGGAAGG + Intronic
1147977878 17:44258387-44258409 AAGCCTCAGCTGGGAAGGGCAGG + Intronic
1148205269 17:45775832-45775854 GAGCCACAGCAGGATGGGGCTGG - Intergenic
1148208927 17:45796497-45796519 GAGGAAGAGGAGGGAAGGGAAGG + Intronic
1148245959 17:46031031-46031053 AAGCCACAGATGGGAGGGGAGGG + Exonic
1148622791 17:49046904-49046926 GCTCCAGAGCATGGAAGGGAAGG + Intronic
1148637028 17:49156715-49156737 GAGCCCAAGGAGGGAGGGGATGG + Intronic
1148862197 17:50610208-50610230 GAGGCACAGGAGGGAAGAGGTGG - Intronic
1149203445 17:54215185-54215207 GGGCCAAAGCAGGGCTGGGAAGG - Intergenic
1149624502 17:58070649-58070671 GAGCCAAGGCAGGGAATGGTGGG - Intergenic
1150297424 17:64020318-64020340 GAGACCCAGCAGGGCAGGGCAGG + Intronic
1150465091 17:65385944-65385966 GAGCCTCAGCAGGAAGGGGCTGG - Intergenic
1150595879 17:66604069-66604091 GAGCGACAGCCGGGAACTGATGG - Intronic
1151219000 17:72597863-72597885 GAGCCCAGGCAGGGTAGGGAGGG - Intergenic
1151364705 17:73609739-73609761 GAGCCAAAGCACAGGAGGGAGGG + Intronic
1151449325 17:74188137-74188159 GAACCAAAGCAGGGAAGTCAGGG + Intergenic
1151566491 17:74901332-74901354 GAGGCAGGGCAGGGGAGGGACGG + Intergenic
1151700185 17:75738632-75738654 GAGCCACAACAGGGAAGAAAGGG + Intronic
1151714545 17:75824833-75824855 GGGCCTGAGCAGGGAAGGGTGGG + Exonic
1151719235 17:75846191-75846213 GACCCAGGACAGGGAAGGGAAGG + Exonic
1151770438 17:76156904-76156926 GAGCGCCTGGAGGGAAGGGAAGG - Intronic
1151944511 17:77312158-77312180 GAGCCACAGCAGGGCAGGGGTGG - Intronic
1152576267 17:81142638-81142660 GACCAAGAGCAGGGAAGAGAAGG + Intronic
1152635595 17:81429378-81429400 GAACCCCCGCAGGGAGGGGAGGG - Intronic
1153014830 18:574089-574111 GAGTCAAAGAAGGGAAAGGATGG - Intergenic
1153187366 18:2500397-2500419 TAGCCCCAGCAGGGAGAGGACGG + Intergenic
1153804705 18:8702309-8702331 GAGGGAAAGAAGGGAAGGGAAGG - Intergenic
1155922148 18:31614178-31614200 GAGCGATGGGAGGGAAGGGAAGG + Intergenic
1156246528 18:35304818-35304840 TAACCAAAGCAGGGAAGGGGGGG - Intergenic
1156971544 18:43162986-43163008 CAGTCCCAGCAGGGAGGGGAGGG - Intergenic
1156977315 18:43238315-43238337 GAGCCAGAGCAGCTAAGGAAGGG - Intergenic
1157888148 18:51388671-51388693 CAACCACAGCAGGGAGGGGAAGG + Intergenic
1158077262 18:53545141-53545163 GAGCCAGAAAAGGCAAGGGATGG + Intergenic
1158307180 18:56118832-56118854 CACCAACAGAAGGGAAGGGAGGG + Intergenic
1158889074 18:61856441-61856463 CAGGCACAGAAAGGAAGGGAGGG + Intronic
1159104822 18:63994052-63994074 GAGGGACAGGAGGGATGGGATGG - Intronic
1160229034 18:77032520-77032542 GAGCCTCAGGAGGGTGGGGACGG + Intronic
1160445711 18:78925448-78925470 GAGCCTCAGCAGCGCAGGGGAGG - Intergenic
1160526737 18:79543025-79543047 GAGCCATGGAGGGGAAGGGAGGG + Intergenic
1160828915 19:1093749-1093771 CACCCACAGCAAGGAAGGGGAGG + Intronic
1160943412 19:1630428-1630450 GCCCCACAGCGGGGCAGGGACGG - Intronic
1160976286 19:1794310-1794332 CAGCCACCCCAGGGAATGGATGG - Intronic
1160989845 19:1856011-1856033 AAGCCACAGCAGGGCCAGGAGGG + Intronic
1161312987 19:3604910-3604932 GATCTACAGCAGGCATGGGAGGG - Intronic
1161380877 19:3964386-3964408 GAGGCTCAGCAGGGAAAGCACGG + Intronic
1161438382 19:4277547-4277569 CAGCCAGTGCAGGGAAGGGGAGG + Intergenic
1161447867 19:4328241-4328263 GAGTCAGAGCTGGGCAGGGAGGG - Intronic
1162130939 19:8525901-8525923 GGGCAACAGCAAGGAAGGGGCGG - Intronic
1162478046 19:10912709-10912731 GAGGCAGAGCAGGGAATGGAGGG - Intronic
1162576134 19:11500043-11500065 GGGCCACAGCAGGGAGGCCAGGG - Intronic
1162634058 19:11952746-11952768 GACTCACAGCAGGGAAGACAGGG + Intronic
1162637427 19:11980959-11980981 GATTCACAGCAGGGAAGACAGGG + Intergenic
1162671229 19:12259551-12259573 AAAACAAAGCAGGGAAGGGAAGG - Intronic
1162731169 19:12719867-12719889 CAGCCAGAGCAGGAGAGGGAAGG + Intronic
1163166611 19:15502466-15502488 GAGCCATAGCAGGCATTGGAGGG + Intergenic
1163663023 19:18589693-18589715 GAGACACGGCGGGGAAGGGGTGG - Intronic
1163799643 19:19356741-19356763 GAGACCCAGCAGGGAAGGTGAGG - Exonic
1164602002 19:29568503-29568525 GAGTGACAGCAGGGAAGAGAAGG + Intergenic
1164627823 19:29741146-29741168 GAGCAATGGCAGGCAAGGGAGGG - Intergenic
1165315020 19:35049458-35049480 CAGCCACTGCAGAGAAGGGAGGG - Exonic
1165523582 19:36333129-36333151 TCCCCACAGAAGGGAAGGGAGGG + Intergenic
1166040646 19:40200453-40200475 GAGCCTCAGCTGGGAATTGACGG - Intronic
1166097332 19:40549129-40549151 GAGCCACAGCAGGATCAGGAGGG + Intronic
1166311943 19:41967767-41967789 GAGGCACAGAAGGGCAGGGCTGG + Intronic
1166359679 19:42247938-42247960 AGGTCACAGCAGGGGAGGGAGGG - Exonic
1166929043 19:46290163-46290185 GAGAGAGAGAAGGGAAGGGAAGG - Intergenic
1167005744 19:46775474-46775496 CACCCCCAGCAGGGCAGGGAAGG + Exonic
1167103984 19:47419812-47419834 GAGCCAGAGGAGAGAAAGGACGG - Intergenic
1167115983 19:47489331-47489353 GAGGCACAGACGGGGAGGGAAGG - Intronic
1167161093 19:47767508-47767530 GACACACAGCTGGTAAGGGATGG - Intergenic
1167240811 19:48342138-48342160 GAGGAACAGGAAGGAAGGGAGGG + Intronic
1167979677 19:53263162-53263184 GAGGCCCAGGAGGGAAGGGGTGG - Intergenic
1168145931 19:54420262-54420284 GACCCACAGCGGGCAAGGGGAGG + Intronic
1168274737 19:55271421-55271443 GGGCCAGAGCAGGGTAGAGAGGG - Intronic
1168651967 19:58097589-58097611 GGGCTGGAGCAGGGAAGGGATGG - Intronic
1202692164 1_KI270712v1_random:100343-100365 CAGCCAAGGCAGGGTAGGGAAGG + Intergenic
925006401 2:446109-446131 AAGACGAAGCAGGGAAGGGAGGG + Intergenic
925595453 2:5551659-5551681 GAGCCACAGAAGGGCCTGGATGG + Intergenic
925836224 2:7949683-7949705 CAGACACAGCAGTGCAGGGAAGG + Intergenic
925915397 2:8600771-8600793 CAGCCACCGCAGGGACGGGAGGG + Intergenic
926052345 2:9753151-9753173 GAGCCAAGGGACGGAAGGGAAGG - Intergenic
926086380 2:10022816-10022838 GAGACAGAGAAAGGAAGGGAGGG - Intergenic
926662734 2:15486035-15486057 GAACAGCAGCAGGAAAGGGAGGG + Intronic
928024396 2:27728189-27728211 TTCCCACAGCAGGGAAGGAAGGG + Intergenic
928436400 2:31257308-31257330 GAGCCATCCCTGGGAAGGGAAGG + Intronic
929455249 2:42060637-42060659 GCGCCAGAGGAGGGAAGGCAAGG + Intergenic
929716918 2:44321683-44321705 GAGACCCAGGAGGGGAGGGAGGG - Intronic
929759144 2:44791698-44791720 GAGCCACAGCAGAGATCTGAAGG + Intergenic
929830888 2:45345485-45345507 CAGCAACTGCAGGGAAGTGAGGG - Intergenic
929986256 2:46736010-46736032 GAGGTACAGAAGGGGAGGGAAGG - Intronic
930084050 2:47480187-47480209 GAGGAAGAGGAGGGAAGGGAAGG - Intronic
931687347 2:64805832-64805854 GAGCCACACCAGAGCAGGGGAGG + Intergenic
931691096 2:64835499-64835521 GAGCCACCGCAGGGTGGGGCCGG + Intergenic
932053452 2:68421428-68421450 GAATCACAGCAGGGAAGGTAAGG + Intergenic
932166340 2:69511124-69511146 GAGGGACTGGAGGGAAGGGATGG - Intronic
932397766 2:71459940-71459962 GAGCCATAGCCTGGAAGGAAGGG - Intronic
932835157 2:75029265-75029287 GAGCCACAGTGGGGAAAGCAGGG - Intergenic
933331491 2:80897838-80897860 GAGATACAGCAGGGAAAAGAAGG - Intergenic
933512324 2:83256677-83256699 GAGAAACAGCAGAGAAGGGAAGG + Intergenic
933531727 2:83518755-83518777 GAGCAACAGCAGGCCAGGAAAGG - Intergenic
933765540 2:85706152-85706174 CTGCCACAGGATGGAAGGGAAGG + Intergenic
933954234 2:87353629-87353651 CAGCCAAGGCAGGGTAGGGAAGG - Intergenic
934238429 2:90249849-90249871 CAGCCAAGGCAGGGTAGGGAAGG - Intergenic
934274762 2:91566861-91566883 CAGCCAAGGCAGGGTAGGGAAGG + Intergenic
934559711 2:95306824-95306846 GGCTCACAGCATGGAAGGGAGGG - Intronic
936075115 2:109396865-109396887 GAACCACAGCAGGCAAGTGAAGG - Intronic
936450740 2:112632175-112632197 GAGCCACAGCGGGGAAAGGCAGG + Intergenic
936513233 2:113165148-113165170 GAGCCTGGGCAGGGGAGGGATGG + Intronic
936945818 2:117929797-117929819 CAGCCACAGCAGTGCAGGAATGG - Intronic
936964484 2:118114156-118114178 GAGCCATTGCAGGGAAGGGTGGG + Intergenic
936988231 2:118332538-118332560 GAAACACAGCAGGGAAAAGAAGG - Intergenic
937191829 2:120109512-120109534 GAGTAACAGCAGGGAAAGCAAGG - Intronic
937202117 2:120210379-120210401 GCATCACTGCAGGGAAGGGAGGG - Intergenic
937210054 2:120262678-120262700 CTGACACAGCAGGGAAGAGAAGG + Intronic
937273289 2:120669039-120669061 GAGCAAGAGGAGGGAAGGGAGGG - Intergenic
937293221 2:120794412-120794434 GGGGCTCAGCAGGGGAGGGATGG + Intronic
938444562 2:131367047-131367069 GAGTCACTGCAGGCAAGGGCTGG - Intergenic
939756729 2:146122748-146122770 GATCCACAGTAAGAAAGGGAGGG - Intergenic
941763597 2:169271833-169271855 GAGTGAAAGCAGGGAAGGAAGGG + Intronic
942034187 2:171994918-171994940 GAGCGAGGGAAGGGAAGGGACGG - Intronic
942602798 2:177658449-177658471 GAGGCAGAGGAGGGAAGGGGAGG - Intronic
942793827 2:179792802-179792824 GAGAAAAAGAAGGGAAGGGAAGG + Intronic
944653766 2:201857849-201857871 AAGCCACAGCAGCTCAGGGATGG - Intronic
944816336 2:203379777-203379799 GAGCCACAACAGAGATGGTATGG - Intronic
945785191 2:214225426-214225448 GAGTGAAAGCAGGGAAGGCAGGG + Intronic
946054512 2:216889117-216889139 GAGAGACAGCAGGGGAGGGGTGG + Intergenic
946203855 2:218089426-218089448 CACCCACCCCAGGGAAGGGAGGG + Intronic
946492448 2:220162526-220162548 GAGTCACAGCAGAGACTGGAGGG - Intergenic
946715085 2:222545737-222545759 CAGCCACCACAGAGAAGGGAAGG - Intronic
947196564 2:227573821-227573843 GAGTCCCAGCAGGGAGGGGCAGG + Intergenic
947605511 2:231483250-231483272 GAGCAACGGCAGGAAAGGGACGG - Intronic
947639649 2:231699836-231699858 AAGCCTCATCAGGGAGGGGAAGG - Intergenic
948077309 2:235174849-235174871 CATCCACACCAGAGAAGGGAAGG + Intergenic
948155524 2:235778171-235778193 CAGCCACAGGGAGGAAGGGAGGG - Intronic
948201689 2:236133808-236133830 GAGCAGCAGCAGGGCAGGCACGG - Intergenic
948407381 2:237732441-237732463 GATGCACAGAAGGAAAGGGAAGG - Intronic
948453789 2:238094717-238094739 GAGCCACGTCAGGGAGAGGAGGG - Intronic
948708125 2:239807761-239807783 GACCCACAGCAAGGTAGGGCAGG + Intergenic
948750920 2:240132477-240132499 GAGCCACGGCCGGTCAGGGAGGG - Intronic
1168893805 20:1310419-1310441 AAGCCACTGCAGGGCAGGGCAGG - Exonic
1168980874 20:2002676-2002698 GAGCCACAGCAGCAGAGAGACGG + Intergenic
1169082751 20:2807152-2807174 GAGACACAGCAGGGAACCAAGGG - Intergenic
1169123677 20:3112112-3112134 GAACCTCTACAGGGAAGGGAAGG + Intronic
1169557059 20:6762461-6762483 GAGCCCCAGTAGGGAAATGATGG - Intergenic
1170285421 20:14703296-14703318 GAGCAACAGCTGGGAAGGAGGGG + Intronic
1170355785 20:15490251-15490273 GAGAGAAAGAAGGGAAGGGAAGG - Intronic
1170546963 20:17442596-17442618 AAGCTACATCAGAGAAGGGAGGG - Intronic
1171185852 20:23123547-23123569 GGGCCACAGCAGGGGAGCGAAGG + Intergenic
1171348823 20:24487108-24487130 GGGCCACAGGAGGGAAGAAATGG + Intronic
1171489652 20:25508037-25508059 GATCTAGAGCAGCGAAGGGAAGG - Intronic
1172223146 20:33287279-33287301 GAGGCAAGGCAGGGAAGGAAAGG + Intronic
1172232796 20:33348336-33348358 GGGGCCCAGCAGGGAGGGGATGG - Intergenic
1172315723 20:33952674-33952696 GAGCCACAGCAGGATGGGGAGGG + Intergenic
1172590889 20:36117104-36117126 GGGCAAGAGCAGGGGAGGGAAGG - Intronic
1172703253 20:36864988-36865010 GAGCCACCGCAGGGCAGAGCTGG + Intergenic
1172898513 20:38317147-38317169 GAGCAACATCAGGAGAGGGAGGG + Intronic
1173094567 20:40012754-40012776 GAGGCAAAGAAGGGAAAGGAAGG - Intergenic
1173384092 20:42572416-42572438 TGGCCACAGCAGAGAAGGTAAGG - Intronic
1173401629 20:42731081-42731103 GACCTACAGAATGGAAGGGAGGG + Intronic
1173731386 20:45331136-45331158 GAACCACAGAAGGGATGAGACGG + Intronic
1173906833 20:46635574-46635596 GAACAAAAGCAGGGTAGGGAGGG - Intronic
1173918457 20:46726461-46726483 GAGCAACTGCAGGTAAGTGAGGG - Intronic
1173962575 20:47086514-47086536 TAGCCAGAGCAGGAAAAGGAGGG + Intronic
1173977102 20:47195329-47195351 GAGCCTCCGCAGGGAGGGGAAGG + Intergenic
1174157869 20:48528429-48528451 AAGACAAAGCTGGGAAGGGAGGG + Intergenic
1174781200 20:53390410-53390432 GAGCCACAGAAAGCCAGGGAAGG + Intronic
1174837629 20:53873345-53873367 GAACCTCAAAAGGGAAGGGATGG + Intergenic
1175612809 20:60365444-60365466 GAGGCCCTGCAGGGCAGGGAGGG - Intergenic
1175789862 20:61734514-61734536 GAGCCCCAGACGGGGAGGGACGG + Intronic
1175817541 20:61891361-61891383 GAGGCTCAGCAGGACAGGGAGGG - Intronic
1175858005 20:62133164-62133186 GGGCCACTACAGGGAAGGGGCGG - Intronic
1175928367 20:62481660-62481682 GGGCCACAGCTGGGCAGGGGCGG + Intergenic
1176106077 20:63388238-63388260 TACACACAGCAGGGAGGGGAAGG + Intergenic
1176160312 20:63644173-63644195 CAGGCACCGCAGGGAAGGGCAGG + Intronic
1176188262 20:63793335-63793357 GAGCCCCAGGAGGGCAGGGCAGG + Intronic
1176263707 20:64197619-64197641 GAGCCACACCAGGCGGGGGAGGG - Intronic
1176591979 21:8656233-8656255 CAGCCAAGGCAGGGTAGGGAAGG - Intergenic
1176693896 21:9950125-9950147 GTGCCTCAGCCGGGAGGGGAGGG + Intergenic
1177912404 21:27049306-27049328 GATACAGAACAGGGAAGGGAAGG + Intergenic
1178355996 21:31911218-31911240 AAGCCCCAGAAGGGAAGAGATGG - Intronic
1178409155 21:32349502-32349524 GAGCCTCAGCAGGGAAGAGACGG + Intronic
1179111162 21:38446712-38446734 GAGGCAGAGCAGGGGAGGCAGGG + Intronic
1179114275 21:38475696-38475718 GAGCCTTAGGAGGGAAGGTAGGG - Intronic
1179475697 21:41642093-41642115 GAGTCACAGAACGGAAAGGAAGG + Intergenic
1179505694 21:41838770-41838792 GACCCACAGCAGAAAAGGGGAGG + Intronic
1179646957 21:42782023-42782045 GAGGCAGAGGAGGGAGGGGAGGG - Intergenic
1179766235 21:43575031-43575053 GAGCAGCAGGAGGGGAGGGAAGG - Intronic
1179945342 21:44670468-44670490 GAGGCACAGAAGGCAAGGGAAGG + Intronic
1179994904 21:44969520-44969542 GAGCCACATCTGAGGAGGGACGG - Intronic
1180391779 22:12290523-12290545 GAGACACAGCATGGAAATGATGG - Intergenic
1180407965 22:12574233-12574255 GAGACACAGCATGGAAATGATGG + Intergenic
1180857617 22:19058359-19058381 GACCCACAGCAGAGCAGGAAAGG + Intronic
1180981450 22:19879923-19879945 GTGTCACAGCAGTGAGGGGAAGG - Intronic
1181107990 22:20585947-20585969 GAGCCAGAAGAGGGGAGGGAGGG - Intronic
1181343101 22:22198591-22198613 GTGCCTCAGCTGGGCAGGGAGGG - Intergenic
1181369597 22:22405461-22405483 CAGCCACAGAAGGCAAGGGAAGG + Intergenic
1181527954 22:23500929-23500951 GAGCCCCAGGAAGGAGGGGAGGG - Intergenic
1181610177 22:24006742-24006764 GAGTGGCAGCCGGGAAGGGATGG - Intergenic
1181748612 22:24973334-24973356 GAGCGAGAGCAGGGAATGGGCGG - Intronic
1182032934 22:27174517-27174539 GGGCCCCAGCAGGGAACAGATGG + Intergenic
1182062366 22:27407369-27407391 GAGACTCAGCAGAGAAGGAAAGG + Intergenic
1182327141 22:29521962-29521984 GAGACACAGTAGGGAAGAGCTGG - Intronic
1182388741 22:29971613-29971635 GAGACAAAACAGGGAAGGTAGGG - Intronic
1182477035 22:30581968-30581990 GAGCCGGAGCAGGGAGGGGAGGG - Intronic
1183056168 22:35307525-35307547 GGGACACAGCCGGGAAGGGGCGG - Intronic
1183391491 22:37547747-37547769 GAGCAGCAGCACGGAAGGGAGGG + Intergenic
1183529266 22:38344033-38344055 GAGCCATAAGAGAGAAGGGATGG + Intronic
1183589979 22:38774389-38774411 GAGCCAAAGCAGGAGAGGCAGGG - Intronic
1183720961 22:39561072-39561094 GGGACACAGCAGTGAACGGAAGG + Intergenic
1183750084 22:39714937-39714959 CTTCCACAGCAGGGAAGGGGTGG - Intergenic
1183770011 22:39916080-39916102 GGGGCAGAGCTGGGAAGGGAGGG - Intronic
1183934461 22:41254357-41254379 GAGCCTCAGCAGCGAGGGCAGGG - Exonic
1184017022 22:41793989-41794011 GAGTCACACAAGGGAATGGAAGG - Intronic
1184258922 22:43303354-43303376 GAGCCAATGCAGGGCATGGATGG - Intronic
1184365953 22:44051511-44051533 TAGCAACAGCAGGAAAAGGAAGG + Intronic
1184450196 22:44578076-44578098 TACCCAAAGCTGGGAAGGGAAGG - Intergenic
1184647387 22:45903577-45903599 GAGCCCCCGAAGGGAAGGGGGGG - Intergenic
1184739805 22:46421278-46421300 GAGCCCCAGCAGTGAGGGGTTGG + Intronic
1185022577 22:48387966-48387988 GACTCCTAGCAGGGAAGGGAGGG + Intergenic
1185031160 22:48443679-48443701 GAGGGAAAGAAGGGAAGGGAGGG + Intergenic
1185075445 22:48679784-48679806 CAGCCACACCAGGAGAGGGATGG - Intronic
1185148006 22:49149760-49149782 AAGGCAGAGGAGGGAAGGGAAGG + Intergenic
1185162705 22:49239288-49239310 GATCCACAGCAAGGAGGGCAAGG - Intergenic
1185337967 22:50279183-50279205 GAGCCGGAGCAGGCAGGGGAAGG - Intronic
1185377435 22:50488781-50488803 GAGGGACAGGAGGGACGGGAGGG - Intronic
1185377446 22:50488808-50488830 GAGGGACAGGAGGGATGGGAGGG - Intronic
949421682 3:3872687-3872709 GAGTAACAGGAGGGAAGGCAGGG - Intronic
950164577 3:10784429-10784451 AAACCACAGCAGGGAAAGGGAGG + Intergenic
950407791 3:12815531-12815553 CAGCCATGGAAGGGAAGGGAAGG + Intronic
951525649 3:23650405-23650427 GAGCAGCACCAGGGAAAGGAAGG - Intergenic
951543923 3:23806894-23806916 GCGCCACGGCGGGGCAGGGAGGG - Intronic
952269351 3:31817038-31817060 CAGCCAGAGCAGGGAGAGGATGG - Intronic
952354287 3:32570458-32570480 GAGCCGCAGCGCGGGAGGGACGG + Intronic
952953012 3:38539298-38539320 GAGGCAGAGCTGGGAAGGGCAGG - Intronic
953150495 3:40320019-40320041 GAGACAGAGAAGGGAAGGGAAGG - Intergenic
953312159 3:41890780-41890802 GAGGGACAGGAGGGACGGGATGG + Intronic
953934938 3:47033216-47033238 GAGCAAAGGCAGGGAAGGAAGGG - Intronic
954036812 3:47855205-47855227 GAGACACAGCTGGGGAGGGGTGG - Intronic
954125352 3:48524991-48525013 GAGCCACAGGAAGGACAGGATGG + Intronic
954686993 3:52376509-52376531 CAGCCACAGGAGGGAAGGCAGGG - Intronic
954791842 3:53139198-53139220 GAGGCAGAGCAGGGGAGGGTAGG - Intergenic
957952234 3:87141610-87141632 CAGCCCCAGCATGGAGGGGAGGG - Intergenic
958970494 3:100605613-100605635 AAGCCAGAGCAGGGAGAGGAGGG - Intergenic
959926836 3:111931616-111931638 CAGACAAAGCAGTGAAGGGAAGG - Intronic
960043426 3:113173313-113173335 GGGGCAGGGCAGGGAAGGGAAGG + Intergenic
960831622 3:121855573-121855595 GAATCACAGCAGGGCATGGATGG - Intronic
961089215 3:124094982-124095004 AAGACACAGCAGAGAGGGGAGGG + Intronic
961410393 3:126716277-126716299 GAGCAAAGGCACGGAAGGGAGGG - Intronic
961425162 3:126839577-126839599 TAGATGCAGCAGGGAAGGGAGGG - Intronic
961520338 3:127464063-127464085 GAGCCTGAGCAGCGAAGGGAGGG - Intergenic
962350154 3:134650669-134650691 GTGCCACTGCGGGGAAGCGACGG + Intronic
962629754 3:137263994-137264016 CTGCCACAGCAGGGGTGGGAGGG + Intergenic
962865943 3:139448113-139448135 GAGCTACAGAAGGGACAGGAGGG - Intergenic
963649676 3:147962898-147962920 ATGCCACAGCAGGGAAGGAAGGG - Intergenic
963919099 3:150888667-150888689 TAGCCACACTAGGGAAGGGCTGG - Intronic
963982680 3:151557499-151557521 TAGCAAATGCAGGGAAGGGAAGG - Intergenic
964133649 3:153318894-153318916 GAGAGAGAGAAGGGAAGGGAAGG + Intergenic
964204158 3:154152301-154152323 GACACACAAGAGGGAAGGGAAGG + Intronic
966140556 3:176752061-176752083 GAGAGAGAGAAGGGAAGGGAAGG + Intergenic
966140700 3:176752665-176752687 GAAAGAGAGCAGGGAAGGGAAGG + Intergenic
966690086 3:182732753-182732775 GAGCCCCAGCTGGGCAGGCAAGG - Intergenic
967106239 3:186257008-186257030 GAGATACAGCAGGGAATGAACGG - Intronic
967124101 3:186409186-186409208 GGGCCACAGCAGGGCAGTGTGGG - Intergenic
967174576 3:186851656-186851678 GAGCCAGAGAAAGGAAGGGAAGG - Intronic
967531499 3:190553581-190553603 CAGCCCCAGCCGGGATGGGACGG + Intronic
967847305 3:194054537-194054559 GAGCCACTGGAAGAAAGGGAAGG - Intergenic
967976858 3:195040366-195040388 GAGCCACAGTGGGGAGGAGAGGG + Intergenic
968509216 4:987992-988014 GAGGCACAGATGGGAGGGGAGGG + Exonic
968564939 4:1306894-1306916 CAGCCAGGACAGGGAAGGGATGG - Intronic
968657688 4:1785692-1785714 GAGCCCCAGCTGGGGAGTGAGGG - Intergenic
968750405 4:2386065-2386087 GAACACCAGCAGGGAAGGGAAGG - Intronic
968788512 4:2642411-2642433 TGGCCACAGAAGGGAAGGAATGG - Intronic
968816675 4:2825030-2825052 GAGTCACAGCAGAGCAGGCAGGG + Intronic
968957295 4:3725899-3725921 GAGCCAGCTCAGGGAAGGGCAGG - Intergenic
969260296 4:6029131-6029153 GTCCCACAGCTAGGAAGGGATGG - Intronic
969498536 4:7539869-7539891 CCCCCACAGCAGGGAGGGGATGG - Intronic
969684025 4:8659475-8659497 GAGAAAGAGAAGGGAAGGGAAGG - Intergenic
970056718 4:11982025-11982047 GAGCAACAGCAGCAAAGAGATGG - Intergenic
970163220 4:13209901-13209923 GAACCTGAGCAGGGAAAGGAGGG + Intergenic
970263430 4:14254326-14254348 GAGCCACGGCAAGGAAGGCTCGG + Intergenic
970346740 4:15159690-15159712 GAACCTCAGCAGGGGAGAGAGGG - Intergenic
970537243 4:17042043-17042065 GCGCTGCAGCAGGGATGGGAAGG + Intergenic
971299591 4:25430850-25430872 GGCCCAGAGGAGGGAAGGGAGGG - Intergenic
971963974 4:33527317-33527339 GATCCACAGAAGGGACAGGAAGG - Intergenic
972418471 4:38865513-38865535 ACGGCACAGCAGGGAAGGGAAGG + Intergenic
973774419 4:54231455-54231477 GAGCCACAGGAGGGGAGGAAGGG + Intronic
974674853 4:65076500-65076522 CAGCCCCAGCGGGGAGGGGATGG - Intergenic
975425877 4:74227035-74227057 GGGCCAGACCAGGGCAGGGAAGG - Intronic
975698510 4:77038905-77038927 GAGCAGCAGCAGGGAAGAGGAGG - Intronic
975977448 4:80115567-80115589 GAGCCACAGGGGGGAGGGGCAGG + Intronic
976304695 4:83548144-83548166 GAGCCACAGCATAGAAGGCTAGG + Intronic
976661199 4:87542509-87542531 GAGCCAGAGATGGGAAGTGAAGG - Intergenic
976988638 4:91335215-91335237 GAGCCACAGCATGAAACTGAGGG + Intronic
977258240 4:94764257-94764279 GAGCCACAGCAGAGAGTAGAGGG + Intronic
977998334 4:103523772-103523794 GACCAACAGGAAGGAAGGGAGGG - Intergenic
979448511 4:120840806-120840828 CAGCCACTGCAGGGAGGGTATGG - Intronic
980366517 4:131810322-131810344 GTGCCCCAGCCGGGAGGGGAGGG + Intergenic
981364281 4:143884093-143884115 GAGCCCCAAGAGGGAAGGGAAGG - Intronic
981385394 4:144124583-144124605 GAGCCCCAAGAGGGAAGGGAAGG - Intronic
981579389 4:146236702-146236724 GAGAGACAGCAAGGGAGGGAGGG + Intergenic
981737645 4:147969828-147969850 TAGCCACAGAAAGGAAGAGAAGG - Intronic
981841283 4:149115507-149115529 GAGTCACAGGAGAGAAGAGAAGG + Intergenic
982300972 4:153879246-153879268 AAGGAACAGCAGTGAAGGGAAGG + Intergenic
983095524 4:163557074-163557096 TAGCGATAGCAGGGAAGGGTTGG + Intronic
983941609 4:173538814-173538836 GAGTCACTGCAGGGAGGAGAGGG + Intergenic
985012661 4:185600163-185600185 GCACAACAGCAGGGCAGGGAGGG + Intronic
985494247 5:195741-195763 GCTCCACAGCAGGGAGGGGGAGG + Intergenic
985626885 5:993640-993662 GAGAAACAGCAGGGAGGAGAAGG + Intergenic
985719951 5:1483661-1483683 GCGCCACAGCACGGATGGGCAGG + Intronic
985853961 5:2410697-2410719 CAGCCACAGAAGGGCAGGGATGG + Intergenic
986038095 5:3960113-3960135 GATGGACAACAGGGAAGGGAAGG + Intergenic
986186882 5:5450918-5450940 GAGCAAAAGCAGACAAGGGATGG + Intronic
986278645 5:6304479-6304501 GGTCCAGAGGAGGGAAGGGAAGG + Intergenic
986429225 5:7665230-7665252 CAGCCAAAGAAGGGAAGGAAAGG - Intronic
986568523 5:9140540-9140562 GAGTCACAGCAGGGAGCAGAAGG - Intronic
987087329 5:14483214-14483236 AAGCTACATCAGGGCAGGGAGGG - Intronic
988613553 5:32751420-32751442 GTGCCAAAGGAGGGAAGGCAGGG + Intronic
990751416 5:59020826-59020848 TAGCCACAGCCGGTAAGAGAAGG - Intronic
991032177 5:62094249-62094271 TACCTACAGCAGGGAAAGGAAGG + Intergenic
991662874 5:68968418-68968440 GAGAGAAAGGAGGGAAGGGAAGG + Intergenic
991725488 5:69531615-69531637 CCACCACAGGAGGGAAGGGAGGG - Intronic
992127367 5:73655689-73655711 GAGGCACAGCAGGGTTGGGCTGG + Intronic
993404884 5:87499449-87499471 GAGCTACAGAAGGGAATGAACGG - Intergenic
993502407 5:88678513-88678535 GAGGCGCAGAAGGGAGGGGAGGG - Intergenic
993822774 5:92640870-92640892 AAGGCACAAAAGGGAAGGGAGGG - Intergenic
994684297 5:102930393-102930415 GACCCAGAGCAGGGTATGGAAGG + Intronic
994885869 5:105561036-105561058 GAGAGACAGCCAGGAAGGGAGGG + Intergenic
995014061 5:107290121-107290143 CAGCCTAAGCAGGGAAGGCAAGG + Intergenic
996864987 5:128110243-128110265 GAGCCACACCAGGAAAAGGTCGG - Intronic
997670696 5:135669433-135669455 GTGAAACAGAAGGGAAGGGATGG + Intergenic
998035292 5:138910079-138910101 GAGGCACAGAAGGGTAGAGATGG - Intronic
998179602 5:139927276-139927298 TAAGCACAGCAGGGAAGGGAGGG - Intronic
999245515 5:150152435-150152457 GAGCGTTAGGAGGGAAGGGAAGG - Intronic
999766425 5:154744423-154744445 GAGTAACACCAGGGGAGGGATGG + Intronic
999773417 5:154792508-154792530 GAGCCACAGCATGCAATGGCAGG - Intronic
1000105516 5:158055322-158055344 GTGACACAGCTGGGAAGGGCAGG - Intergenic
1000267601 5:159652645-159652667 GAGCCACTGAAGGGCAGGGCAGG - Intergenic
1000364875 5:160481450-160481472 GAGGGAGAGAAGGGAAGGGAGGG - Intergenic
1001192979 5:169647668-169647690 GTGTGACAGCAGGGAAGAGAGGG - Intronic
1001309416 5:170600225-170600247 GAGCCAAGGCAGGGCAGGGCTGG - Intronic
1001450417 5:171820302-171820324 GACCCAGAGCAGGAAAGGGCTGG + Intergenic
1001528328 5:172444894-172444916 GAACCACAGGAGAGAAGGCATGG - Intronic
1001926439 5:175640510-175640532 AAGCCTCAGCTGGGAAGGGCTGG + Intergenic
1002039910 5:176505394-176505416 GAGCCAGAGCAGGGTAAGGAGGG + Intronic
1002191143 5:177478316-177478338 GAGAGGCAGCAGGCAAGGGAGGG - Intergenic
1002193846 5:177491933-177491955 GAGACACAGCCGGGCAGGGCGGG + Intronic
1002299291 5:178248328-178248350 GAGCCACATGGGGGAAGGAAGGG - Intronic
1003096747 6:3148280-3148302 GGACCACAGAAGGGAAGGAAGGG + Intronic
1003191538 6:3879432-3879454 GAGCCACAGCAGGGTCAGGGTGG + Intergenic
1003397408 6:5765136-5765158 ATGCAACAGCAGGGAGGGGATGG - Intronic
1003443524 6:6164852-6164874 GAGTCATAGCAGGGGAGGGAAGG - Intronic
1003598878 6:7500290-7500312 GAGCCAAGGGAGGGAAAGGAAGG + Intergenic
1004044381 6:12011610-12011632 GAGCCGCCGCAGGGACGGGAGGG - Intronic
1004432403 6:15556760-15556782 GAGAGAGAGAAGGGAAGGGAAGG - Intronic
1005393169 6:25354467-25354489 AAGCCACAGCAGGGCAAGTACGG - Intronic
1005494479 6:26376496-26376518 GAGCCACAGCATGCAAGGCTTGG - Intronic
1006151867 6:31994164-31994186 GGGCCACAGGAGGGAGGGGTGGG - Intronic
1006158168 6:32026902-32026924 GGGCCACAGGAGGGAGGGGTGGG - Intronic
1006293362 6:33157935-33157957 TAACCACAACTGGGAAGGGATGG + Intergenic
1006295269 6:33167401-33167423 GAGTCACTGCAGGGAAGGGCTGG - Intronic
1006720198 6:36145189-36145211 GGACCACAGTAGGGCAGGGATGG - Intergenic
1007041626 6:38727388-38727410 GAGGCACAGCAGGAAATGGGAGG + Intronic
1007248479 6:40479569-40479591 GGACCACAGCAGGAAAGAGACGG - Intronic
1008731830 6:54491985-54492007 CAACCACAGTAGGGCAGGGAAGG - Intergenic
1008813930 6:55540054-55540076 GAAGCAAAGGAGGGAAGGGAAGG + Intronic
1009243108 6:61203259-61203281 GAGAGAAAGGAGGGAAGGGAGGG + Intergenic
1010120098 6:72365240-72365262 GGACCCCAGCAGGGAAGAGAAGG - Intronic
1010507253 6:76675634-76675656 GAGGGAGAGAAGGGAAGGGAAGG - Intergenic
1010958614 6:82119906-82119928 CAGCCACAGCAAGCAGGGGAAGG + Intergenic
1011198668 6:84809782-84809804 GAGACACAGCAGGGAAGTGGTGG + Intergenic
1012257334 6:97049063-97049085 TAGCCCCAGCAGGTAAGGAAGGG - Intronic
1012771287 6:103437872-103437894 GAGCAACAGCAGCTATGGGAGGG + Intergenic
1013607589 6:111764866-111764888 GAGCCACAGCAGGGAAGGGAAGG - Intronic
1014098389 6:117483335-117483357 GAGCGACGGCAGGGAGGGCAGGG - Intronic
1014250699 6:119112973-119112995 GAGCTGCAGAAGGGAGGGGAAGG + Intronic
1015163193 6:130175377-130175399 CAGGACCAGCAGGGAAGGGAAGG + Intronic
1016804968 6:148203384-148203406 GAGAAACAGAAAGGAAGGGAGGG - Intergenic
1016900471 6:149096201-149096223 TAGACACAGCAGTAAAGGGAAGG - Intergenic
1017106900 6:150896449-150896471 CACCCACAGCAGGCAGGGGAGGG - Intronic
1017166593 6:151413642-151413664 GATCCAGAGGAGGAAAGGGAGGG - Intronic
1017812623 6:157994930-157994952 GAGCCACAGCCTGGAAAGCAAGG - Intronic
1018197587 6:161368636-161368658 GAGCCACTGCAGTGAGGGGAGGG - Intronic
1018299393 6:162384929-162384951 GAGCAACAAAAGGGAGGGGAAGG - Intronic
1018661003 6:166087485-166087507 GAGTGCCAACAGGGAAGGGAAGG + Intergenic
1018989788 6:168665315-168665337 TAGCCACAGCATGAAAGGCATGG - Intronic
1019076730 6:169393972-169393994 GCACCGCAGCTGGGAAGGGAGGG + Intergenic
1019308691 7:348377-348399 GACCCCCAGCAGGGACTGGAGGG - Intergenic
1019614162 7:1951370-1951392 GAGCCACACCCCGGACGGGAGGG - Intronic
1019709960 7:2513665-2513687 CAGCCACAGCAGGCAGGGGGTGG - Intronic
1019758134 7:2788411-2788433 GAGCCAGAGGAGGGTGGGGAGGG - Intronic
1021444684 7:20719660-20719682 GAGCCAGAGCAGGGTGAGGAGGG + Intronic
1022532727 7:31076937-31076959 GAGACACAGCAGGCCAGGGCTGG - Intronic
1023317652 7:38956854-38956876 GAGCAGTAGGAGGGAAGGGAAGG - Intergenic
1023730824 7:43190426-43190448 TAGTCACAGTAGGGAAGGGGAGG + Intronic
1024242956 7:47449391-47449413 GAAGCACAGCAGGTAAGGTAGGG - Intronic
1024246912 7:47477549-47477571 GAGCTCCAGCAGGTGAGGGAGGG + Intronic
1024560974 7:50644940-50644962 GAGACACAGCAGGCACAGGATGG + Intronic
1026337805 7:69409817-69409839 GGGGCAGAGCAGGGAAGGGGAGG + Intergenic
1026563390 7:71469106-71469128 AAGGCACAGCAGAGGAGGGAAGG + Intronic
1026806076 7:73430346-73430368 AGGGCACTGCAGGGAAGGGAAGG - Intergenic
1026819392 7:73536808-73536830 GAGACATTGGAGGGAAGGGAAGG - Exonic
1026940853 7:74287162-74287184 GGGCAACAGAAGGGATGGGATGG - Intergenic
1027172782 7:75884666-75884688 TAGCAACAGCAGGAAAGGGAAGG + Intronic
1027820149 7:83032430-83032452 GAGGCAAGGGAGGGAAGGGAAGG - Intronic
1028403861 7:90455309-90455331 GAGACAGAGCAGGGAATGGAAGG - Intronic
1029041161 7:97576267-97576289 GAAACACAGCAGGGAGGGAATGG + Intergenic
1029351602 7:100016658-100016680 GGGGCACTGCAGGAAAGGGAGGG - Intronic
1029478798 7:100800928-100800950 GACCCAAACCCGGGAAGGGAGGG + Intergenic
1029506625 7:100967015-100967037 GACCCCCACCAGGGCAGGGAGGG + Intronic
1029545308 7:101207416-101207438 GAGGCACCCCAGGGGAGGGAGGG - Intronic
1029853129 7:103485577-103485599 TAGCCAAAGCTGGGAAGGGCAGG + Intronic
1030450995 7:109710818-109710840 CAGCCTGAGCAGGGTAGGGAGGG - Intergenic
1031679136 7:124649473-124649495 AAGCCACAGGAGGGCAGGAATGG - Intergenic
1031847382 7:126822512-126822534 GAGACAAGGAAGGGAAGGGAAGG - Intronic
1031926513 7:127643752-127643774 GAGCCACAGTAAGCAAGAGAGGG + Intergenic
1032325438 7:130924193-130924215 GCTCCCCAGCAGGGCAGGGATGG + Intergenic
1032472186 7:132186484-132186506 GAGCCCATCCAGGGAAGGGAGGG + Intronic
1032509453 7:132460449-132460471 GAGCCACAGGAGAGAAGGGTGGG - Intronic
1032742600 7:134753832-134753854 GAGTCAGAGCAGGCCAGGGAGGG - Intronic
1033038732 7:137899264-137899286 GAGGCACAGCAGGGATGTGCTGG - Intronic
1033242638 7:139693010-139693032 GAGCCACTGCAGGAAGGGGCTGG + Intronic
1033345617 7:140523492-140523514 GAGCCACTGCAGGGCAGGCCTGG + Intronic
1033348014 7:140540484-140540506 GTCCCAGAGCAGGGCAGGGAGGG + Intronic
1035059271 7:156057047-156057069 GAGTCACTGCAGGGAAAAGAAGG - Intergenic
1035224744 7:157426956-157426978 CAGTCACAGGAGGGAAGGGGTGG - Intergenic
1035329371 7:158086045-158086067 AAGCCAAAGCAGGAATGGGAAGG - Intronic
1035451007 7:158976690-158976712 CAGCCAGAGCAGGGCAGAGAAGG + Intergenic
1035464415 7:159065282-159065304 CAGCCACTGCAGGGGAGGGGAGG - Intronic
1035578671 8:725709-725731 CGGCCCCAGCAGGGAAGGGCAGG - Intronic
1035915357 8:3614892-3614914 GGGGCACAGAAGGAAAGGGAAGG + Intronic
1037319593 8:17630643-17630665 GTGCCCCAGCAGGGAGGGGAGGG - Intronic
1037365904 8:18122067-18122089 CAGCCAAAGCAGGAGAGGGATGG - Intergenic
1037453406 8:19039617-19039639 GAGCCACAGGTGTGAAGGGTTGG - Intronic
1037670975 8:21015070-21015092 GCGCCACAGCAGTGTAGGGAGGG - Intergenic
1037823929 8:22149444-22149466 GTGGCAAGGCAGGGAAGGGAGGG + Intronic
1038325515 8:26569822-26569844 GGGCCATTGCAGGGAAAGGAAGG + Intronic
1038829101 8:31036990-31037012 CATCCACAGGAGGGAGGGGATGG + Intronic
1040554939 8:48469990-48470012 GGCCCACAGCAGGGAAGGTCTGG + Intergenic
1041660050 8:60392534-60392556 GAGCCAAAGCAAGAGAGGGAGGG - Intergenic
1041972738 8:63761520-63761542 GAACCCCAGCAGGGAGGGGTGGG - Intergenic
1043512142 8:80960120-80960142 AAGGCAGGGCAGGGAAGGGAAGG - Intergenic
1043855105 8:85255831-85255853 GAGCCACAGCAAGGGTGGTAGGG - Intronic
1044262434 8:90142147-90142169 GAGAGAGAGAAGGGAAGGGAGGG + Intergenic
1044289644 8:90452793-90452815 GAGCTACAGCTGGGCAGGGCAGG + Intergenic
1044488521 8:92783345-92783367 GAGCCACAGCAGGTAGGTGAAGG + Intergenic
1044496417 8:92891013-92891035 GACACACAGCATGGAAGAGATGG + Intronic
1044767905 8:95596856-95596878 GAACCACAGCATGAGAGGGAGGG + Intergenic
1044831382 8:96253359-96253381 GACCCAAAGAAGGGAAGGAACGG + Intronic
1045283945 8:100773689-100773711 CAGTCCCAGCAGGCAAGGGAAGG + Intergenic
1045532779 8:103000358-103000380 GTGCCAGAACAGGGAAGTGAAGG + Intergenic
1046104612 8:109650485-109650507 CAGCTACAGCAGGGAATGGTTGG + Intronic
1047759927 8:127946880-127946902 ATGTCAGAGCAGGGAAGGGAAGG - Intergenic
1048019054 8:130521495-130521517 GAGCCACAGGAGGGAAGTGGAGG + Intergenic
1048529348 8:135233612-135233634 CAGCCAGAGCGGGGCAGGGAGGG - Intergenic
1048574060 8:135677425-135677447 CAGAAGCAGCAGGGAAGGGAGGG + Intergenic
1048593000 8:135838859-135838881 GAGGCACAGCTAGGAAGGGATGG - Intergenic
1049030324 8:140031766-140031788 CATCCACAGCAGTGCAGGGATGG + Intronic
1049191194 8:141288709-141288731 GACACACAGCAGGGACTGGATGG + Intronic
1049229190 8:141473335-141473357 CAGGCAGAGAAGGGAAGGGAGGG - Intergenic
1049358718 8:142201676-142201698 GACCCACAGCAGGGAGAGGGGGG + Intergenic
1049436159 8:142587203-142587225 GAGCCACAGAAAGGGAAGGAAGG + Intergenic
1050636088 9:7614693-7614715 AAGCCAGAGCAGGGAAGGCCTGG - Intergenic
1051180146 9:14403308-14403330 CAGCCTCAGCAGGCAAGGCAGGG + Intergenic
1051605873 9:18917422-18917444 GAGACACAGGAGAAAAGGGAAGG + Intergenic
1052048512 9:23821594-23821616 GAGTCACAGCAGGCAAGTGCTGG - Intronic
1053221394 9:36316080-36316102 GAGCCAAAGGAGGGGTGGGAAGG + Intergenic
1053281966 9:36826353-36826375 GAGCCACAGCAGGGGCCGGTCGG - Intergenic
1054854175 9:69880288-69880310 TAGTCAGGGCAGGGAAGGGATGG - Intronic
1055098777 9:72441553-72441575 GAGCCAGAGTAGGCACGGGAGGG - Intergenic
1056307006 9:85300276-85300298 GAGACACAGCCAGGCAGGGAAGG + Intergenic
1056628633 9:88274652-88274674 GACCCAGAGCTGGGGAGGGAGGG - Intergenic
1056755757 9:89381163-89381185 GAGCCCCAGCAGGTATGGGGCGG - Exonic
1056795168 9:89654105-89654127 TGGCTGCAGCAGGGAAGGGAGGG + Intergenic
1057163503 9:92908121-92908143 TGCCTACAGCAGGGAAGGGAAGG + Intergenic
1057211008 9:93201117-93201139 CAGCCACAGGATGGAAAGGATGG - Intronic
1057422795 9:94926036-94926058 GAGGCACTCCAGGGAAGAGATGG - Intronic
1057445482 9:95111517-95111539 GAGCCACAGCAGGGCCGTGGGGG + Exonic
1057557618 9:96100301-96100323 GAGGCAGAGCAGAGAAGGGCGGG + Intergenic
1058251966 9:102710288-102710310 GTCCCACAGAAGGGATGGGATGG - Intergenic
1058736790 9:107900943-107900965 GCCTCACAGCAGGAAAGGGAAGG + Intergenic
1059428646 9:114236834-114236856 AGCCCACAGCAGGGAAAGGAAGG + Intronic
1059432824 9:114260190-114260212 AAGCCACTGCTGGGAAGGGGTGG - Intronic
1059525810 9:114989979-114990001 GAGCCACAGCTCGGGAGGCAGGG - Intergenic
1060258957 9:122057054-122057076 AAGCCAGAGGTGGGAAGGGAAGG + Intronic
1060412688 9:123410571-123410593 CACCCACAGCGGGGAAGGGAAGG + Intronic
1060499658 9:124143499-124143521 GGGTCCCAGCAGGAAAGGGATGG + Intergenic
1060607203 9:124926069-124926091 GAACCGCAGCAGGAAAGAGACGG + Intronic
1060739878 9:126091136-126091158 CAGACACAGCAGGGAAGGGAAGG + Intergenic
1061706880 9:132460150-132460172 GAGCAACAGCAGGAAATGGATGG - Intronic
1061891057 9:133619968-133619990 CAGCCACAGCAAGGGAGGGCTGG + Intergenic
1061913053 9:133734983-133735005 GTGGCACAGCAGGGCAGGGAGGG + Intronic
1061985087 9:134125951-134125973 GAGCCAGAGAAGGGGAGGGGAGG + Intergenic
1062331831 9:136048258-136048280 CAGCCACCCCAGGGAAGGCAGGG - Intronic
1062447148 9:136599782-136599804 GACCCACGGCTGGGCAGGGAGGG + Intergenic
1062476871 9:136732668-136732690 CAGCCAAAGCAGGGAGGGGAAGG - Intergenic
1062580475 9:137227201-137227223 GCTCCACAGCAGGGCAGGGCAGG + Intergenic
1062703977 9:137924391-137924413 GAGCTACAGGAAGGAAGGGAGGG - Intronic
1185581327 X:1213154-1213176 GAGAGGCAGAAGGGAAGGGAGGG - Intergenic
1185701462 X:2233989-2234011 GAGGCATAGCAGGGAAGGAGAGG + Intronic
1186747211 X:12582528-12582550 GAGGCAGGACAGGGAAGGGAAGG + Intronic
1187046610 X:15653599-15653621 GAGGCAGAGAAGGGAAGAGATGG - Intronic
1187274414 X:17805565-17805587 GAGTCACAGCAGGGGATGCAAGG - Intronic
1187568765 X:20479027-20479049 GAGACTCAGAAGGGAAGGGTGGG + Intergenic
1187670864 X:21664818-21664840 GAGACAGGGAAGGGAAGGGAAGG - Intergenic
1187701677 X:21969375-21969397 GGGTCACAGCAGGGAAGAAAAGG - Intronic
1189381583 X:40506303-40506325 GGGCCACAGAATGGGAGGGAGGG - Intergenic
1190368830 X:49722605-49722627 GAACCACAGCCAGGCAGGGAAGG - Intergenic
1190597151 X:52061539-52061561 GGGCCACAGCAGGGGCGGGGTGG - Intergenic
1190611673 X:52192534-52192556 GGGCCACAGCAGGGGCGGGGTGG + Intergenic
1191645009 X:63470780-63470802 CAGCCCCAGCAAGGAGGGGAGGG + Intergenic
1191944812 X:66521342-66521364 GGGACTCAGCAGGGAAGGGTGGG - Intergenic
1192048188 X:67698752-67698774 CAGACACAGCAGGGAAAGCAAGG - Intronic
1192078300 X:68022615-68022637 GAAACAGAGCAGGGAAGAGAAGG - Intergenic
1192177483 X:68895026-68895048 GAGGGAGAGGAGGGAAGGGAGGG - Intergenic
1192358068 X:70422120-70422142 CAGCATCAGCAGGGAAGGGCTGG - Intergenic
1193894768 X:87099754-87099776 GAGCCACTGAAGGATAGGGAAGG - Intergenic
1194103607 X:89738690-89738712 TGGCCACAGTAGGGAATGGAGGG + Intergenic
1195041653 X:101020370-101020392 GACCCACAGGGAGGAAGGGAGGG - Intronic
1195697057 X:107674793-107674815 AACCCACAGCAGAGAGGGGAGGG + Intergenic
1195745622 X:108114616-108114638 GCTCCACAGCAGGGATGTGAAGG + Intronic
1195858033 X:109351741-109351763 GAGGCATACCAGGGCAGGGAGGG + Intergenic
1196818616 X:119685372-119685394 GGGTCAAAGCAGGGAAGGGGTGG + Intronic
1197061831 X:122190506-122190528 CAGACCCAGCAGGGACGGGAGGG - Intergenic
1197366172 X:125567177-125567199 CATCCCCAGCAGGGAGGGGAAGG + Intergenic
1197466986 X:126816971-126816993 GAGAGACAGCAAGGAAGAGAGGG - Intergenic
1197923933 X:131626772-131626794 GAGGCAGGGAAGGGAAGGGAAGG + Intergenic
1198394752 X:136209643-136209665 GAGCCACAGCAGGGTTGCGGCGG + Intronic
1198666237 X:139026278-139026300 GAGCCACAGCATGAAATAGAGGG + Intronic
1199853027 X:151738848-151738870 GCCCCACAGCAGGGAAGGAGTGG + Exonic
1200086609 X:153610255-153610277 CAGCCACACCAGGGGAGGGCGGG - Intergenic
1200117732 X:153776624-153776646 GAGGCAGAGCAGGGCAGGGCTGG + Intronic
1200117778 X:153776730-153776752 GAGGCAAGGCAGGGAAGGGCAGG + Intronic
1200231383 X:154445439-154445461 GAGCCAGAGCAGCTCAGGGATGG + Intronic