ID: 1013607590

View in Genome Browser
Species Human (GRCh38)
Location 6:111764870-111764892
Sequence GAATGAGCCACAGCAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 960
Summary {0: 1, 1: 0, 2: 15, 3: 119, 4: 825}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013607590_1013607602 16 Left 1013607590 6:111764870-111764892 CCCTTCCCTGCTGTGGCTCATTC 0: 1
1: 0
2: 15
3: 119
4: 825
Right 1013607602 6:111764909-111764931 GCTGGCAGCTGGAGGCAGGAGGG No data
1013607590_1013607595 5 Left 1013607590 6:111764870-111764892 CCCTTCCCTGCTGTGGCTCATTC 0: 1
1: 0
2: 15
3: 119
4: 825
Right 1013607595 6:111764898-111764920 TGTTCCCCTTTGCTGGCAGCTGG No data
1013607590_1013607594 -2 Left 1013607590 6:111764870-111764892 CCCTTCCCTGCTGTGGCTCATTC 0: 1
1: 0
2: 15
3: 119
4: 825
Right 1013607594 6:111764891-111764913 TCTCTCTTGTTCCCCTTTGCTGG 0: 1
1: 0
2: 2
3: 37
4: 303
1013607590_1013607601 15 Left 1013607590 6:111764870-111764892 CCCTTCCCTGCTGTGGCTCATTC 0: 1
1: 0
2: 15
3: 119
4: 825
Right 1013607601 6:111764908-111764930 TGCTGGCAGCTGGAGGCAGGAGG 0: 1
1: 1
2: 9
3: 99
4: 898
1013607590_1013607603 27 Left 1013607590 6:111764870-111764892 CCCTTCCCTGCTGTGGCTCATTC 0: 1
1: 0
2: 15
3: 119
4: 825
Right 1013607603 6:111764920-111764942 GAGGCAGGAGGGTGCTCTGATGG 0: 1
1: 0
2: 6
3: 58
4: 577
1013607590_1013607600 12 Left 1013607590 6:111764870-111764892 CCCTTCCCTGCTGTGGCTCATTC 0: 1
1: 0
2: 15
3: 119
4: 825
Right 1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG No data
1013607590_1013607596 8 Left 1013607590 6:111764870-111764892 CCCTTCCCTGCTGTGGCTCATTC 0: 1
1: 0
2: 15
3: 119
4: 825
Right 1013607596 6:111764901-111764923 TCCCCTTTGCTGGCAGCTGGAGG 0: 1
1: 1
2: 2
3: 40
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013607590 Original CRISPR GAATGAGCCACAGCAGGGAA GGG (reversed) Intronic
900754801 1:4426071-4426093 GGAGGAGGCACAGCATGGAAGGG - Intergenic
900873789 1:5326651-5326673 ATCTGAGCCACAGGAGGGAAGGG - Intergenic
900963052 1:5937951-5937973 GTGAGAGCCACAGCAGGGACAGG + Intronic
901290349 1:8119325-8119347 GACTGAGGCACAGAAAGGAAAGG + Intergenic
901536009 1:9883399-9883421 GAAGGAGGCAGAGCAGGGCAGGG + Intronic
901757870 1:11452248-11452270 GAATGAGTCCCAGGAAGGAAGGG - Intergenic
901960119 1:12819585-12819607 GCGTGAGCCAAAGCAGGGCAAGG - Intergenic
902222912 1:14978133-14978155 GAACCAGCCCCAGCTGGGAATGG - Intronic
902756247 1:18551015-18551037 GAATTTGCCACAACAGGGAGTGG - Intergenic
903202568 1:21754408-21754430 TAATGAGCTAGTGCAGGGAATGG + Intronic
904092707 1:27956334-27956356 GGATGGGCCATAGCAGGGCAGGG - Intronic
904897724 1:33829682-33829704 GCATGAGCCAAAGCAGGGTGAGG + Intronic
906663722 1:47602393-47602415 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
906753600 1:48288524-48288546 GCATGAGCCAAAGCAGGACAAGG + Intergenic
907386767 1:54130811-54130833 AACTGAGCCACAGAAGGAAATGG + Intergenic
908295073 1:62705358-62705380 GTGTGAGCCAAAGCAGGGCAAGG - Intergenic
908638132 1:66190800-66190822 GTATGAGCCAAAGCAGGGTGAGG - Intronic
908876903 1:68687452-68687474 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
908986043 1:70023257-70023279 GAATGACCCACAGCTGGCATGGG + Exonic
909368223 1:74854082-74854104 GAATGGGGCTCAGCTGGGAATGG - Intergenic
909379932 1:74986677-74986699 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
910857817 1:91713448-91713470 GAATGAGGCATAGCAGGGAGGGG - Intronic
911091661 1:94022210-94022232 GAATAGGCCACTCCAGGGAAGGG - Intronic
911676954 1:100668940-100668962 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
913284961 1:117217759-117217781 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
913367301 1:118054258-118054280 GACTGAGCCACATCAGTGATGGG + Intronic
913607361 1:120478309-120478331 GGATGAGCCAAAGCAGGGTGGGG + Intergenic
914209072 1:145561830-145561852 GGATGAGCCAAAGCAGGGTGGGG - Intergenic
914267991 1:146054196-146054218 GGATGAGCCAAAGCAGGGTGGGG - Intergenic
914369103 1:147006663-147006685 GGATGAGCCAAAGCAGGGTGGGG + Intergenic
914583833 1:149043525-149043547 GGATGAGCCAAAGCAGGGTGGGG - Intronic
915869025 1:159538378-159538400 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
915987504 1:160481266-160481288 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
916064019 1:161121546-161121568 GAAGGAGCCACATCAGGCAGAGG + Exonic
916166863 1:161972714-161972736 AAATGTGCCACAGCAGGGTATGG + Intergenic
916543889 1:165783968-165783990 GCGTGAGCCAAAGCAGGGCAAGG - Intronic
916580199 1:166100371-166100393 GCATGAGCCGAAGCAGGGCAAGG + Intronic
916603471 1:166316844-166316866 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
916762435 1:167829362-167829384 AGATGCGCCACAGCAAGGAAAGG + Exonic
917111812 1:171556393-171556415 GGGTGAGCCAAAGCAGGGCAGGG - Intronic
917160321 1:172050049-172050071 GAAAGAGCCACAGGAGTTAAGGG + Intronic
917181398 1:172302054-172302076 GGACGAGCCAAAGCAGGGTAGGG + Intronic
917308833 1:173656074-173656096 GGGTGAGCCAAAGCAGGGCAGGG - Intronic
917711782 1:177692693-177692715 GCGTGAGCCAAAGCAGGGCAAGG + Intergenic
917987261 1:180333693-180333715 GCGTGAGCCAAAGCAGGGCAAGG + Intronic
918541473 1:185637798-185637820 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
919171107 1:193955238-193955260 GAATTAGCCTCAGATGGGAAAGG - Intergenic
919375357 1:196786771-196786793 GCGTGAGCCAAAGCAGGGGAAGG - Intronic
920064370 1:203256629-203256651 GGGTGAGCCAAAGCAGGGCAGGG + Intronic
920238298 1:204524389-204524411 TAACAAGCCACATCAGGGAAAGG - Intronic
920294782 1:204949257-204949279 GGAAGAGCCACAGCAGGGAAGGG - Intronic
921288460 1:213631173-213631195 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
921806564 1:219462013-219462035 GCATGATACAAAGCAGGGAATGG - Intergenic
922244860 1:223786289-223786311 GAAGGGGCCACATCAGGGAGGGG + Intronic
922586185 1:226736649-226736671 GGGTGAGCCACAGCGGGGACTGG + Exonic
922826739 1:228526649-228526671 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
923085999 1:230703976-230703998 GGAGGAGGCACAGCAGGGATGGG + Intronic
923423610 1:233845612-233845634 GTCTGAGCCTCAGTAGGGAAAGG - Intergenic
923519065 1:234722076-234722098 GAATGACCCAAAGAAGGAAAAGG - Intergenic
923800545 1:237204960-237204982 TAATGAGCCTCAGCAGGGACGGG + Intronic
924864307 1:247960901-247960923 GCGTGAGCCAAAGCAGGGCAAGG - Intronic
1063173541 10:3531313-3531335 GAATTAGCCACAGCGGTGAAGGG - Intergenic
1063333042 10:5180953-5180975 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1063954796 10:11255929-11255951 GGAGGAGACACAGCAGGGGAAGG + Intronic
1064791282 10:18959954-18959976 TAATGAGCCCCACCAGGGACTGG - Intergenic
1064901183 10:20297390-20297412 GCACGAGCCACAGCAGGGCGAGG - Intergenic
1065156986 10:22880803-22880825 GGGTGAGCCAAAGCAGGGCAGGG + Intergenic
1065184705 10:23160467-23160489 TAAAGAGCCACACCAGAGAATGG + Intergenic
1065198063 10:23286388-23286410 GACTGAGACATAGAAGGGAAGGG + Intronic
1065216309 10:23452117-23452139 AAATGGGTCAGAGCAGGGAAGGG + Intergenic
1065649768 10:27875724-27875746 GCATGAGCCAAAGCAGGGCAAGG + Intronic
1065740237 10:28790959-28790981 TAATGAGCCCCACCAGGGACGGG + Intergenic
1066582763 10:36898890-36898912 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1066786103 10:39005599-39005621 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1067172612 10:43920732-43920754 GGGTGAGCCAAAGCAGGGCAGGG - Intergenic
1067777785 10:49175769-49175791 CACTGAGCCACACCTGGGAAGGG + Intronic
1068970110 10:62949783-62949805 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1069094042 10:64236918-64236940 GACTGAGTCACAGCAGGAACTGG + Intergenic
1069716663 10:70525602-70525624 GAATCATCCACAGCAGGTCAGGG - Intronic
1070064648 10:73021663-73021685 GAATGAGCCAAAGCAGGGCGGGG + Intronic
1070175499 10:73966131-73966153 GAAGGAACAACTGCAGGGAAGGG - Intergenic
1070337340 10:75467255-75467277 GTGTGAGCCATGGCAGGGAAGGG + Intronic
1070480663 10:76879344-76879366 GAGTGAGCCAGAGCAGGAGAGGG - Intronic
1071372933 10:84972115-84972137 GTGTGAGCCAAAGCAGGGCAAGG + Intergenic
1071524925 10:86353048-86353070 GAACGTGCCCCAGGAGGGAAAGG + Intronic
1071669573 10:87596075-87596097 GAATGAGCTTCAGCAAGGACAGG + Intergenic
1071740844 10:88356179-88356201 GCATGAGCCAAAGCAGGGAGAGG - Intronic
1071900832 10:90119024-90119046 GCATGAGCCAAAGCAGGGAGAGG - Intergenic
1072034018 10:91548118-91548140 GGATAAGCCACAGCAGGTTATGG - Intergenic
1072287249 10:93927844-93927866 GCATGAGCCAAAGCAGGGTGGGG + Intronic
1072316747 10:94210921-94210943 GACTGGGCTACAGAAGGGAAAGG - Intronic
1072364509 10:94695661-94695683 GCATGAGCCAAAGCAGGGTGAGG + Intronic
1072382741 10:94892523-94892545 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1072394768 10:95027074-95027096 GAGTGAGCCAAAGCAGGGTGGGG - Intergenic
1072451810 10:95544735-95544757 AAAGGAGCTCCAGCAGGGAAGGG - Intronic
1072859029 10:98983671-98983693 GCGTGAGCCAAAGCAGGGCAAGG + Intronic
1072944399 10:99796837-99796859 GAAGGAGCAAGAGCAGGGTAAGG + Intronic
1073924920 10:108504565-108504587 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1074017098 10:109545485-109545507 GGGTGAGCCACAGCAGGGCAGGG + Intergenic
1075122037 10:119671449-119671471 GAAGGTGGCCCAGCAGGGAAAGG + Intronic
1076107097 10:127832266-127832288 AAATGAGACACAGGAGGGTAGGG + Intergenic
1076546760 10:131250614-131250636 TCTTGAGCCACAGCAGGGATGGG + Intronic
1077139039 11:1015494-1015516 GAGTGAGCCAGTGCAGGGAAAGG + Intronic
1077771323 11:5221942-5221964 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1077834570 11:5914646-5914668 GCGTGAGCCAAAGCAGGGCAAGG + Intronic
1078013025 11:7588343-7588365 CAATCAGCCTCAGCAGGGAGAGG - Intronic
1078572349 11:12470169-12470191 GAATTTGCCAAAGCAGAGAATGG - Intronic
1078977673 11:16496497-16496519 GCATGAGCCAAAGCAGGGCAAGG + Intronic
1079177666 11:18157954-18157976 GCATGAGCCGAAGCAGGGAGAGG + Intronic
1079516140 11:21272081-21272103 GCATGAGCCGAAGCAGGGCAAGG + Intronic
1079752530 11:24217268-24217290 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1079832117 11:25281286-25281308 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1079922600 11:26451259-26451281 GCATGAGCCGAAGCAGGGCAAGG + Intronic
1080031419 11:27665445-27665467 GCATGAGCCAAAGCAGGGTGGGG + Intronic
1080306371 11:30840693-30840715 GAAGGAGCCAGAGCAGGGTGAGG + Intronic
1081086747 11:38811341-38811363 GCGTGAGCCAAAGCAGGGCAAGG + Intergenic
1081087717 11:38822225-38822247 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1081143864 11:39536776-39536798 GAGTGAGCCAAAGCAGGGCAGGG - Intergenic
1081405008 11:42688184-42688206 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1081454450 11:43207194-43207216 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1081871879 11:46386610-46386632 GCATGAACTACAGGAGGGAATGG + Intergenic
1082122255 11:48391847-48391869 GCATGAGCCAAAGAAGGGCAAGG - Intergenic
1082127876 11:48453931-48453953 GGGTGAGCCAAAGCAGGGCAGGG - Intergenic
1082135834 11:48547865-48547887 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1082150572 11:48734147-48734169 GCATGAGCCAATGCAGGGCAAGG + Intergenic
1082253235 11:50005151-50005173 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1082268952 11:50149006-50149028 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1082575411 11:54797778-54797800 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1082577999 11:54833191-54833213 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1082596117 11:55084533-55084555 GCATGAGCCAAAACAGGGAAAGG + Intergenic
1083327527 11:61880351-61880373 GGATGGGGCACAGCAGGCAATGG - Intronic
1083494830 11:63042248-63042270 GCATGACCCAAAGCAGGGCAAGG - Intergenic
1083513765 11:63236605-63236627 GCATGAGCCAAAGCAGGGTGAGG - Intronic
1083531529 11:63427934-63427956 GGGTGAGCCAAAGCAGGGCAGGG + Intergenic
1084483358 11:69434568-69434590 GAGCCAGCCAGAGCAGGGAAGGG - Intergenic
1084909467 11:72376254-72376276 GAATGAGTCAGAGCTGGGTATGG + Intronic
1085283099 11:75343584-75343606 AAGGGAGCCACAGCAGAGAAAGG + Intronic
1085827577 11:79864551-79864573 GGGTGAGCCAAAGCAGGGAGGGG + Intergenic
1085884371 11:80505399-80505421 GGATGAGCCAAAGCAGGGTGGGG + Intergenic
1086979546 11:93178360-93178382 GTGTGAGCCAAAGCAGGGCAGGG - Intronic
1087103159 11:94384519-94384541 GCATGAGCCGAAGCAGGGCAAGG + Intronic
1087243381 11:95806400-95806422 GTATGAGCCGAAGCAGGGCAGGG + Intronic
1087545983 11:99583787-99583809 GCATGAGCCAAAGCAGGGTGAGG - Intronic
1087580184 11:100040939-100040961 GCATGAGCCAAAGCAGGGCGAGG - Intronic
1087916831 11:103820768-103820790 GCATGTGCCAAAGCAGGGCAAGG - Intergenic
1088414268 11:109571545-109571567 GCGTGAGCCAAAGCAGGGCAAGG + Intergenic
1089091504 11:115881095-115881117 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1089192814 11:116666865-116666887 GCATGAGCCAAAGCAGGGCAGGG + Intergenic
1089720088 11:120409579-120409601 GCATGATCTACTGCAGGGAAAGG + Intronic
1089768259 11:120784251-120784273 GAAGGAGCCAGTACAGGGAAGGG - Intronic
1090322250 11:125857509-125857531 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1090746857 11:129712710-129712732 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1091157161 11:133384633-133384655 GAATGAGGCACAGAAGGCACTGG - Intronic
1091251588 11:134148465-134148487 GAAGGAGGCACAGCAGGGCCAGG + Intronic
1091839207 12:3607424-3607446 GAGAGAGCCACAGCTGGGTAAGG + Intronic
1092002306 12:5043181-5043203 GCAAAAACCACAGCAGGGAAGGG - Intergenic
1092078948 12:5697633-5697655 GCATGAGCCAAAGCAGGGCGAGG + Intronic
1092238180 12:6822439-6822461 AAATGGGGCACAGCAGTGAAAGG - Intronic
1092936321 12:13367352-13367374 TAATGAGCCTCAGCAGGGACGGG - Intergenic
1093320291 12:17705358-17705380 GCGTGAGCCAAAGCAGGGCAAGG - Intergenic
1093344445 12:18023977-18023999 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1093385641 12:18549884-18549906 GAATGGGCCACAAAAGGAAAAGG - Intronic
1093572321 12:20680870-20680892 GAAAGAGAGACAGAAGGGAATGG + Exonic
1093672903 12:21899489-21899511 GCATGAGCCAAAGCAGGGCGAGG + Intronic
1094779332 12:33773030-33773052 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1094803405 12:34065139-34065161 GCACGAGCCAAAGCAGGGCAAGG + Intergenic
1094858352 12:34431155-34431177 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1095060387 12:37681773-37681795 GTGTGAGCCAAAGCAGGGAGAGG + Intergenic
1095065009 12:37761864-37761886 GCATGAGCCAAAGCTGGGAGAGG + Intergenic
1095066691 12:37787075-37787097 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1095083265 12:38031597-38031619 GCATGAGCCAAAACAGGGCAAGG + Intergenic
1095089593 12:38091497-38091519 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
1095629807 12:44362282-44362304 GTAAGAGCCTCTGCAGGGAAAGG - Intronic
1095706488 12:45242543-45242565 GGGTGAGCCAAAGCAGGGCAGGG - Intronic
1095863899 12:46950367-46950389 AAGTCAGCCACTGCAGGGAAAGG + Intergenic
1095873607 12:47056883-47056905 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1096044942 12:48554164-48554186 GCATGAGCCAAAGCAGGGTGGGG - Intergenic
1096579631 12:52576320-52576342 AAATCAGCCACAGCAAGGATGGG + Intergenic
1096783004 12:54001565-54001587 GAAGGAGAAACAGCAGGGGAGGG + Intronic
1096895600 12:54818535-54818557 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1096902591 12:54900577-54900599 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1096954401 12:55510664-55510686 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1096955170 12:55518491-55518513 GCATGAGCCAAAGCAAGGCAAGG + Intergenic
1097246324 12:57609656-57609678 GACTGAGACACAGGAGAGAAAGG - Exonic
1097551435 12:61076555-61076577 GCATGAGCCGAAGCAGGGAGAGG + Intergenic
1097689115 12:62717344-62717366 GAAGGAGCCACAACTGAGAATGG - Intronic
1097774293 12:63628245-63628267 GCATGAGCCAAAGCAGGGCAAGG + Intronic
1097917515 12:65036417-65036439 GCATGAGCCAAAGCAGGGCAGGG - Intergenic
1098638551 12:72813531-72813553 GCATGAGCCAAAGCAGGGCGGGG - Intergenic
1098642673 12:72857388-72857410 GCATGAGCCAAAGCAGGGAGAGG - Intergenic
1098760491 12:74418985-74419007 GAATCAGACAAAGCAGGGAATGG - Intergenic
1099087030 12:78258106-78258128 GTGTGAGCCAAAGCAGGGCAGGG - Intergenic
1099512499 12:83555076-83555098 GCATGAGACAAAGCAGGGCAAGG - Intergenic
1099514767 12:83584430-83584452 GCACGAGCCAAAGCAGGGCAAGG + Intergenic
1099720499 12:86356499-86356521 GCATGAGACAAAGCAGGGCAGGG + Intronic
1099806855 12:87531130-87531152 GCATGAGCCAAAGCAGGGTGGGG + Intergenic
1100563789 12:95775360-95775382 GCATGAGCCAAAGCAGGGCGAGG + Intronic
1100579951 12:95929381-95929403 GCATGAGCCGAAGCAGGGCAAGG - Intronic
1101524914 12:105519826-105519848 GCGTGAGCCAAAGCAGGGCAAGG - Intergenic
1102011454 12:109621771-109621793 GACTGAGGCACAGCAGAGAAAGG - Intergenic
1102521852 12:113482500-113482522 GTGTGAGCCACAGCAGGGGTGGG - Intergenic
1103203660 12:119110788-119110810 GCATGAGCCAAAGCAGGGCGGGG - Intronic
1104022537 12:125002993-125003015 GTATGAACCACAGAGGGGAAAGG - Intronic
1104474714 12:129061867-129061889 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1105072678 12:133245105-133245127 GCATGAGCCAAAGCAGGGTCAGG + Intergenic
1105608671 13:21948557-21948579 AGGTGAGCCACAGCAGGGAAAGG - Intergenic
1106513470 13:30431976-30431998 GAAGGAGCAACAGTTGGGAATGG - Intergenic
1106762548 13:32881267-32881289 GGAAGAGCCACGGCAGGGCAGGG + Intergenic
1106816835 13:33418111-33418133 GGGTGAGCCAAAGCAGGGCAGGG + Intergenic
1106872367 13:34035758-34035780 GAATCAGTCAATGCAGGGAAGGG + Intergenic
1106953068 13:34906236-34906258 GAACGAGCCAGGGCTGGGAAAGG - Intergenic
1107238744 13:38206285-38206307 GAATGATCAACAGTGGGGAATGG - Intergenic
1108445929 13:50508995-50509017 GTGTGAGCCAAAGCAGGGCAAGG - Intronic
1109363208 13:61323724-61323746 GTGTGAGCCAAAGCAGGGCAGGG + Intergenic
1110291584 13:73813954-73813976 GAATTTGCCAAAGCAGGAAACGG + Intronic
1110459907 13:75733593-75733615 GCATGAGCCAAAGCAGGGCGAGG - Intronic
1110892604 13:80708442-80708464 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1111071240 13:83171324-83171346 GCATGAGCCAAAGCAGGGCAGGG + Intergenic
1111273587 13:85917747-85917769 GCATGAGCCAAAGCAGGGAGAGG - Intergenic
1111322753 13:86651387-86651409 GCGTGAGCCAAAGCAGGGCAAGG + Intergenic
1111398891 13:87705968-87705990 GAGTGAGCCACAGAAGAGAAAGG - Intergenic
1112210836 13:97375459-97375481 GAATGAGACAGAGAAGGGACAGG + Intronic
1112232980 13:97607816-97607838 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
1113382312 13:109814873-109814895 GAAGGGGCCACAGCAGTGAATGG - Intergenic
1114704016 14:24707376-24707398 GTATGAGACACAGCAGAGAAAGG + Intergenic
1114749115 14:25183586-25183608 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1115018162 14:28641619-28641641 GTGTGAGCCAAAGCAGGGAGAGG - Intergenic
1115043023 14:28955125-28955147 GGGTGAGCCAAAGCAGGGTAGGG + Intergenic
1115077898 14:29413907-29413929 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1115391269 14:32857125-32857147 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1115792788 14:36898496-36898518 GAGTGAGCCAAAGCAGGGCGAGG - Intronic
1115843619 14:37501770-37501792 GGGTGAGCCAAAGCAGGGCAGGG + Intronic
1116198374 14:41757719-41757741 GCGTGAGCCAAAGCAGGGCAAGG - Intronic
1116541015 14:46101362-46101384 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1116705086 14:48285668-48285690 GCATGAGCCGAAGCAGGGAGAGG - Intergenic
1117261059 14:54033664-54033686 GCATCAGCCAAAGCAGGGCAGGG - Intergenic
1117349381 14:54866568-54866590 GAATTAGACAGAGAAGGGAAGGG + Intronic
1117528887 14:56639662-56639684 GTGTGAGCCAAAGCAGGGCAAGG + Intronic
1117664399 14:58041141-58041163 GCATGAGCCAAAGCAGGGCGAGG + Intronic
1117856817 14:60042712-60042734 GCATGAGCCAAAGCAGGACAGGG - Intronic
1119356618 14:74012395-74012417 GAATGAGTCCCAGCTGGGACCGG - Intronic
1120971714 14:90213474-90213496 GAAGGAGCCCCAGCAGGGAGAGG - Intergenic
1121573677 14:94966333-94966355 GAATGACACACAGCTGGTAACGG + Intergenic
1121717034 14:96083791-96083813 GAATTAGTCACAGCAGCGACAGG + Intronic
1122477189 14:102018529-102018551 GAATGAGCCTCAGCATGGCGCGG - Exonic
1202846709 14_GL000009v2_random:183800-183822 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
1202916170 14_GL000194v1_random:174401-174423 GCATGAGCCATAGCAGGGCAAGG - Intergenic
1202876605 14_KI270722v1_random:8646-8668 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
1123576716 15:21676790-21676812 GGATGAGCCAAAGCAGGGTGGGG - Intergenic
1123613338 15:22119258-22119280 GGATGAGCCAAAGCAGGGTGGGG - Intergenic
1124356946 15:29002769-29002791 GAATCAGCCACTGCAGGAAAGGG + Intronic
1125058628 15:35391804-35391826 GCATGAGCCAAAGCAGGGCGAGG - Intronic
1125589010 15:40843448-40843470 CAATGAGCCATAGCAGGGAATGG + Intergenic
1125909311 15:43421810-43421832 GAGAGAGCCACAGCAGGGGCAGG - Intronic
1126099172 15:45109575-45109597 GAATGAGCTGCTGCTGGGAATGG - Exonic
1126197031 15:45943968-45943990 AAATGAGTAACAGCAGGGCATGG + Intergenic
1126665856 15:51076076-51076098 GAATGCGGAACAGCAGGAAAGGG + Intronic
1127057104 15:55143345-55143367 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1127189647 15:56515877-56515899 GTGTGAGCCAAAGCAGGGCAAGG - Intergenic
1127373642 15:58362745-58362767 GAGTGAGCCAAAGCAGGGTGGGG + Intronic
1127440834 15:59005922-59005944 TAATGAGTCACAGCAGTGATGGG + Intronic
1127527019 15:59803518-59803540 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1127704987 15:61537576-61537598 AAAAGAGGCACAGGAGGGAAGGG + Intergenic
1128416814 15:67454192-67454214 GCATGAGCCAAAGCAGGGCAAGG - Intronic
1128594809 15:68934280-68934302 TAATGAACCACAGAAGGTAAGGG + Intronic
1129581689 15:76818766-76818788 GCGTGAGCCAAAGCAGGGCAAGG + Intronic
1129821822 15:78607747-78607769 GCATGAGCCAAAGCAGGGCGAGG + Intronic
1130432307 15:83860845-83860867 GCCTGAGCCAAAGCAGGGCAAGG + Intronic
1130572284 15:85057501-85057523 GCATGAGCCAGAGCAGGGAGGGG - Intronic
1130778124 15:87006654-87006676 GCATGAGCCAAAGCAGGGTGAGG - Intronic
1130798451 15:87235711-87235733 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1130802668 15:87281284-87281306 GCCTGAGCCAAAGCAGGGCAAGG - Intergenic
1131589316 15:93731179-93731201 GGGTGAGCCAAAGCAGGGCAGGG - Intergenic
1132160292 15:99535230-99535252 AAATCAGCCTGAGCAGGGAAGGG - Intergenic
1202985584 15_KI270727v1_random:411035-411057 GGATGAGCCAAAGCAGGGTGGGG - Intergenic
1134232385 16:12438911-12438933 GAGGGAAACACAGCAGGGAAGGG + Intronic
1134504365 16:14792975-14792997 GAATGAGAAGCAGTAGGGAATGG - Intronic
1134565604 16:15249292-15249314 AAATGAGACAGAGAAGGGAAAGG + Intergenic
1134576208 16:15335934-15335956 GAATGAGAAGCAGTAGGGAATGG + Intergenic
1134624618 16:15714782-15714804 GAATAAACCACAGAAGGGAGTGG + Intronic
1134726235 16:16420568-16420590 GAATGAGAAGCAGTAGGGAATGG - Intergenic
1134736891 16:16507406-16507428 AAATGAGACAGAGAAGGGAAAGG - Intergenic
1134798725 16:17065204-17065226 GGAAGAGACACAGAAGGGAATGG + Intergenic
1134884318 16:17776206-17776228 GACTGAGCCACTTCAGGGCAGGG + Intergenic
1134930624 16:18204767-18204789 AAATGAGACAGAGAAGGGAAAGG + Intergenic
1134941197 16:18291292-18291314 GAATGAGAAGCAGTAGGGAATGG + Intergenic
1135301806 16:21335012-21335034 GTGTGAGCCAAAGCAGGGCAGGG - Intergenic
1136727640 16:32373659-32373681 GGGTGAGCCAAAGCAGGGCAGGG - Intergenic
1136917406 16:34218688-34218710 GCACGAGCCAAAGCAGGGTAAGG - Intergenic
1137062018 16:35799432-35799454 GAGAGAGCCACATCAGGGATAGG - Intergenic
1137624101 16:49896651-49896673 GACGGAGCCACAGAAGGGCAAGG - Intergenic
1137890994 16:52161745-52161767 GTGTGAGCCAAAGCAGGGCAGGG - Intergenic
1137907024 16:52333571-52333593 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
1138357100 16:56391376-56391398 GCATGAGCCGAAGCAGGGCAAGG + Intronic
1138722295 16:59096584-59096606 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1138785124 16:59836663-59836685 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
1139375916 16:66496147-66496169 GCATGAGCCAAAGCAGGGTGAGG + Intronic
1140179140 16:72696340-72696362 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1140486493 16:75297669-75297691 AAATGGGCCACAGAAGGCAATGG - Intronic
1140917320 16:79505972-79505994 GAAGGAGCAAAAGAAGGGAAGGG + Intergenic
1141700107 16:85638585-85638607 GAATGTGCCACAGCCGGGAATGG + Intronic
1141747205 16:85933712-85933734 GTAAGAGCCACAGTGGGGAATGG + Intergenic
1142255238 16:89010731-89010753 GACAGAGCCACTGCAGTGAAGGG + Intergenic
1202998792 16_KI270728v1_random:144091-144113 GGGTGAGCCAAAGCAGGGCAGGG + Intergenic
1203130391 16_KI270728v1_random:1680499-1680521 GGGTGAGCCAAAGCAGGGCAGGG + Intergenic
1203147308 16_KI270728v1_random:1810096-1810118 GAATGGGCCAAAGCAGGGCCAGG + Intergenic
1143238231 17:5421309-5421331 GAATGAGAAACAGCCGGGACAGG + Exonic
1144502233 17:15798683-15798705 GGCTGAGCCACAGCACGAAAAGG + Intergenic
1145025601 17:19465849-19465871 TAATGAGACTCAGAAGGGAAGGG - Intergenic
1145164413 17:20601343-20601365 GGCTGAGCCACAGCACGAAAAGG + Intergenic
1146045538 17:29503057-29503079 GATTTAGGCACAGCAGGGAGAGG + Intronic
1146157435 17:30535786-30535808 ACATGAGCCCCAGCAGGGACCGG - Intergenic
1146561871 17:33877297-33877319 GCATGAGCCAAAGCAGGGCAAGG + Intronic
1146686913 17:34847256-34847278 GGCTGAGCCCCAGCAAGGAAGGG + Intergenic
1146739893 17:35274535-35274557 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1147385387 17:40078196-40078218 GCATGAGCCACAGCACCCAATGG - Intronic
1147472809 17:40679376-40679398 GTATGAGGCACAGGAGGGAGGGG - Intergenic
1147527494 17:41240095-41240117 GCATGAGCCAAAGCAGGGCGAGG + Intronic
1147675186 17:42200381-42200403 GAATGGGCTACAGCAGGTAGTGG - Exonic
1149225567 17:54465899-54465921 GAGTGAGCCAAAGCAGGGTGGGG - Intergenic
1149317934 17:55456342-55456364 AACTGAGGCACAGCAGGGAAAGG - Intergenic
1149624504 17:58070653-58070675 TCATGAGCCAAGGCAGGGAATGG - Intergenic
1149767014 17:59287651-59287673 GAATCAGCCACAGAGGAGAAGGG - Intergenic
1149888663 17:60366435-60366457 GCATGAGCCACAGTAGAGACGGG + Intronic
1151658730 17:75507830-75507852 GGCTGAGCCACAGCATGAAAGGG + Intronic
1151944513 17:77312162-77312184 GAAGGAGCCACAGCAGGGCAGGG - Intronic
1153571411 18:6476949-6476971 AAATGAGAAAGAGCAGGGAAAGG + Intergenic
1153925434 18:9831568-9831590 TAATGAGCCTCAGCAGGGACGGG + Intronic
1154176297 18:12088622-12088644 GAAAGAGCCAAAGCAGGGCCAGG - Intergenic
1154377204 18:13820224-13820246 GAATGGGCCAAAGCAGGAGATGG - Intergenic
1156434422 18:37111700-37111722 GTATGAGCCAAAGCAGGGTGGGG + Intronic
1157205468 18:45694633-45694655 GCATGAGCCAAAGCGGGGCAAGG + Intergenic
1157330649 18:46701419-46701441 GCATGAGCTACCGCAGGGATAGG + Intronic
1157599097 18:48882582-48882604 GTGAGAGCCACAGCGGGGAATGG - Intergenic
1157920176 18:51706543-51706565 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1158713782 18:59860323-59860345 AACTGAGCCATAGCAGAGAATGG + Intergenic
1159126689 18:64232289-64232311 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
1159810842 18:73016599-73016621 GCATGAGCCGAAGCAGGGCAGGG + Intergenic
1160027975 18:75234311-75234333 GAAAGAAAGACAGCAGGGAAAGG - Intronic
1160342771 18:78103841-78103863 GAAGGAGACACAGCAAGGCATGG + Intergenic
1160794766 19:940130-940152 TAGCGAGCCACAGCAGGGCAGGG + Intronic
1160828913 19:1093745-1093767 GCATCACCCACAGCAAGGAAGGG + Intronic
1161081969 19:2315773-2315795 GCAAGAGAAACAGCAGGGAAGGG + Intronic
1161605126 19:5210651-5210673 CTAGGGGCCACAGCAGGGAAGGG - Intronic
1162080659 19:8215798-8215820 TGATGAGCCACAGCAGGGACAGG + Intronic
1163940675 19:20490484-20490506 GTGTGAGCCAAAGCAGGGTAAGG + Intergenic
1164265555 19:23613576-23613598 GCATGAGCCAAAGCAGGGCAAGG + Intronic
1164347724 19:27286376-27286398 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
1164367636 19:27602918-27602940 GAGTGAACCAAAGCAGGGCAAGG - Intergenic
1164420492 19:28087814-28087836 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1164568324 19:29348514-29348536 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1165010968 19:32846196-32846218 GCATGAGCCGAAGCAGGGCAAGG + Intronic
1165270858 19:34706324-34706346 GCGTGAGCCAAAGCAGGGCAAGG - Intergenic
1165334102 19:35156993-35157015 AAATGACACAGAGCAGGGAAAGG - Intronic
1165980680 19:39719906-39719928 GTATGAGCCGAAGCAGGGCAAGG - Intergenic
1166079799 19:40436669-40436691 ATATGAGGAACAGCAGGGAATGG + Intergenic
1166171809 19:41033225-41033247 GCGTGAGCCAAAGCAGGGCAAGG + Intergenic
1166379901 19:42350420-42350442 GAGGGAGCCACAGCAGGCAATGG + Intronic
1166446646 19:42863500-42863522 GCATGAGCCAAAGCAGGGCAAGG - Intronic
1167568529 19:50272262-50272284 GAATCAGAAACAGAAGGGAAGGG + Intronic
1167965244 19:53139381-53139403 GAAAGAACCACAGTATGGAAAGG - Exonic
1168297986 19:55387033-55387055 GATTGAGGCACAACAGGGGAGGG + Intronic
1202674059 1_KI270710v1_random:24173-24195 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
1202709249 1_KI270714v1_random:8050-8072 GGATGAGCCAAAGCAGGGTGGGG + Intergenic
925814668 2:7735962-7735984 GGATGAGCCACAGCCTGGGAGGG - Intergenic
926054024 2:9763270-9763292 GAATGAAACACCCCAGGGAAGGG + Intergenic
926102294 2:10126001-10126023 GAATGAACGACAGCTGGGCATGG + Intronic
926338910 2:11887417-11887439 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
927058473 2:19389927-19389949 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
927117070 2:19916095-19916117 GGATGAGCCAAAGCAGGGTGGGG + Intronic
927236063 2:20875806-20875828 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
927239814 2:20911426-20911448 GCATGAGCCAAAGCAGGGTGCGG - Intergenic
927705896 2:25296421-25296443 GCATCAGGCATAGCAGGGAAAGG + Intronic
928106279 2:28472441-28472463 GAATGATGCTCAGCAGGGGAGGG + Intronic
928487613 2:31748689-31748711 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
928852473 2:35766614-35766636 GCCTGAGCCAAAGCAGGGCAAGG + Intergenic
929082855 2:38138420-38138442 GCACGAGCCAAAGCAGGGCAAGG - Intergenic
929958379 2:46477939-46477961 GCATGAGCCAAAGAAGGGAGGGG - Intronic
929960137 2:46490255-46490277 GTATCAGCCAGAGCAGGGAAGGG + Intergenic
930051320 2:47218301-47218323 GAAGTACCCACAGCCGGGAAAGG + Intergenic
930476737 2:51891666-51891688 GGGTGAGCCAAAGCAGGGAGGGG - Intergenic
930690576 2:54359053-54359075 GAATGAGCCTCTCCAGGGAAAGG + Exonic
931477584 2:62605401-62605423 GCGTGAGCCAAAGCAGGGCAAGG + Intergenic
931491730 2:62754950-62754972 GCATGAGCCGAAGCAGGGCAAGG - Intronic
931526975 2:63167259-63167281 TAATGAGGCAGAGCAGGGATTGG - Intronic
931691095 2:64835495-64835517 GCATGAGCCACCGCAGGGTGGGG + Intergenic
931822783 2:65969030-65969052 GAGTGAGCCAAAGCAGGGCGAGG - Intergenic
932176518 2:69607825-69607847 ATATGTGCTACAGCAGGGAAGGG + Intronic
932660566 2:73648165-73648187 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
932986230 2:76728847-76728869 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
933593838 2:84262534-84262556 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
933737391 2:85505995-85506017 GAATCAGGCCCAGAAGGGAATGG - Intergenic
934516503 2:94991382-94991404 GAATGTGCCACAGCAGGGTATGG + Intergenic
934554699 2:95281199-95281221 GACTGAGGGACAGCAGGGACTGG - Intronic
934999619 2:99000679-99000701 GTGTGAGCCAAAGCAGGGCAGGG + Intronic
936125927 2:109789195-109789217 GACTGAGGAACAGCAGGGAGAGG + Intergenic
936218766 2:110582273-110582295 GACTGAGGAACAGCAGGGAGAGG - Intergenic
936769608 2:115895375-115895397 GGATGAGCCAAAGCAGGGTGGGG - Intergenic
936964482 2:118114152-118114174 TAAAGAGCCATTGCAGGGAAGGG + Intergenic
938156888 2:128949255-128949277 GTGTGAGCCAAAGCAGGGCAAGG - Intergenic
938167537 2:129044071-129044093 GGATGAGCCAAAGCAGGGCGAGG - Intergenic
938243560 2:129760962-129760984 GATGGGGCCACAGCAGGGCAGGG + Intergenic
938498819 2:131819135-131819157 GTGTGAGCCAAAGCAGGGCAAGG - Intergenic
938619217 2:133031770-133031792 GGCTGAGCCACAGCAGGATACGG + Intronic
938651578 2:133388998-133389020 GAGTGAGCCAAAGCAGGGCGAGG - Intronic
938718422 2:134042919-134042941 GCATAAGCCAAAGCAGGGCAAGG + Intergenic
938854679 2:135297539-135297561 GCATGAGCCAAAGCAGGGCGAGG - Intronic
939071948 2:137554727-137554749 GCGTGAGCCAAAGCAGGGCAAGG + Intronic
939074933 2:137588296-137588318 CCATGAGCCAAAGCAGGGTAAGG - Intronic
939399400 2:141671375-141671397 GAAGGAGGCAAAGTAGGGAAGGG + Intronic
939807185 2:146788565-146788587 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
940067276 2:149643818-149643840 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
940080613 2:149796568-149796590 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
940417503 2:153439781-153439803 GTGTGAGCCGAAGCAGGGAAAGG - Intergenic
940602047 2:155875131-155875153 GCATGAGCCGAAGCAGGGAGAGG + Intergenic
940829880 2:158456299-158456321 GAAAGATCCACCCCAGGGAAGGG + Intronic
940995276 2:160142797-160142819 GAATGAGGCACGGCAAAGAAGGG + Intronic
941534762 2:166708572-166708594 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
941895864 2:170628509-170628531 GCGTGAGCCAAAGCAGGGCAAGG - Intronic
941971495 2:171355930-171355952 GCATGAGCCAAAGCAGGGCAAGG - Intronic
942639828 2:178049529-178049551 GCATGAGCCGAAGCAGGGCAAGG + Intronic
942779885 2:179629690-179629712 GGATGAGCCAAAGCAGGGTGGGG + Intronic
942911489 2:181249803-181249825 GGATCATCCACAGCAGGGAATGG - Intergenic
943031059 2:182686708-182686730 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
943112425 2:183622246-183622268 GGATGAGCCAAAGCAGGGTGGGG - Intergenic
943605958 2:189976939-189976961 GTGTGAGCCAAAGCAGGGCAAGG - Intronic
943710754 2:191092719-191092741 GGGTGAGCCAAAGCAGGGCAGGG + Intronic
944165122 2:196710472-196710494 GGGTGAGCCAAAGCAGGGCAGGG - Intronic
944613048 2:201430791-201430813 GGGTGAGCCAAAGCAGGGCAGGG - Intronic
944749185 2:202690598-202690620 GAATTAGCCACACCAAAGAAAGG + Intronic
945093675 2:206199473-206199495 GAAAGAGGCAAAGGAGGGAAGGG + Intronic
945161914 2:206900201-206900223 GGGTGAGCCAAAGCAGGGCAGGG - Intergenic
945669397 2:212785293-212785315 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
945675548 2:212851473-212851495 GAATGAGGCAGAGAAGGCAAAGG + Intergenic
946056170 2:216903829-216903851 GAATGAGCAGTAGCGGGGAAAGG - Intergenic
946463009 2:219886688-219886710 GAAAGGGCCACATCAGTGAAAGG + Intergenic
946545865 2:220742414-220742436 GCACGAGCCAAAGCAGGGCAAGG - Intergenic
946719016 2:222584519-222584541 GTGTGAGCCAAAGCAGGGCAGGG + Intronic
946906422 2:224421066-224421088 GCAGGAGTCACAGCAGGGAATGG + Intergenic
946924460 2:224612752-224612774 AAATGAGACACAGCTGGGAATGG + Intergenic
947056202 2:226107418-226107440 GACTGAGCCAAAGCAGGGCAAGG + Intergenic
947196563 2:227573817-227573839 AAATGAGTCCCAGCAGGGAGGGG + Intergenic
947259587 2:228205121-228205143 GCACGAGCCAAAGCAGGGCAAGG - Intergenic
947321785 2:228927174-228927196 GATGGAGCCACAGAATGGAAGGG - Intronic
948453791 2:238094721-238094743 AAATGAGCCACGTCAGGGAGAGG - Intronic
948592941 2:239063021-239063043 GGAGGAGCGACAGCAGGCAATGG - Intronic
948988837 2:241541689-241541711 GAATGTGCCGCGGAAGGGAAGGG + Intergenic
1169745218 20:8936146-8936168 TCATGAGCCTCAGCAGGGACGGG - Intronic
1170095997 20:12646705-12646727 CAATGGGCCACAGCGAGGAAGGG - Intergenic
1170266007 20:14467498-14467520 GCGTGAGCCAAAGCAGGGAGAGG - Intronic
1170494656 20:16913391-16913413 GCATGAGACAAAGCAGGGCAAGG - Intergenic
1171168384 20:22993535-22993557 GAGTGAGCCAAAGCAGGGCAAGG - Intergenic
1171234098 20:23510299-23510321 GAATGAGCTTCAGCAGGCACAGG - Intergenic
1171748288 20:29022104-29022126 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1172065322 20:32215671-32215693 GAGTGAGACAGAGCAGGGACTGG - Intronic
1172409461 20:34710657-34710679 GAATGAGCCAGATCAGGGACTGG - Exonic
1172951790 20:38727125-38727147 GGAGAAGCCACAGGAGGGAAGGG - Intronic
1173044827 20:39500031-39500053 ACAGGAACCACAGCAGGGAATGG + Intergenic
1173249753 20:41358206-41358228 GCCAGAACCACAGCAGGGAAGGG - Intronic
1173318726 20:41968474-41968496 GGATGAGCCAAAGCAGGGTGGGG - Intergenic
1173543902 20:43877108-43877130 GTGTGAGCCAAAGCAGGGCAGGG - Intergenic
1173770397 20:45651615-45651637 GCATGAGCCAAAGCAGGGCAAGG + Intronic
1173977101 20:47195325-47195347 GTATGAGCCTCCGCAGGGAGGGG + Intergenic
1174521560 20:51134944-51134966 GTCTGAGCCACAAAAGGGAAGGG + Intergenic
1174523917 20:51156315-51156337 GAATTAGACTCAGCAGGGAACGG + Intergenic
1174694455 20:52543106-52543128 GTGTGAGCCAAAGCAGGGCAAGG + Intergenic
1175816001 20:61883554-61883576 GCATCAGCCACAGGAGGGCAAGG + Intronic
1176097759 20:63352147-63352169 GAATGAGGCAGAGGAGGGATGGG - Intronic
1176317220 21:5257514-5257536 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1176635521 21:9189047-9189069 GCATGAGCCATAGCAGGGCAAGG - Intergenic
1176637870 21:9266088-9266110 GCATGAGCCAAAGCAGGGAAAGG + Intergenic
1176859132 21:13995424-13995446 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1177132096 21:17271470-17271492 GTGTGAGCCAAAGCAGGGCAAGG + Intergenic
1177155885 21:17501016-17501038 GAAACAGCCACAGCAGGGACGGG + Intergenic
1178872648 21:36389117-36389139 GCATCAGTCACAGCAGGGAATGG - Intronic
1180249088 21:46567653-46567675 GAATGAGCCCCAGCAGTCCAAGG + Exonic
1180371091 22:12037321-12037343 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
1180395014 22:12323446-12323468 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1180404726 22:12541302-12541324 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1180421910 22:12873585-12873607 GCATGAGCCAAAGCAGGGAAAGG + Intergenic
1180565503 22:16660539-16660561 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1180847831 22:18994093-18994115 GAGAGAGACACAGAAGGGAAGGG + Intergenic
1182298566 22:29325541-29325563 GAATGCCCCGCAGCAGGGACTGG + Intergenic
1182332594 22:29561544-29561566 GAATGAGCCACAGCCCAGAATGG - Exonic
1183085303 22:35483420-35483442 AAATAAGCAACAGCATGGAAGGG - Intergenic
1184017023 22:41793993-41794015 GTATGAGTCACACAAGGGAATGG - Intronic
949592451 3:5508703-5508725 GTGTGACACACAGCAGGGAAGGG - Intergenic
950164575 3:10784425-10784447 GGAGAAACCACAGCAGGGAAAGG + Intergenic
950315045 3:11994748-11994770 GAATCTGACACAGCAGGGCATGG + Intergenic
950649132 3:14396388-14396410 GAAGGAGCCAGACCTGGGAAGGG + Intergenic
951042744 3:18005633-18005655 GCACGAGCCAAAGCAGGGCAAGG - Intronic
951157835 3:19376440-19376462 GCATGAGCCGAAGCAGGGAGAGG - Intronic
951687677 3:25362765-25362787 GGATGAGCCAAAGCAGGGTGGGG - Intronic
951751648 3:26042583-26042605 GCGTGAGCCAAAGCAGGGCAAGG - Intergenic
951862032 3:27263779-27263801 GCATGAGCCAAAGCAGGGCGAGG - Intronic
951964787 3:28370119-28370141 GCATGAGCCAAAGCAGGGAGAGG - Intronic
952501882 3:33970609-33970631 GCATGAGCCGAAGCAGGGCAGGG - Intergenic
952863955 3:37838958-37838980 GGGTGAGCCAAAGCAGGGCAGGG + Intergenic
953150496 3:40320023-40320045 AAATGAGACAGAGAAGGGAAGGG - Intergenic
953722532 3:45368908-45368930 AGATGAGCCACAGCAGGATAGGG + Intergenic
955268901 3:57477103-57477125 GCATGAGCCAAAGCAGGGTGAGG + Intronic
955448950 3:59046934-59046956 AAATGATACACAGCAGGGCATGG + Intronic
955626347 3:60923737-60923759 GCATGAGCCAAAGCAGGGCAAGG + Intronic
955895328 3:63694073-63694095 GAGTGAGCCAAAGCAGGGTAGGG + Intergenic
956038374 3:65120053-65120075 GCATGAGCCGAAGCAGGGAGAGG + Intergenic
956993260 3:74794285-74794307 GGGTGAGCCAAAGCAGGGCAGGG + Intergenic
957497621 3:81011064-81011086 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
957867053 3:86039246-86039268 GCATGAGCCAAAGCAGGGTGAGG + Intronic
958697734 3:97548029-97548051 GCATGAGCCAAAGCAGGGCGAGG - Intronic
958829958 3:99074485-99074507 GAGTGAGCCAAAGCAGGGCAAGG - Intergenic
958835590 3:99141013-99141035 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
959398176 3:105868351-105868373 GAAGGGGCCTGAGCAGGGAAGGG - Intronic
960448523 3:117778145-117778167 GCATGAGCCAAAGCACGGCAAGG + Intergenic
960563661 3:119112561-119112583 GCACGAGCCAAAGCAGGGCAAGG - Intronic
960565775 3:119130230-119130252 GGGTGAGCCAAAGCAGGGCAGGG + Intronic
960594135 3:119392585-119392607 GGCAGAGCCACAGCAGGGCAAGG + Intronic
961353157 3:126316637-126316659 GCATGGGCCAGAGTAGGGAAGGG + Intergenic
961588213 3:127952927-127952949 AAATAAGCCACAGAAAGGAAAGG + Intronic
961656334 3:128444245-128444267 GCCTGGGCCGCAGCAGGGAAGGG + Intergenic
961955998 3:130804793-130804815 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
962442972 3:135439674-135439696 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
962690817 3:137896773-137896795 GCATGAGTCAAAGCAGGGCAAGG + Intergenic
963050777 3:141141293-141141315 GCATGAGCCAAAGCAGGGCGAGG - Intronic
963160019 3:142141339-142141361 GGGTGAGCCGAAGCAGGGAAGGG - Intronic
963191787 3:142481049-142481071 GCATGAGCCGAAGCAGGGCAAGG - Intronic
963678695 3:148347433-148347455 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
963714449 3:148786602-148786624 GTGTGAGCCAAAGCAGGGCAGGG - Intergenic
964536184 3:157724857-157724879 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
964551686 3:157891609-157891631 GGATGACCTACAGCAAGGAAGGG - Intergenic
965311036 3:167129517-167129539 GTGTGAGCCAAAGCAGGGCAAGG + Intergenic
965736531 3:171826718-171826740 GTTTCAGGCACAGCAGGGAAAGG + Intergenic
966459007 3:180154141-180154163 GCATGAGCCACAGCACCGGACGG - Intergenic
966613309 3:181889448-181889470 GACTGAGGCCCAGCAGGGCATGG - Intergenic
966656845 3:182368197-182368219 GAATGAGCAACTACAAGGAAAGG + Intergenic
967797230 3:193610998-193611020 GCATGAGCCAAAGCAGGGCGAGG - Intronic
967843894 3:194029459-194029481 GCCTGAGCAAGAGCAGGGAATGG + Intergenic
968092684 3:195908748-195908770 GAAGGAGCCCCAGGAGGGAGAGG - Intronic
1202749025 3_GL000221v1_random:138933-138955 GCATGAGCCAAAGCAGGGAAAGG - Intergenic
968701903 4:2061399-2061421 GACGCATCCACAGCAGGGAACGG - Intronic
968739779 4:2321670-2321692 GAGTGAAACAGAGCAGGGAAGGG + Intronic
968750406 4:2386069-2386091 GAGTGAACACCAGCAGGGAAGGG - Intronic
969126286 4:4950791-4950813 GAATGAGCCTCAGCAGGCCCTGG - Intergenic
969159891 4:5247535-5247557 GAGTGAGCCAAAGCAGGGCGAGG - Intronic
969199771 4:5593744-5593766 GCGTGAGCCAAAGCAGGGAGAGG + Intronic
969689552 4:8696642-8696664 GAAAGCCCCACAGCTGGGAAGGG - Intergenic
969692000 4:8708907-8708929 GGATGGGACAGAGCAGGGAAGGG + Intergenic
970643206 4:18090399-18090421 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
970796560 4:19920299-19920321 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
971866073 4:32174165-32174187 TAGTGAGCCACTGCACGGAATGG + Intergenic
972821098 4:42702250-42702272 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
972917390 4:43897464-43897486 GAATGAGCAGAAGCAGGGTAAGG - Intergenic
973598943 4:52522023-52522045 GGATGAGCCAAAGAAGGGCAGGG + Intergenic
973693478 4:53466516-53466538 GCACGAGCCAAAGCAGGGCAAGG + Intronic
974023637 4:56712803-56712825 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
974112164 4:57537806-57537828 GCATGAGCTGAAGCAGGGAAAGG - Intergenic
974237963 4:59206616-59206638 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
974347028 4:60696003-60696025 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
974530216 4:63098268-63098290 GCACGAGCCAAAGCAGGGCAAGG - Intergenic
974542154 4:63250820-63250842 GCCTGAGCCAAAGCAGGGCAAGG - Intergenic
974959844 4:68683492-68683514 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
974962420 4:68720657-68720679 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
975345970 4:73293065-73293087 GCATGAGCCAAAGCAGGGCAGGG - Intergenic
975348344 4:73319574-73319596 GTATGAGCCGAAGCAGGGAAAGG + Intergenic
975367903 4:73550016-73550038 AAAGGAGCCACTGCAGGTAAAGG - Intergenic
975500596 4:75080225-75080247 GAGTGAGCCAAAGCAGGGCGGGG - Intergenic
975513654 4:75220988-75221010 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
975582098 4:75916118-75916140 TGATGAGCCACAGCAGAGGATGG + Intronic
975683290 4:76897077-76897099 GAGTGAGCCACTGCAGGCACAGG + Exonic
975727202 4:77303558-77303580 GGATGAGCCAAAGCAGGGTGGGG - Intronic
976219925 4:82748194-82748216 GACAGAGTCAAAGCAGGGAAAGG + Intronic
976449172 4:85166803-85166825 GGGTGAGCCAAAGCAGGGCAGGG - Intergenic
976998177 4:91462537-91462559 GTGTGAGCCAAAGCAGGGCACGG + Intronic
977653142 4:99492293-99492315 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
977681023 4:99798578-99798600 GCATGAGCCGAAGCAGGGAGAGG - Intergenic
978187954 4:105880325-105880347 GCGTGAGCCAAAGCAGGGCAGGG + Intronic
978245245 4:106564052-106564074 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
978412573 4:108441403-108441425 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
978591303 4:110327769-110327791 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
978701678 4:111654124-111654146 GAAAGAGCGACCACAGGGAAAGG + Intergenic
979934015 4:126669892-126669914 GGGTGAGCCAAAGCAGGGCAGGG + Intergenic
980413688 4:132457962-132457984 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
980586905 4:134829829-134829851 GAGTGAGCCAAAGCAGGGCGAGG + Intergenic
980607590 4:135112222-135112244 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
981032221 4:140136750-140136772 GTATGAGCCACCAAAGGGAAAGG + Intronic
981162065 4:141509874-141509896 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
981188450 4:141833786-141833808 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
981273087 4:142867564-142867586 GAGTGAGCCAAAGCAGGGCGAGG + Intergenic
981668186 4:147255188-147255210 GCATGAGCCAAAGCAGGGCAGGG + Intergenic
981737823 4:147971314-147971336 GAATGACTCACAGCAGGCACTGG - Intronic
982728969 4:158935200-158935222 GCATAAGCCAAAGCATGGAAGGG - Intronic
982820214 4:159935032-159935054 GCATGAGCCAAAGCAGAGCAAGG - Intergenic
983677772 4:170316557-170316579 GAGTGAGCCAAAGCAGGGTGGGG + Intergenic
983949125 4:173619206-173619228 GGGTGAGCCAAAGCAGGGCAGGG - Intergenic
984015264 4:174417855-174417877 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
984087111 4:175326748-175326770 TACTGAGCCACAGCAAAGAAAGG - Intergenic
985379022 4:189372915-189372937 AAATGAGGCAAACCAGGGAAGGG + Intergenic
985438866 4:189963914-189963936 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1202752769 4_GL000008v2_random:24505-24527 GCATGAGCCAAAGCAGGGAAAGG + Intergenic
985470352 5:38366-38388 GAATGAAGCACAGAAGGGATTGG + Intergenic
985893366 5:2733517-2733539 GAGTGAGCAGCAGCAGGGAATGG + Intergenic
986270214 5:6223686-6223708 GAACCAGACACAGCAGGCAAAGG + Intergenic
986379601 5:7170712-7170734 GCACGAGCCAAAGCAGGGCAAGG + Intergenic
986599301 5:9455614-9455636 GAATGGGCCAGAACAGAGAAGGG + Intronic
986650971 5:9963082-9963104 GCATGAGCCACTGCAGGAAGTGG + Intergenic
987183928 5:15396286-15396308 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
988202598 5:28086620-28086642 GAATGAGCTACAGCAGGGCGGGG + Intergenic
988693342 5:33594658-33594680 GAAGGAGCTACAGCACGGAGAGG + Intronic
988871540 5:35396250-35396272 GCACGAGCCGAAGCAGGGAAAGG + Intergenic
989226409 5:39034494-39034516 GCATGAGCCAAAGCAGGGCGAGG + Intronic
989253473 5:39342121-39342143 GAATGAGCCCCTGGAGTGAATGG - Exonic
989508908 5:42260205-42260227 GCATGAGCCAAAGCGGGGCAAGG - Intergenic
989670248 5:43908847-43908869 GGGTGAGCCAAAGCAGGGAGGGG + Intergenic
989674015 5:43953051-43953073 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
989968241 5:50489953-50489975 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
989968640 5:50495036-50495058 GTGTGAGCCAAAGCAGGGCAAGG + Intergenic
990340011 5:54813121-54813143 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
990369859 5:55106572-55106594 GAATTAGCCTCAGCATGGAAGGG + Intronic
990415451 5:55581664-55581686 GAATGTCCAACAACAGGGAATGG + Intergenic
990707145 5:58542106-58542128 GCGTGAGCCAAAGCAGGGCAAGG - Exonic
990710269 5:58572957-58572979 GAGTAAGCCAAAGCAGGGCAAGG + Intergenic
990721397 5:58699934-58699956 GGGTGAGCCAAAGCAGGGCATGG - Intronic
990913894 5:60881822-60881844 GCATGAGCCAAAGCAGGGTGAGG - Intronic
991023765 5:62008159-62008181 GAAGGAGCAACAGCAGGGGATGG + Intergenic
991209421 5:64087351-64087373 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
991496360 5:67230143-67230165 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
991543624 5:67757717-67757739 GCGTGAGCCAAAGCAGGGCAAGG + Intergenic
992010201 5:72518330-72518352 GAAAGAAACACAGCAGGGCAAGG + Intergenic
992354513 5:75967350-75967372 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
992675463 5:79101725-79101747 GCATGAGCCAAAGCAGGGCGAGG - Intronic
993244237 5:85431633-85431655 GGGTGAGCCAGAGCAGGGAGAGG + Intergenic
993357101 5:86927879-86927901 GAATGAGCCAGAGGTGGGGAGGG + Intergenic
993358308 5:86941788-86941810 GGGTGAGCCAAAGCAGGGCAGGG - Intergenic
993446271 5:88015434-88015456 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
994039636 5:95244352-95244374 GGATGAGCCAAAGCAGGGCGGGG + Intronic
994565572 5:101442218-101442240 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
994572174 5:101529067-101529089 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
994893798 5:105674429-105674451 AAATGAGACAGAGCAGTGAAGGG - Intergenic
995467598 5:112466696-112466718 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
995633861 5:114162964-114162986 GCATGAGCCGAAGCAGGGAGAGG - Intergenic
995665460 5:114536612-114536634 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
996140806 5:119906438-119906460 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
996625705 5:125568135-125568157 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
997084609 5:130783641-130783663 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
997613910 5:135233282-135233304 GAGTGAGCCACAGGAGGGTAAGG + Intronic
997697108 5:135870371-135870393 GAAGGATCCATAGCAGAGAAGGG + Intronic
998055784 5:139075897-139075919 GAAAGAGGCACAGTAGGGCATGG + Intronic
998645404 5:144055877-144055899 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
998803135 5:145891312-145891334 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
999064810 5:148674158-148674180 GCATGAGCCAAAGCAGGGCGAGG - Intronic
999605187 5:153306388-153306410 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
999773418 5:154792512-154792534 GCAGGAGCCACAGCATGCAATGG - Intronic
1001154375 5:169260351-169260373 GAATGGGCCACATCACAGAAAGG + Intronic
1001310238 5:170605031-170605053 GAGTGTGGCACAGCAGTGAAAGG + Intronic
1003225816 6:4204473-4204495 GTATGAGCCGAAGCAGGGCAAGG - Intergenic
1004056019 6:12139509-12139531 GGGTGAGCCAAAGCAGGGCAAGG + Intronic
1005193938 6:23260243-23260265 GCAAGAGCCAAAGCAGGGCAAGG - Intergenic
1006817985 6:36866320-36866342 GACTGAGGGACAGCTGGGAATGG + Intronic
1006843614 6:37047973-37047995 ACCTGAGCCACAGCAGGGAGGGG - Intergenic
1007934467 6:45720906-45720928 GAATGGGCCACAGGAGGCAAAGG - Intergenic
1008388521 6:50921795-50921817 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1008537518 6:52518142-52518164 CAGTGAGCCACAGCAGGCGAGGG + Intronic
1009188300 6:60599999-60600021 GCCTGAGCCAAAGCAGGGCAAGG + Intergenic
1009361421 6:62818751-62818773 GCATGAGCCAAAGCAGGGCAGGG - Intergenic
1009662337 6:66630992-66631014 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1009873741 6:69480370-69480392 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1010102531 6:72125958-72125980 GGGTGAGCCAAAGCAGGGCAGGG - Intronic
1010334030 6:74660174-74660196 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1010476960 6:76299499-76299521 GCATGAGCCACAGCAGGGCAAGG - Intergenic
1010603620 6:77862253-77862275 GCATGAGCCGAAGCAGGGCAAGG + Intronic
1010820710 6:80411927-80411949 GGCTGAGCCAAAGCAGGGCAGGG - Intergenic
1010869304 6:81018025-81018047 GCATGAGCCAAAGCAGAGCAAGG - Intergenic
1011294871 6:85816103-85816125 GCATGAGCCACAGCAGGGTGAGG + Intergenic
1011358569 6:86498069-86498091 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1011376770 6:86695337-86695359 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1011395082 6:86897869-86897891 GCGTGAGCCAAAGCAGGGCAAGG + Intergenic
1012055908 6:94410135-94410157 GAAAGAGCCACAGCATGACATGG + Intergenic
1012481946 6:99676764-99676786 GCATAAGCCAAAGCAGGGCAAGG - Intergenic
1013607590 6:111764870-111764892 GAATGAGCCACAGCAGGGAAGGG - Intronic
1013906126 6:115222246-115222268 GAGTGAGCCGAAGCAGGGCAAGG + Intergenic
1013908848 6:115250235-115250257 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1013956834 6:115852150-115852172 GGGTGAGCCATAGCAGGGTAAGG + Intergenic
1014013261 6:116501012-116501034 GAGTGAGCCGAAGCAGGGCAGGG + Intronic
1014063641 6:117101233-117101255 GCAAGAGCCAAAGCAGGGCAAGG - Intergenic
1014184623 6:118421174-118421196 GGGTGAGCCAAAGCAGGGCAGGG + Intergenic
1014357652 6:120432750-120432772 GCGTGAGCCAAAGCAGGGCAAGG + Intergenic
1014529614 6:122543180-122543202 GCATGAGCCAAAGCAGGGCGAGG - Intronic
1014842948 6:126241171-126241193 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1015290383 6:131532106-131532128 GGGTGAGCCAAAGCAGGGCAGGG - Intergenic
1016523916 6:144977702-144977724 GGGTGAGCCAAAGCAGGGCAAGG - Intergenic
1017433945 6:154398105-154398127 ACAAGAGCCAAAGCAGGGAAGGG + Exonic
1018187812 6:161282538-161282560 GAATGAGCCGCAGTAGGTGAAGG - Intergenic
1018612644 6:165660683-165660705 GAATGAGCCGCAGTTGGGAGCGG + Intronic
1019703846 7:2488152-2488174 GGATGAGCCTCGGCAGGGATGGG + Intergenic
1020622316 7:10533379-10533401 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1020645718 7:10811864-10811886 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1021143180 7:17053107-17053129 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1021375957 7:19906498-19906520 GCCTGAGCCAAAGCAGGGCAAGG - Intergenic
1021978726 7:26033679-26033701 GAAGGAGAAACAGCTGGGAAGGG - Intergenic
1022044553 7:26612594-26612616 GAGTGAGGCAGAGCAGGGCAGGG - Intergenic
1022329333 7:29362649-29362671 GAAAGAGGAACTGCAGGGAAAGG - Intronic
1022392263 7:29953675-29953697 GAATGAGGAACAGTAAGGAAAGG + Intronic
1022426676 7:30275904-30275926 GAATGATCTGCAGCAGGGGATGG - Intergenic
1022624953 7:32025659-32025681 GATTTTGCCACAGCAGGGAGAGG + Intronic
1022879919 7:34575963-34575985 GCATAAGCCAAAGCAGGGCAAGG + Intergenic
1022901384 7:34814082-34814104 GGGTGAGCCAAAGCAGGGCAGGG + Intronic
1022933861 7:35151981-35152003 GCATGAGCCGAAGCAGGGAAAGG + Intergenic
1023294296 7:38699128-38699150 GAATGATCCAGAGAAGTGAAGGG - Intergenic
1023651244 7:42371412-42371434 GGGTGAGCCAAAGCAGGGCAGGG - Intergenic
1023661958 7:42479126-42479148 GAATCAGCTACAGTTGGGAAAGG + Intergenic
1023916351 7:44592242-44592264 GAGTTAACCCCAGCAGGGAAGGG + Intergenic
1024139895 7:46451736-46451758 AATTTAGCCACAGCAGGGCAGGG + Intergenic
1024408283 7:49007951-49007973 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1024459988 7:49649903-49649925 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
1024668252 7:51566627-51566649 GAATGGGCCCCTGCAGAGAAGGG + Intergenic
1025184189 7:56844347-56844369 GCACGAGCCAAAGCAGGGCAAGG - Intergenic
1025601211 7:62999167-62999189 GCATAAGCCAAAGCAGGGAGAGG - Intergenic
1025868504 7:65407768-65407790 GAATGAGCCAAAGCAGGGCAAGG - Intergenic
1025874768 7:65470449-65470471 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1026276077 7:68877850-68877872 TTATAAGCCACAGCAGGGATGGG - Intergenic
1026470867 7:70693759-70693781 GATTGCGCCATGGCAGGGAAAGG - Intronic
1026658870 7:72281162-72281184 GAAAGAGGCAGAGAAGGGAAAGG - Intronic
1026909257 7:74083231-74083253 GAATGAGCAGCACCAGAGAAAGG - Intronic
1026953750 7:74364174-74364196 GAATGAGCAACAGCAGAGAGAGG - Intronic
1027172781 7:75884662-75884684 GAAGTAGCAACAGCAGGAAAGGG + Intronic
1028340893 7:89718855-89718877 GGGTGAGCCAAAGCAGGGAGGGG + Intergenic
1028395560 7:90365091-90365113 GTGTGAGCCAAAGCAGGGCAAGG - Intronic
1028405059 7:90465645-90465667 GCCTGACCCACAGCAGGGAAGGG - Intronic
1028646888 7:93108479-93108501 GTGTGAGCCAAAGCAGGGCAGGG + Intronic
1028718266 7:93999778-93999800 GAAAGAGCCAAAGCAGGGAGGGG + Intronic
1029465390 7:100721583-100721605 GAGGGAGCGACAGCAGGGACAGG - Exonic
1029681928 7:102117495-102117517 GAATGAGCCAGAGCGGGGAAAGG + Intronic
1029922112 7:104276689-104276711 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1029979427 7:104864292-104864314 GCATGAGCCAAAGCAGGGCGAGG + Intronic
1030142570 7:106320321-106320343 GCATGAGCCAAAGCAGGGAGGGG + Intergenic
1030197147 7:106863674-106863696 GACTGAGCCAGGACAGGGAAGGG + Intergenic
1031358970 7:120823589-120823611 GGGTGAGGCACAGCAGGAAAGGG + Intronic
1032283495 7:130524512-130524534 GAATGAGTCGGAGCAGGCAATGG + Intronic
1032284236 7:130528738-130528760 GAATGAGTCGGAGCAGGCAATGG + Intronic
1033830167 7:145241892-145241914 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1034028882 7:147737980-147738002 GCATGAGCCGAAGCAGGGCAAGG - Intronic
1034208991 7:149345788-149345810 GCATGAGCCGAAGCAGGGCAGGG - Intergenic
1034360817 7:150496385-150496407 GAATGAGCTGAAGCAGGGCAGGG + Intergenic
1034379489 7:150678521-150678543 GCGTGAGCCAAAGCAGGGCAAGG + Intergenic
1034529916 7:151689328-151689350 GGATGAGGCACAGGTGGGAAGGG + Intronic
1035065704 7:156103729-156103751 GAATGAGCCAGAGAAGGAACTGG + Intergenic
1035431255 7:158824171-158824193 GGCTGAGACACAGAAGGGAAAGG - Intronic
1036066202 8:5384176-5384198 GATTGTGCCACTGCAGGTAAGGG - Intergenic
1036139206 8:6191246-6191268 GCATGAGCCAAAGCAGGGAGAGG + Intergenic
1037994382 8:23341917-23341939 AAAGGAGACACAGCAAGGAAAGG + Intronic
1038140455 8:24839730-24839752 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1038211495 8:25522876-25522898 GGATGAGCCGAAGCAGGGTATGG + Intergenic
1038264107 8:26023825-26023847 GTATCAGCCACTGGAGGGAAAGG - Intronic
1038928922 8:32171525-32171547 GCATGAGCCAAAGCAGGGAGAGG + Intronic
1039103720 8:33967757-33967779 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1039107895 8:34009181-34009203 GGATGAACCACAGGAAGGAAGGG - Intergenic
1039194726 8:35018248-35018270 GAATGTGCCACAGAAGCTAAAGG - Intergenic
1039422987 8:37460444-37460466 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1039923554 8:41909368-41909390 GTATGAGCCCCAGGAGGGTAGGG + Intergenic
1040363657 8:46691961-46691983 GTGTGAGCCAAAGCAGGGCAAGG + Intergenic
1040368603 8:46745843-46745865 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1040369794 8:46758067-46758089 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1040383318 8:46894121-46894143 GGGTGAGCCAAAGCAGGGCAAGG + Intergenic
1040403366 8:47075678-47075700 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1040814399 8:51492461-51492483 GCATGAGCCAAAGCTGGGCAAGG + Intronic
1040962473 8:53049105-53049127 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1041121081 8:54586957-54586979 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
1041275412 8:56152124-56152146 CCATGAGCCAAAGCAGGGCAGGG - Intergenic
1041302643 8:56429263-56429285 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1041550712 8:59097582-59097604 GAATGTGCCACAGATGAGAAAGG - Intronic
1041621232 8:59971953-59971975 GAAACTGCCAAAGCAGGGAAGGG + Intergenic
1041726648 8:61024046-61024068 GAATGTGCGAGAGCAGAGAAAGG - Intergenic
1041771838 8:61480545-61480567 GCATGAGCCAAAGCAGGGTGAGG - Intronic
1042115432 8:65426520-65426542 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1042204779 8:66317970-66317992 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1042534321 8:69843464-69843486 GGGTGAGCCAAAGCAGGGCAAGG + Intergenic
1042800491 8:72712840-72712862 GCATGAGCCAAAGCAGGGCGAGG + Intronic
1043089224 8:75876294-75876316 GGATGAGCCGAAGCAGGGCAGGG - Intergenic
1044546534 8:93466478-93466500 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
1044712861 8:95073601-95073623 GAATGAGCCATGGCAGTGGATGG - Intronic
1044722816 8:95167447-95167469 GAATGCGGCTCTGCAGGGAAGGG - Intergenic
1045143585 8:99314130-99314152 GCATGAGCCAAAGCAGGGCAAGG - Intronic
1045293391 8:100852486-100852508 GCACGAGCCAAAGCAGGGCAAGG + Intergenic
1045360221 8:101425930-101425952 GCATGAGCCAAAGCATGGCAAGG + Intergenic
1045949371 8:107834101-107834123 GGGTGAGCCAAAGCAGGGCAGGG + Intergenic
1046121996 8:109858796-109858818 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1046704394 8:117434481-117434503 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1046783822 8:118244518-118244540 GAAAGGGCCACACCATGGAAAGG - Intronic
1047540269 8:125758488-125758510 GAATTGGCCACAGCAGAGATAGG + Intergenic
1047774583 8:128059232-128059254 GAATGAGATATGGCAGGGAAAGG + Intergenic
1048105346 8:131402611-131402633 GAATGTGCCACTGTAGGGCAGGG - Intergenic
1048335753 8:133500995-133501017 GGCTGAGCCACACCAGGCAAGGG + Intronic
1048551831 8:135440612-135440634 GCCTGAGGCACAACAGGGAAAGG - Intergenic
1048858411 8:138703803-138703825 GTGTGAGCCAAAGCAGGGCAGGG + Intronic
1049744634 8:144258037-144258059 GGAGCAGCCTCAGCAGGGAAGGG + Intronic
1049867187 8:144946722-144946744 GTATGGCCCACAGCAGGGTACGG - Intronic
1050374206 9:4953669-4953691 GCATAAGCCAAAGCAGGGAGAGG - Intergenic
1050629919 9:7548139-7548161 GAATTAGCAACAGCACAGAATGG + Intergenic
1050886933 9:10778448-10778470 GAATGAGCTGAAGCAGGGCAAGG + Intergenic
1051199357 9:14599294-14599316 GGATGAGCCAAAGCAGGGTGGGG + Intergenic
1051614798 9:18997117-18997139 GGATGAGCCAAAGCAGGGCAGGG + Intronic
1052345080 9:27401197-27401219 GAATGTGAAACAGAAGGGAATGG - Intronic
1052377403 9:27732613-27732635 GACTGAGTGACAGCAAGGAAAGG + Intergenic
1052770461 9:32684284-32684306 GGGTGAGCCAAAGCAGGGCAGGG + Intergenic
1052799989 9:32957956-32957978 GGGTGAGCCAAAGCAGGGCAGGG + Intergenic
1052992969 9:34532527-34532549 GCGTGAGCCAAAGCAGGGCAAGG - Intergenic
1053346833 9:37384345-37384367 GAATGCGGAACAGCAGGGCATGG - Intergenic
1053550890 9:39078450-39078472 GAACGACCTACAACAGGGAAAGG + Exonic
1053815000 9:41898527-41898549 GAACGACCTACAACAGGGAAAGG + Exonic
1053847111 9:42250658-42250680 GCATGAGCCAAAGCAGGGCGGGG + Intergenic
1054581836 9:66922313-66922335 GCATGAGCCAAAGCAGGGCAGGG - Intronic
1054615596 9:67288914-67288936 GAACGACCTACAACAGGGAAAGG - Intergenic
1055053253 9:72000461-72000483 GGGTGAGCCAAAGCAGGGCAGGG - Intergenic
1055571688 9:77623617-77623639 GAGTGAGCCAAAGCAGGGTGGGG + Intronic
1055802829 9:80059242-80059264 GAATGTGAAACAGGAGGGAAAGG - Intergenic
1056308976 9:85320889-85320911 TAATGAGCCCCACCAGGGACAGG + Intergenic
1056455028 9:86751719-86751741 GGATCAACCACAGCAGAGAAAGG - Intergenic
1056750244 9:89345387-89345409 GAATGAGCCAAAGCAGAGCGGGG + Intronic
1056899293 9:90583521-90583543 TAATGAGCCCCACCAGGGATGGG + Intergenic
1057790556 9:98122021-98122043 GAATAAACCACAGCTGGGTAAGG + Exonic
1058215192 9:102223749-102223771 GCTCGAGCCACAGCAGGGAGAGG - Intergenic
1058367109 9:104221277-104221299 GCATGAGCCAAAGCAGGGCTAGG - Intergenic
1059161738 9:112041343-112041365 GAATGGGGCCCAGCTGGGAATGG + Exonic
1059912085 9:119055640-119055662 GAATGATCCACAGTAGGGAATGG + Intergenic
1059939471 9:119343954-119343976 GATTGAGACAGAGGAGGGAAAGG - Intronic
1060152740 9:121299283-121299305 GCATGCGCCGCAGCAGGGCAGGG - Intronic
1060828100 9:126697743-126697765 GATTTAGCTACAGCAGGGCAGGG - Exonic
1061659596 9:132120105-132120127 GACTGGGGCAGAGCAGGGAACGG - Intergenic
1061706881 9:132460154-132460176 GAGAGAGCAACAGCAGGAAATGG - Intronic
1062181871 9:135195268-135195290 GCAGGAGCCACAGCAGGCACAGG - Intergenic
1203758296 Un_GL000218v1:156351-156373 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
1203447298 Un_GL000219v1:69576-69598 GCATGAGCCGAAGCAGGGAGAGG - Intergenic
1203365731 Un_KI270442v1:254183-254205 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1203410383 Un_KI270581v1:3217-3239 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1203415484 Un_KI270582v1:2562-2584 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1203717665 Un_KI270742v1:169023-169045 GCATGAGCCAAAGCAGGGAAAGG - Intergenic
1203533559 Un_KI270743v1:9210-9232 GCATGAGCCAAAGCAGGGAAAGG + Intergenic
1203651880 Un_KI270751v1:132614-132636 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
1186144848 X:6614576-6614598 GAAAGAATCACAGCAGGGAAGGG - Intergenic
1186196722 X:7116530-7116552 GAATGAGGCTGAGCAGGGCAGGG - Intronic
1186775883 X:12864257-12864279 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1187436923 X:19279327-19279349 GTGTGAGCCAAAGCAGGGAGAGG - Intergenic
1187685876 X:21815064-21815086 GGAGGAGCCCCAGCAGGGCAGGG - Intergenic
1188017672 X:25122999-25123021 GTGTGAGCCAAAGCAGGGCAGGG - Intergenic
1188978676 X:36706149-36706171 GCGTGAGCCAAAGCAGGGCAAGG - Intergenic
1189200084 X:39186323-39186345 GTATGAGCCAAAGCAGGGCGAGG - Intergenic
1189297281 X:39927928-39927950 TTATGAGCCACAGCAGAGCAAGG + Intergenic
1189930527 X:46004302-46004324 ACATGAGCCAAAGCAGGGCAAGG - Intergenic
1189963112 X:46344133-46344155 GAAGATCCCACAGCAGGGAAGGG - Intergenic
1190188743 X:48257909-48257931 GAAGTAGCCAAAGCAGGAAAAGG - Intronic
1190194291 X:48304156-48304178 GAAGTAGCCAAAGCAGGAAAAGG + Intergenic
1190200168 X:48354561-48354583 GAAATAGCCAAAGCAGGAAAAGG + Intronic
1190519404 X:51262183-51262205 GCGTGAGCCAAAGCAGGGCAAGG + Intergenic
1190606763 X:52151096-52151118 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
1190654441 X:52598657-52598679 GAAGTAGCCAAAGCAGGAAAAGG - Intergenic
1190655764 X:52611069-52611091 GAAGTAGCCAAAGCAGGGAAAGG + Intergenic
1190657633 X:52625665-52625687 GAAGTAGCCAAAGCAGGAAAAGG - Intergenic
1190666977 X:52705057-52705079 GAAGTAGCCAAAGCAGGAAAAGG + Intronic
1190672441 X:52753351-52753373 GAAGTAGCCAAAGCAGGAAAAGG - Intronic
1190800436 X:53783521-53783543 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1190830245 X:54053064-54053086 GCATGAGCCGAAGCAGGGCAAGG - Intergenic
1190903056 X:54697654-54697676 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1190966183 X:55303606-55303628 GTATGAGCCGAAGCAGGGCAAGG - Intergenic
1191023688 X:55889954-55889976 GCATGAGCCAAAGCAGAGCAAGG - Intergenic
1191049709 X:56178063-56178085 GTGTGAGCCAAAGCAGGGAGAGG - Intergenic
1191065307 X:56341603-56341625 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1191092283 X:56636173-56636195 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1191114916 X:56842136-56842158 GCATGAGCCAATGCAGGGCAAGG - Intergenic
1191120038 X:56894093-56894115 GGAGGAGCCAAAGCAGGGCAAGG + Intergenic
1191138402 X:57090961-57090983 GCATGAGCTAAAGCAGGGCAAGG - Intergenic
1191168617 X:57418523-57418545 GGATGAGCCAAAGCAGGGTGGGG - Intronic
1191172838 X:57467279-57467301 GAGTGAGCCAAAGCAGGGCAAGG + Intronic
1191197856 X:57744144-57744166 GGGTGAGCCAAAGCAGGGCAGGG + Intergenic
1191592901 X:62906936-62906958 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1191745094 X:64477921-64477943 GGGTGAGCCAAAGCAGGGTAGGG - Intergenic
1191765687 X:64695803-64695825 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1191799259 X:65059038-65059060 GCGTGAGCCAAAGCAGGGCAAGG - Intergenic
1191814080 X:65224548-65224570 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1191969229 X:66794998-66795020 GCGTGAGCCAAAGCAGGGCAAGG - Intergenic
1191990120 X:67026342-67026364 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
1192049355 X:67709602-67709624 GTGTGAGCCAAAGCAGGGAGAGG - Intronic
1192066405 X:67889922-67889944 GTGTGAGCCAAAGCAGGGCAGGG - Intergenic
1192071201 X:67942693-67942715 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1192101007 X:68264706-68264728 GCATGAGCCAAAGCAGGGCGAGG + Intronic
1192358069 X:70422124-70422146 GCATCAGCATCAGCAGGGAAGGG - Intergenic
1192406377 X:70890365-70890387 GGGTGAGCCAAAGCAGGGCAGGG + Intronic
1192525923 X:71843884-71843906 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1192553674 X:72073201-72073223 GGCTGAGCTGCAGCAGGGAAAGG + Intergenic
1192685987 X:73305545-73305567 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1192835533 X:74794818-74794840 GCATGAGCCAAAGCAGGGCGAGG - Intronic
1192987390 X:76414995-76415017 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1193049978 X:77089439-77089461 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1193051404 X:77103364-77103386 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1193154410 X:78157843-78157865 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1193473877 X:81940396-81940418 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1193592473 X:83407296-83407318 GAGTGAGCCAAAGCAGGGCGAGG + Intergenic
1193811311 X:86054691-86054713 GCGTGAGCCAAAGCAGGGCAGGG - Intergenic
1194035953 X:88872356-88872378 AAATGAGCCAGAGCAGTGAATGG + Intergenic
1194068625 X:89292791-89292813 GCATGAGCCAAAGCGGGGCAAGG + Intergenic
1194190933 X:90836395-90836417 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1194658066 X:96597795-96597817 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1194961130 X:100236773-100236795 GAATGAGCCGAAGCAGGGTGGGG - Intergenic
1195089027 X:101440936-101440958 GCATGAGCCAAAGCAGGGCAAGG - Intronic
1195119587 X:101736837-101736859 TTATGAGTCACAGCAGGGACAGG + Intergenic
1195147436 X:102031611-102031633 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1195167684 X:102236440-102236462 GCATGAGCCAAAGCAGGGAGAGG - Intergenic
1195191173 X:102450647-102450669 GCATGAGCCAAAGCAGGGAGAGG + Intronic
1195340630 X:103903082-103903104 GCCTGAGCCAAAGCAGGGCAAGG - Intergenic
1195417589 X:104636805-104636827 GCATGAGCCAAAGCAGGGCGAGG - Intronic
1195502043 X:105613152-105613174 GGCTCAGCCACAGCAGGGTAGGG + Intronic
1195519331 X:105812746-105812768 GGGTGAGCCAAAGCAGGGAGGGG - Intergenic
1195680523 X:107542702-107542724 CAATCAGCCACAGGAGGGCAGGG - Intronic
1195826737 X:109010547-109010569 GCATGAACCAAAGCAGGGCAAGG + Intergenic
1195858031 X:109351737-109351759 GAATGAGGCATACCAGGGCAGGG + Intergenic
1195932900 X:110096650-110096672 GCATGAGCCGAAGCAGGGCAGGG - Intronic
1196380744 X:115086426-115086448 GCATGAGCCGAAGCAGGGAGAGG - Intergenic
1196658186 X:118241865-118241887 GAATCAGCCAAAGCAGGGTGAGG + Intergenic
1196901812 X:120391034-120391056 GCATGAGCCAAAGCAGGGAGAGG - Intergenic
1197057605 X:122140167-122140189 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1197909126 X:131461760-131461782 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1197988301 X:132290441-132290463 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1198615634 X:138456009-138456031 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1198716790 X:139566278-139566300 GAAAGAATCACAGCAGGCAAAGG + Intergenic
1198841378 X:140861216-140861238 GACTGAGCCCCTGCAGGGAGTGG + Intergenic
1198858472 X:141044458-141044480 GCATGAGCCCAAGCAGGGCAGGG + Intergenic
1199354638 X:146847825-146847847 GAAGGAACGACAACAGGGAAGGG - Intergenic
1199486421 X:148352862-148352884 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1199936744 X:152582064-152582086 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
1199968560 X:152841276-152841298 GGGTGAGCCAAAGCAGGGCACGG - Intronic
1200269775 X:154671303-154671325 GGGTGAGCCAAAGCAGGGCAGGG - Intergenic
1200288575 X:154848749-154848771 GCATGAGCCGAAGCAGGGTAAGG - Intronic
1200722769 Y:6626946-6626968 GCATGAGCCAAAGCGGGGCAAGG + Intergenic
1200737336 Y:6814003-6814025 GGGTGAGCCAAAGCAGGGCAAGG + Intergenic
1201171826 Y:11273961-11273983 GCATGAGCCAAAGCAGGACAAGG - Intergenic
1201308213 Y:12569736-12569758 GCATGAGCCGAAGCAGGGCAAGG + Intergenic
1201494319 Y:14576552-14576574 GCATGAGCCAAAGCAGGGTGAGG - Intronic
1201663832 Y:16427174-16427196 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1201684259 Y:16683369-16683391 GAGTGAGCCAAAGCAGGGCAAGG + Intergenic
1201909073 Y:19114886-19114908 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1201915044 Y:19172649-19172671 GCATGAGTCAAAGCAGGAAAAGG + Intergenic
1201933437 Y:19379129-19379151 GCACGAGCCAAAGCAGGGCAAGG - Intergenic
1201942347 Y:19473492-19473514 GCATGAGCCAAAGTAGGGCAAGG - Intergenic
1201967497 Y:19753932-19753954 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1201969815 Y:19779828-19779850 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1202066299 Y:20943749-20943771 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1202170740 Y:22041087-22041109 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
1202174653 Y:22086145-22086167 GAATGAGCTGAAGCAGGGCAGGG + Intronic
1202216709 Y:22500237-22500259 GAATGAGCTGAAGCAGGGCAGGG - Intronic
1202220623 Y:22545286-22545308 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
1202242142 Y:22781615-22781637 GCATGAGCCAAAGCAGGGTGAGG - Intergenic
1202255877 Y:22919965-22919987 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1202322490 Y:23650377-23650399 GCATGAGCCAAAGCAGGGCAAGG + Intergenic
1202326478 Y:23695831-23695853 GAATGAGCTGAAGCAGGGCAGGG + Intergenic
1202331320 Y:23756446-23756468 GTATAAGCCGCAGCAGGGCAAGG + Intergenic
1202408868 Y:24553718-24553740 GCATGAGCCAAAGCAGGGCGAGG + Intergenic
1202461915 Y:25116360-25116382 GCATGAGCCAAAGCAGGGCGAGG - Intergenic
1202475658 Y:25254733-25254755 GCATGAGCCAAAGCAGGGTGAGG + Intergenic
1202539450 Y:25913614-25913636 GTATAAGCCGCAGCAGGGCAAGG - Intergenic
1202544292 Y:25974222-25974244 GAATGAGCTGAAGCAGGGCAGGG - Intergenic
1202548283 Y:26019679-26019701 GCATGAGCCAAAGCAGGGCAAGG - Intergenic
1202601881 Y:26601940-26601962 GCATGAGCCAAAGCAGGGTGAGG + Intergenic