ID: 1013607591

View in Genome Browser
Species Human (GRCh38)
Location 6:111764871-111764893
Sequence AGAATGAGCCACAGCAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 758
Summary {0: 1, 1: 0, 2: 8, 3: 106, 4: 643}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013607591_1013607600 11 Left 1013607591 6:111764871-111764893 CCTTCCCTGCTGTGGCTCATTCT 0: 1
1: 0
2: 8
3: 106
4: 643
Right 1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG No data
1013607591_1013607603 26 Left 1013607591 6:111764871-111764893 CCTTCCCTGCTGTGGCTCATTCT 0: 1
1: 0
2: 8
3: 106
4: 643
Right 1013607603 6:111764920-111764942 GAGGCAGGAGGGTGCTCTGATGG 0: 1
1: 0
2: 6
3: 58
4: 577
1013607591_1013607595 4 Left 1013607591 6:111764871-111764893 CCTTCCCTGCTGTGGCTCATTCT 0: 1
1: 0
2: 8
3: 106
4: 643
Right 1013607595 6:111764898-111764920 TGTTCCCCTTTGCTGGCAGCTGG No data
1013607591_1013607602 15 Left 1013607591 6:111764871-111764893 CCTTCCCTGCTGTGGCTCATTCT 0: 1
1: 0
2: 8
3: 106
4: 643
Right 1013607602 6:111764909-111764931 GCTGGCAGCTGGAGGCAGGAGGG No data
1013607591_1013607594 -3 Left 1013607591 6:111764871-111764893 CCTTCCCTGCTGTGGCTCATTCT 0: 1
1: 0
2: 8
3: 106
4: 643
Right 1013607594 6:111764891-111764913 TCTCTCTTGTTCCCCTTTGCTGG 0: 1
1: 0
2: 2
3: 37
4: 303
1013607591_1013607601 14 Left 1013607591 6:111764871-111764893 CCTTCCCTGCTGTGGCTCATTCT 0: 1
1: 0
2: 8
3: 106
4: 643
Right 1013607601 6:111764908-111764930 TGCTGGCAGCTGGAGGCAGGAGG 0: 1
1: 1
2: 9
3: 99
4: 898
1013607591_1013607596 7 Left 1013607591 6:111764871-111764893 CCTTCCCTGCTGTGGCTCATTCT 0: 1
1: 0
2: 8
3: 106
4: 643
Right 1013607596 6:111764901-111764923 TCCCCTTTGCTGGCAGCTGGAGG 0: 1
1: 1
2: 2
3: 40
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013607591 Original CRISPR AGAATGAGCCACAGCAGGGA AGG (reversed) Intronic
900886801 1:5421005-5421027 AGAATGGGCCACATGAAGGAGGG - Intergenic
902051621 1:13567839-13567861 AGAAAGAGACACAGGAGAGAGGG + Intergenic
902965214 1:19996073-19996095 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
903061361 1:20670919-20670941 AGAAAGAGCCACAGCATGTCTGG + Intronic
903245604 1:22013030-22013052 ATAATGAGCCACTTCAGGGCAGG - Intergenic
903753117 1:25642173-25642195 AGAGGCAGCCACAGGAGGGAGGG - Intronic
903852014 1:26313185-26313207 AGAATGGAATACAGCAGGGAGGG - Intronic
904198317 1:28802431-28802453 AGGATGAGCAGCAGCAGGGATGG - Intergenic
904272343 1:29358328-29358350 AGAATGGGCCACAGCCATGATGG + Intergenic
905320664 1:37114514-37114536 AGCATGGGGCTCAGCAGGGAGGG + Intergenic
905886967 1:41496699-41496721 AGAATCAGCAACTGCGGGGAGGG + Intergenic
905923704 1:41735448-41735470 AAAATGAGCCACAACAGTGTGGG + Intronic
906529104 1:46512974-46512996 AGAAGGAGAAACAGAAGGGATGG - Exonic
906570179 1:46831145-46831167 ACAGTGAGCCAAAGCAGGGCGGG - Intergenic
906613203 1:47217745-47217767 AGAAGTAGCCACAGTATGGATGG - Exonic
908986042 1:70023256-70023278 AGAATGACCCACAGCTGGCATGG + Exonic
909446513 1:75754787-75754809 AGCATGAGCCGAAGCAGGGCAGG + Intronic
910519715 1:88106044-88106066 AGGAAGAGCCTCAGCAGGTATGG - Intergenic
910857818 1:91713449-91713471 AGAATGAGGCATAGCAGGGAGGG - Intronic
911014731 1:93320276-93320298 AGAATGAGCAAGAGGTGGGATGG - Intergenic
911091662 1:94022211-94022233 AGAATAGGCCACTCCAGGGAAGG - Intronic
911258889 1:95663740-95663762 AGAACCATCCACAGCATGGAAGG + Intergenic
911689767 1:100820103-100820125 AGGGTGAGCCAAAGCAGGGCGGG + Intergenic
912304273 1:108549418-108549440 AGAATCTGCAACAGCAGAGAAGG - Intergenic
912636156 1:111295732-111295754 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
913045748 1:115072320-115072342 AGAATGAGGGAGAGGAGGGATGG - Intronic
913367300 1:118054257-118054279 GGACTGAGCCACATCAGTGATGG + Intronic
913607360 1:120478308-120478330 AGGATGAGCCAAAGCAGGGTGGG + Intergenic
914209073 1:145561831-145561853 AGGATGAGCCAAAGCAGGGTGGG - Intergenic
914267992 1:146054197-146054219 AGGATGAGCCAAAGCAGGGTGGG - Intergenic
914369102 1:147006662-147006684 AGGATGAGCCAAAGCAGGGTGGG + Intergenic
914583834 1:149043526-149043548 AGGATGAGCCAAAGCAGGGTGGG - Intronic
915003890 1:152619056-152619078 TGAATGAGCTACAGCTGTGATGG + Intergenic
915077947 1:153327095-153327117 AGTGTGAGCCAAAGCAGGGCGGG + Intergenic
915771857 1:158433340-158433362 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
915886752 1:159730597-159730619 AGCATGAGCCAAAGCAGGGCAGG + Intergenic
916233968 1:162567035-162567057 AACATGAGCAAAAGCAGGGAAGG - Intronic
916469558 1:165109538-165109560 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
916512116 1:165481805-165481827 AGAAAGAGAGACAGGAGGGAGGG + Intergenic
917041551 1:170810894-170810916 AGGGTGAGCCAAAGCAGGGCGGG + Intergenic
917111813 1:171556394-171556416 AGGGTGAGCCAAAGCAGGGCAGG - Intronic
917160320 1:172050048-172050070 AGAAAGAGCCACAGGAGTTAAGG + Intronic
917181397 1:172302053-172302075 AGGACGAGCCAAAGCAGGGTAGG + Intronic
917192378 1:172431761-172431783 AGGGTGAGCCAAAGCAGGGCGGG + Intronic
917207949 1:172597250-172597272 AGTGTGAGCCAAAGCAGGGCGGG - Intronic
917308834 1:173656075-173656097 AGGGTGAGCCAAAGCAGGGCAGG - Intronic
917585057 1:176417439-176417461 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
917639988 1:176974186-176974208 AAATTGAGCCACAGAAGGAAGGG - Intronic
917647494 1:177043648-177043670 AGATTGAGTCACAGCTGGAATGG - Intronic
918093039 1:181313904-181313926 AGGATGGGCAACAGCAGGAATGG - Intergenic
919400687 1:197112692-197112714 AGGAAGACCCAAAGCAGGGAGGG - Intronic
919966147 1:202527395-202527417 ACACTGAGCCCCATCAGGGAGGG + Intronic
920064369 1:203256628-203256650 AGGGTGAGCCAAAGCAGGGCAGG + Intronic
920294783 1:204949258-204949280 AGGAAGAGCCACAGCAGGGAAGG - Intronic
920568040 1:206991943-206991965 AGAAAGAGCCACTGGAGTGATGG - Intergenic
920704206 1:208240014-208240036 AGACAGAACCAGAGCAGGGAAGG + Intronic
921295051 1:213693578-213693600 TCACTGAGCCACAGCAGGAATGG + Intergenic
921309730 1:213830978-213831000 AGACTGGTCCTCAGCAGGGAAGG - Intergenic
922045529 1:221941692-221941714 AGAATGAGCCAGATGAGGGGTGG + Intergenic
922244859 1:223786288-223786310 AGAAGGGGCCACATCAGGGAGGG + Intronic
922280137 1:224115016-224115038 AGGATGAGGCAAAGCAGGAATGG - Intronic
923085998 1:230703975-230703997 AGGAGGAGGCACAGCAGGGATGG + Intronic
923800544 1:237204959-237204981 GTAATGAGCCTCAGCAGGGACGG + Intronic
924454188 1:244205092-244205114 AGCATCAGCCACAGCAGCCATGG + Intergenic
1062910856 10:1211056-1211078 AGGCTGAGCCACAGCAGGAGAGG - Intronic
1063173542 10:3531314-3531336 GGAATTAGCCACAGCGGTGAAGG - Intergenic
1063821798 10:9844782-9844804 ATAATGAGCCAGAAAAGGGATGG - Intergenic
1064242164 10:13640583-13640605 AGACTGAGGAACAGCAGGGTAGG - Intronic
1065156985 10:22880802-22880824 AGGGTGAGCCAAAGCAGGGCAGG + Intergenic
1065198062 10:23286387-23286409 AGACTGAGACATAGAAGGGAAGG + Intronic
1065740236 10:28790958-28790980 GTAATGAGCCCCACCAGGGACGG + Intergenic
1066480353 10:35789543-35789565 AGAAGGAGCCACATAAGGGCAGG - Intergenic
1066681260 10:37938552-37938574 AGATTCATCCACAGCAGGGAGGG - Intergenic
1066704203 10:38159867-38159889 TGAATGAGCTACAGCTGTGACGG + Intergenic
1066986417 10:42472008-42472030 TGAATGAGCTACAGCTGTGACGG - Intergenic
1067172613 10:43920733-43920755 AGGGTGAGCCAAAGCAGGGCAGG - Intergenic
1067428580 10:46227330-46227352 GGAATGAGCCAGAGCAGGTGAGG - Intergenic
1068239603 10:54288535-54288557 AGGGCGAGCCACAGCAGGGTGGG + Intronic
1068651561 10:59528343-59528365 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1069349055 10:67503262-67503284 AGGGTGAGCCAAAGCAGGGTGGG - Intronic
1070064647 10:73021662-73021684 AGAATGAGCCAAAGCAGGGCGGG + Intronic
1070175500 10:73966132-73966154 AGAAGGAACAACTGCAGGGAAGG - Intergenic
1070187691 10:74081824-74081846 AGAAGGAGGAATAGCAGGGAAGG + Intronic
1070217693 10:74403711-74403733 AGTGTGAGCCAAAGCAGGGCGGG - Intronic
1070337339 10:75467254-75467276 AGTGTGAGCCATGGCAGGGAAGG + Intronic
1071244453 10:83747167-83747189 AGTGTGAGCCAAAGCAGGGTGGG - Intergenic
1071439924 10:85681176-85681198 AGATTGGGCCACATCATGGAGGG - Intronic
1072287248 10:93927843-93927865 AGCATGAGCCAAAGCAGGGTGGG + Intronic
1072380041 10:94858495-94858517 AGGGTGAGCCAAAGCAGGGCAGG - Intergenic
1072394769 10:95027075-95027097 AGAGTGAGCCAAAGCAGGGTGGG - Intergenic
1073685200 10:105745062-105745084 AGAATGAGAGAGAGAAGGGAAGG + Intergenic
1074017097 10:109545484-109545506 AGGGTGAGCCACAGCAGGGCAGG + Intergenic
1074017249 10:109546442-109546464 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1074521134 10:114225129-114225151 AGAATGAACCACAGAGGGCATGG - Intronic
1075450938 10:122551624-122551646 AGCATGAGCAACAGGAGGCAGGG - Intergenic
1075670534 10:124261197-124261219 AGATAGAGCCAGAACAGGGAAGG + Intergenic
1075895976 10:125994795-125994817 ACAATGGGCCACAGCCGGGGAGG - Intronic
1076107096 10:127832265-127832287 AAAATGAGACACAGGAGGGTAGG + Intergenic
1076509109 10:130999611-130999633 AGCCTGAGCCACTGCAGGCAGGG + Intergenic
1076546759 10:131250613-131250635 GTCTTGAGCCACAGCAGGGATGG + Intronic
1077082145 11:728948-728970 AGAGTGGGGCACAGCAGGTAGGG - Intergenic
1077289492 11:1782351-1782373 AGTATGAGCCACTGTGGGGAGGG - Intergenic
1077916729 11:6616461-6616483 AGCATGAGCCACTGCAGGAAGGG + Exonic
1079105912 11:17572324-17572346 AGAAGGAGGAGCAGCAGGGAGGG + Intronic
1079393005 11:20038650-20038672 CAAATGAGCCACAGCATAGAAGG - Intronic
1079517790 11:21289358-21289380 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
1080031418 11:27665444-27665466 AGCATGAGCCAAAGCAGGGTGGG + Intronic
1081143865 11:39536777-39536799 AGAGTGAGCCAAAGCAGGGCAGG - Intergenic
1082127877 11:48453932-48453954 AGGGTGAGCCAAAGCAGGGCAGG - Intergenic
1082875476 11:57983838-57983860 AGACTGAGCCACTAGAGGGATGG - Intergenic
1083531528 11:63427933-63427955 AGGGTGAGCCAAAGCAGGGCAGG + Intergenic
1083992248 11:66253757-66253779 AGAATGAGAACCAGCAGGGAAGG + Intergenic
1084440845 11:69172212-69172234 AAAATTAGCCACGACAGGGATGG + Intergenic
1084644885 11:70450718-70450740 AGATTGACCCACACCAGAGAAGG + Intergenic
1085026309 11:73238556-73238578 AGAATCAGGCACATGAGGGAGGG + Intergenic
1085292828 11:75412204-75412226 AGCAAGAGCCAGATCAGGGAAGG - Intronic
1085319357 11:75564620-75564642 GGAAGGAGCCAGAGCTGGGAGGG + Intronic
1085403044 11:76245937-76245959 AGAATGGGACTCAGCTGGGAGGG + Intergenic
1085433719 11:76480763-76480785 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
1085717743 11:78888156-78888178 ACAATGACCCATAGCAGGGATGG + Intronic
1085771402 11:79329299-79329321 AGACTGAGGCTCAGCAGTGACGG + Intronic
1085827576 11:79864550-79864572 AGGGTGAGCCAAAGCAGGGAGGG + Intergenic
1085884370 11:80505398-80505420 AGGATGAGCCAAAGCAGGGTGGG + Intergenic
1086345551 11:85892140-85892162 AGAGCCAGACACAGCAGGGAAGG + Intronic
1086612912 11:88778424-88778446 AGGGTGAGCCAAAGCAGGGTGGG - Intronic
1086979547 11:93178361-93178383 AGTGTGAGCCAAAGCAGGGCAGG - Intronic
1087188595 11:95230340-95230362 AGAGTTAGCCACAGCAAAGAGGG + Intronic
1087243380 11:95806399-95806421 AGTATGAGCCGAAGCAGGGCAGG + Intronic
1088650097 11:111949883-111949905 AGAAGGAGCAACAGGATGGAAGG - Intronic
1088927283 11:114315146-114315168 AGAGAGTGCTACAGCAGGGATGG - Intergenic
1089192813 11:116666864-116666886 AGCATGAGCCAAAGCAGGGCAGG + Intergenic
1089556930 11:119320186-119320208 GGAAGGAGGCACAGCCGGGATGG + Intronic
1089784989 11:120901341-120901363 AGCATGTGCCAAGGCAGGGAGGG - Intronic
1090415713 11:126538917-126538939 AGAAGGAGTCACAGAAGGGTTGG + Intronic
1090889284 11:130908897-130908919 AGAATGAGTCAAAGAAGGCATGG - Intronic
1090896197 11:130977382-130977404 AGAGAGAGCCAAAGCAGGGTGGG - Intergenic
1092897887 12:13031123-13031145 AGAAAGAGTCACTACAGGGATGG + Intergenic
1092936322 12:13367353-13367375 GTAATGAGCCTCAGCAGGGACGG - Intergenic
1093677593 12:21962349-21962371 AGGGTGAGCCAAAGCAGGGCGGG + Intergenic
1094234210 12:28145139-28145161 AGAAGGAGCCAAATCAGGAAGGG + Intronic
1095706489 12:45242544-45242566 AGGGTGAGCCAAAGCAGGGCAGG - Intronic
1096044943 12:48554165-48554187 AGCATGAGCCAAAGCAGGGTGGG - Intergenic
1096579630 12:52576319-52576341 AAAATCAGCCACAGCAAGGATGG + Intergenic
1096680445 12:53252188-53252210 AGCCGGAGCCACAGCGGGGAGGG + Intronic
1096783003 12:54001564-54001586 AGAAGGAGAAACAGCAGGGGAGG + Intronic
1096895753 12:54819386-54819408 ACAGTGAGCCAAAGCAGGGTGGG - Intergenic
1097364893 12:58701476-58701498 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
1097365766 12:58710340-58710362 AGGGTGAGCCAAAGCAGGGCGGG - Intronic
1097468960 12:59964907-59964929 AGAAAGAGGCACAGCTGGCATGG - Intergenic
1097635278 12:62114285-62114307 AGGACGAGCCAAAGCAGGGTGGG - Intronic
1097917516 12:65036418-65036440 AGCATGAGCCAAAGCAGGGCAGG - Intergenic
1098021737 12:66163170-66163192 AGAATGGGTCACCTCAGGGAAGG - Intronic
1098151966 12:67556020-67556042 AGAGCGAGCCAAAGCAGGGTGGG - Intergenic
1098176072 12:67792602-67792624 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1098438865 12:70497490-70497512 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1098638552 12:72813532-72813554 AGCATGAGCCAAAGCAGGGCGGG - Intergenic
1098997081 12:77133166-77133188 AGAATGAGAGACATCAGGGCAGG + Intergenic
1099022609 12:77424845-77424867 AGGATGAGCCGAAGCAGGGTGGG - Intergenic
1099087031 12:78258107-78258129 AGTGTGAGCCAAAGCAGGGCAGG - Intergenic
1099554695 12:84097278-84097300 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1099720498 12:86356498-86356520 AGCATGAGACAAAGCAGGGCAGG + Intronic
1099740333 12:86626891-86626913 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
1099806854 12:87531129-87531151 AGCATGAGCCAAAGCAGGGTGGG + Intergenic
1099965484 12:89440796-89440818 AGCATGAGCCGAAGCAGGGCGGG + Intronic
1102521853 12:113482501-113482523 TGTGTGAGCCACAGCAGGGGTGG - Intergenic
1103203661 12:119110789-119110811 AGCATGAGCCAAAGCAGGGCGGG - Intronic
1104393130 12:128408081-128408103 AGAATGAGGCTCAACAGGAAGGG + Intronic
1105355020 13:19652276-19652298 AGGGTGAGCCAAAGCAGGGTCGG + Intronic
1105665505 13:22551769-22551791 AGAATGAGCTACAGCTGTGACGG + Intergenic
1105737462 13:23285903-23285925 AGGGTGAGCCAAAGCAGGGTGGG - Intronic
1106313604 13:28575118-28575140 AGAATCATCCACAGAAGGTAAGG + Intergenic
1106326388 13:28694177-28694199 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1106426675 13:29636954-29636976 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1106762547 13:32881266-32881288 AGGAAGAGCCACGGCAGGGCAGG + Intergenic
1106816834 13:33418110-33418132 AGGGTGAGCCAAAGCAGGGCAGG + Intergenic
1107240670 13:38230778-38230800 AGAATGAAGCAAAGCAGGGTCGG + Intergenic
1108308612 13:49163603-49163625 AGTGTGAGCCAAAGCAGGGTGGG - Intronic
1108998237 13:56762991-56763013 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1109363207 13:61323723-61323745 AGTGTGAGCCAAAGCAGGGCAGG + Intergenic
1110699085 13:78526214-78526236 AGCGTGAGCCAAAGCAGGGCGGG + Intergenic
1111071239 13:83171323-83171345 AGCATGAGCCAAAGCAGGGCAGG + Intergenic
1111627874 13:90813047-90813069 AGGATGAGCAAAAGCAGGGTGGG + Intergenic
1113348832 13:109508279-109508301 AGGGTGAGCCAAAGCAGGGCGGG - Intergenic
1113826361 13:113257547-113257569 AGCATGAGCAAGAACAGGGAGGG + Intronic
1114539356 14:23443269-23443291 AGAAGAGGCCAGAGCAGGGATGG + Intergenic
1114651282 14:24286166-24286188 AGAATGTGCCTGAGCAGTGAAGG - Intergenic
1114676312 14:24442509-24442531 AGAGGGTGCCACAGCGGGGACGG - Intronic
1114918657 14:27297996-27298018 AGCATGAGACAGAGTAGGGAGGG + Intergenic
1115043022 14:28955124-28955146 AGGGTGAGCCAAAGCAGGGTAGG + Intergenic
1115045695 14:28990385-28990407 AGAATGTGAAACAGCATGGAAGG - Intergenic
1115277152 14:31621583-31621605 AGGGTGAGCCAAAGCAGGGTGGG - Intronic
1115362278 14:32517458-32517480 AGTGTGAGCCAAAGCAGGGCGGG + Intronic
1115511185 14:34139487-34139509 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
1115537969 14:34391354-34391376 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
1115743173 14:36409563-36409585 AGGGTGAGCCAAAGCAGGGAGGG + Intergenic
1115843618 14:37501769-37501791 AGGGTGAGCCAAAGCAGGGCAGG + Intronic
1115954591 14:38764197-38764219 AGTGTGAGCCAAAGCAGAGAGGG + Intergenic
1117261060 14:54033665-54033687 AGCATCAGCCAAAGCAGGGCAGG - Intergenic
1117349380 14:54866567-54866589 AGAATTAGACAGAGAAGGGAAGG + Intronic
1117856818 14:60042713-60042735 AGCATGAGCCAAAGCAGGACAGG - Intronic
1118105193 14:62650702-62650724 AGGCTCACCCACAGCAGGGAGGG - Intergenic
1119556558 14:75557888-75557910 TGCTTGAGCCACAGCTGGGAGGG + Intergenic
1120042234 14:79767213-79767235 AGAATGGGCCCCAGTAGGGCTGG - Intronic
1120534952 14:85683324-85683346 AGAGGGAGCCAGGGCAGGGAAGG + Intergenic
1120811483 14:88807970-88807992 GGACTGTGCCACAGTAGGGAGGG - Intergenic
1122099095 14:99393227-99393249 AGAAAGAGGCACAGCCGGCAGGG + Intergenic
1122521729 14:102348855-102348877 AGAATCAGCAACAGCACTGAGGG + Intronic
1123108276 14:105852987-105853009 GGACCGAGCCCCAGCAGGGAAGG - Intergenic
1123576717 15:21676791-21676813 AGGATGAGCCAAAGCAGGGTGGG - Intergenic
1123613339 15:22119259-22119281 AGGATGAGCCAAAGCAGGGTGGG - Intergenic
1123855388 15:24405365-24405387 AGAATCATCTACAGCAGGGCAGG - Intergenic
1124356945 15:29002768-29002790 AGAATCAGCCACTGCAGGAAAGG + Intronic
1124556450 15:30730438-30730460 AGAATGAGGCACTCCAGGGTTGG + Intronic
1124674825 15:31675306-31675328 AGAATGAGGCACTCCAGGGTTGG - Intronic
1124885667 15:33683656-33683678 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
1124948450 15:34292985-34293007 AGGGTGAGCCAAAGCAGGGTGGG - Intronic
1125288433 15:38119568-38119590 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1125330869 15:38580878-38580900 AGTGTGAGCCAAAGCAGGGTGGG + Intergenic
1126050751 15:44682938-44682960 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
1126064189 15:44812540-44812562 AGGATGAGCCACTGCAGGGCTGG - Intergenic
1126087091 15:45021057-45021079 AGGGTGAGCCGAAGCAGGGAGGG - Intergenic
1126476281 15:49068698-49068720 AGGGTGAGCCAAAGCAGGGCGGG + Intergenic
1126763926 15:51994698-51994720 AAAATCAGCCACATCAGTGATGG + Intronic
1127070261 15:55281968-55281990 AGAATGGGCTATGGCAGGGAGGG + Intronic
1127373641 15:58362744-58362766 AGAGTGAGCCAAAGCAGGGTGGG + Intronic
1127440833 15:59005921-59005943 CTAATGAGTCACAGCAGTGATGG + Intronic
1127776724 15:62269802-62269824 TGAATGAGCTACAGCTGTGACGG + Intergenic
1128782174 15:70367860-70367882 AGGGCGAGCCACAGCAGGGTGGG + Intergenic
1129023083 15:72541159-72541181 CGAATGAGCTACAGCTGTGAGGG + Intronic
1129374218 15:75117421-75117443 CGAATGAGCTACAGCTGTGATGG + Intronic
1129947366 15:79550858-79550880 AGAAAGACCCACAGCAAGAAGGG - Intergenic
1130572285 15:85057502-85057524 AGCATGAGCCAGAGCAGGGAGGG - Intronic
1130573651 15:85071364-85071386 AGAATCAGGGGCAGCAGGGATGG - Intronic
1131027370 15:89155799-89155821 AGTAAGAGTCACAGCAGGGCTGG + Intronic
1131118927 15:89811106-89811128 AGAATGAGAGACAGCAGTTAAGG + Intronic
1131589317 15:93731180-93731202 AGGGTGAGCCAAAGCAGGGCAGG - Intergenic
1202985585 15_KI270727v1_random:411036-411058 AGGATGAGCCAAAGCAGGGTGGG - Intergenic
1133080956 16:3319904-3319926 ACACTGAGCCACTGCATGGAGGG + Intergenic
1134232384 16:12438910-12438932 AGAGGGAAACACAGCAGGGAAGG + Intronic
1134884317 16:17776205-17776227 AGACTGAGCCACTTCAGGGCAGG + Intergenic
1135301807 16:21335013-21335035 AGTGTGAGCCAAAGCAGGGCAGG - Intergenic
1136600602 16:31284689-31284711 AGTATGAGCCAAAGCAGGGTGGG - Intronic
1136644006 16:31592894-31592916 AGTATATGCCACAGCAGGGTGGG - Intergenic
1136686614 16:31998554-31998576 AGACTGAGGCACAGCAGGTAAGG - Intergenic
1136727641 16:32373660-32373682 AGGGTGAGCCAAAGCAGGGCAGG - Intergenic
1136787226 16:32942091-32942113 ATACTGAGGCACAGCAGGTAAGG - Intergenic
1136882549 16:33911693-33911715 AGACTGAGGCACAGCAGGTAAGG + Intergenic
1137525080 16:49228246-49228268 AGCATGAGCCGAAGCAGGGTGGG + Intergenic
1137890995 16:52161746-52161768 AGTGTGAGCCAAAGCAGGGCAGG - Intergenic
1138023744 16:53506104-53506126 AGCATGAGCTACAGGATGGATGG + Intergenic
1138260329 16:55615589-55615611 AGGCTGAGCCAAAGCAGGGCTGG + Intergenic
1138273573 16:55713771-55713793 GGAATGAGACACTGCATGGAAGG - Intergenic
1138358884 16:56409335-56409357 TGAATGAGCCACAGCAGGCATGG - Intronic
1138713256 16:58993219-58993241 AGTGTGAGCCAAAGCAGGGCGGG - Intergenic
1139636007 16:68258970-68258992 AAAAAGAGCCAAGGCAGGGATGG + Intronic
1140917319 16:79505971-79505993 AGAAGGAGCAAAAGAAGGGAAGG + Intergenic
1141246190 16:82309710-82309732 ATAGTGAGCCAAAGCAGGGTGGG - Intergenic
1142120876 16:88386162-88386184 AGAATGAACCAAAGCAAGGGTGG - Intergenic
1142315207 16:89339793-89339815 AGGAGCAGCCACAGCAGGGTGGG - Intronic
1202998791 16_KI270728v1_random:144090-144112 AGGGTGAGCCAAAGCAGGGCAGG + Intergenic
1203089462 16_KI270728v1_random:1203768-1203790 AGACTGAGGCACAGCAGGTAAGG - Intergenic
1203130390 16_KI270728v1_random:1680498-1680520 AGGGTGAGCCAAAGCAGGGCAGG + Intergenic
1143244748 17:5474648-5474670 ATAATGAGACCCAGCTGGGAAGG - Exonic
1146459852 17:33037439-33037461 TGAACCAGCCACAGCAGGGCTGG - Intronic
1146686912 17:34847255-34847277 AGGCTGAGCCCCAGCAAGGAAGG + Intergenic
1147147576 17:38494209-38494231 AGACTGAGGCACAGCAGGTAAGG - Intronic
1147472810 17:40679377-40679399 GGTATGAGGCACAGGAGGGAGGG - Intergenic
1147659583 17:42110459-42110481 AGGATGAGCTACAACAGGGAGGG + Intronic
1147987129 17:44313084-44313106 AGGCTGAGCCAGGGCAGGGAGGG - Exonic
1148447303 17:47745293-47745315 AGAAGGGGCCCCAGCAGGGGAGG - Exonic
1148750863 17:49945058-49945080 AGCATGAGCCACCGCACGGGTGG - Intergenic
1149225568 17:54465900-54465922 AGAGTGAGCCAAAGCAGGGTGGG - Intergenic
1149390497 17:56185486-56185508 AGAATGGGTCAGAGCAGGGCTGG + Intronic
1149585640 17:57784397-57784419 AGAATGAGCCACGGGATGAACGG - Intergenic
1149888662 17:60366434-60366456 GGCATGAGCCACAGTAGAGACGG + Intronic
1151360580 17:73586272-73586294 ATAAAGAGCAACAGGAGGGAGGG - Intronic
1151557946 17:74856109-74856131 ACCAAGAGCCACAGCAGTGAGGG + Intronic
1151944514 17:77312163-77312185 GGAAGGAGCCACAGCAGGGCAGG - Intronic
1152054865 17:78016668-78016690 AGAATGACCTAAAGAAGGGAAGG - Intronic
1152384755 17:79965632-79965654 AGAATGGCCCACAGCAGGGCAGG + Intronic
1153092697 18:1366540-1366562 AGAAAGAGCTACAGGAGAGATGG - Intergenic
1153826197 18:8877140-8877162 AGAATGAGTCAGAGCAGAGCAGG + Intergenic
1153925433 18:9831567-9831589 GTAATGAGCCTCAGCAGGGACGG + Intronic
1154184754 18:12173071-12173093 AGCATGAACCAAAGCAGGGTGGG - Intergenic
1156247567 18:35317027-35317049 ATAATGAGACAGAGTAGGGATGG + Intergenic
1156329418 18:36105626-36105648 AGAATGAGCAGCAGAGGGGAGGG - Intergenic
1156434421 18:37111699-37111721 AGTATGAGCCAAAGCAGGGTGGG + Intronic
1156523741 18:37746636-37746658 AGAGTGAGGCAGGGCAGGGAGGG + Intergenic
1156979367 18:43266069-43266091 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1157058295 18:44256268-44256290 ATGGTGAGCCAAAGCAGGGAGGG - Intergenic
1157061735 18:44300036-44300058 AGTGTGAGCCAAAGCAGGGTGGG + Intergenic
1157637775 18:49177988-49178010 AGGATGAGTCACAGTAGAGATGG - Intronic
1158400011 18:57113517-57113539 AGGAAGAGCCACAGATGGGATGG + Intergenic
1158702754 18:59763582-59763604 AGAATAAGCCAAAGCTGAGATGG + Intergenic
1158775901 18:60578821-60578843 AGAATTAAACACAGCAGGAAGGG + Intergenic
1159508303 18:69363476-69363498 AGAATGAGCCACCGTAGTGCAGG - Intergenic
1159810841 18:73016598-73016620 AGCATGAGCCGAAGCAGGGCAGG + Intergenic
1160108315 18:76001260-76001282 AAAATGAGACACTGCCGGGAGGG + Intergenic
1160128893 18:76206143-76206165 AGGATGAGCCAGCCCAGGGATGG + Intergenic
1160688000 19:446097-446119 AGACAGAGACACAGAAGGGAGGG + Intronic
1161953115 19:7478521-7478543 AGCATGAGGCACAGCCAGGAGGG - Intronic
1163380195 19:16961186-16961208 AGGATGAGCCGCAGTAGGGCGGG + Intronic
1163684179 19:18701271-18701293 AAACTGAGGCACAGAAGGGAGGG - Intronic
1163823984 19:19512637-19512659 AAAGGGACCCACAGCAGGGAGGG + Intronic
1163929531 19:20375752-20375774 AGAATGAGTCAGAGCAGAGCAGG - Intergenic
1164133224 19:22384909-22384931 AGAGTGAGCCGAAGCAGGGCGGG - Intergenic
1164165588 19:22671847-22671869 AGAGTGAGCCGAAGCAGGGCGGG + Intergenic
1164175691 19:22772009-22772031 AGAATGTGCCAGAGCAGGCTGGG - Intronic
1164882309 19:31742657-31742679 AGAATGAAGGACAGGAGGGAGGG + Intergenic
1165119289 19:33548777-33548799 AGCTGAAGCCACAGCAGGGATGG + Intergenic
1165308010 19:35013896-35013918 AGGATGAGAGACAGAAGGGATGG + Intronic
1165386600 19:35513805-35513827 AGAGTGAGCCGCATCAGGGAGGG + Intergenic
1166275429 19:41750361-41750383 AACAGGAGCCACAGGAGGGAAGG - Intronic
1166280454 19:41789158-41789180 AACAGGAGCCACAGGAGGGAAGG - Intergenic
1166396287 19:42443622-42443644 AACAGGAGCCACAGGAGGGAAGG + Intergenic
1167189104 19:47971128-47971150 AGGAAGAGCCAAAGCAGGGACGG - Intronic
1167568528 19:50272261-50272283 AGAATCAGAAACAGAAGGGAAGG + Intronic
1168297985 19:55387032-55387054 AGATTGAGGCACAACAGGGGAGG + Intronic
1202709248 1_KI270714v1_random:8049-8071 AGGATGAGCCAAAGCAGGGTGGG + Intergenic
925554694 2:5117052-5117074 AGAAAGAGGAAAAGCAGGGATGG + Intergenic
925729248 2:6905450-6905472 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
925814669 2:7735963-7735985 AGGATGAGCCACAGCCTGGGAGG - Intergenic
926018919 2:9477429-9477451 AGAATAATCCATAGGAGGGATGG - Intronic
926054023 2:9763269-9763291 AGAATGAAACACCCCAGGGAAGG + Intergenic
927027902 2:19089408-19089430 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
927117069 2:19916094-19916116 AGGATGAGCCAAAGCAGGGTGGG + Intronic
927221183 2:20711559-20711581 AGGGTGAGCCAAAGCAGGGCGGG + Intronic
927446963 2:23171694-23171716 AGCATGAGCCAAAGAAGGGTGGG + Intergenic
929534743 2:42774028-42774050 AGGATGACTCAAAGCAGGGAGGG - Intronic
929958380 2:46477940-46477962 GGCATGAGCCAAAGAAGGGAGGG - Intronic
929960136 2:46490254-46490276 GGTATCAGCCAGAGCAGGGAAGG + Intergenic
930333193 2:50012930-50012952 AGCATGTGCCACAGCAAAGAAGG - Intronic
930359242 2:50357925-50357947 AGAGCGAGCCAAAGCAGGGTGGG + Intronic
930476738 2:51891667-51891689 AGGGTGAGCCAAAGCAGGGAGGG - Intergenic
931004018 2:57827768-57827790 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
931046821 2:58363148-58363170 AGGATGAGCTGGAGCAGGGAGGG - Intergenic
931204705 2:60136177-60136199 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
931479221 2:62622569-62622591 AGTGTGAGCCAAAGCAGGGTGGG - Intergenic
931480302 2:62633133-62633155 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
931691094 2:64835494-64835516 GGCATGAGCCACCGCAGGGTGGG + Intergenic
932292059 2:70590278-70590300 GGGATGAGGCACAGCTGGGAGGG - Intergenic
933345947 2:81085902-81085924 GGAATCAGCCCCAGCAGGTAGGG + Intergenic
933558605 2:83863637-83863659 AGAATGAGACAAAACATGGATGG + Intergenic
934140201 2:89039545-89039567 ACAATAAGCCAAAGCAGTGAAGG - Intergenic
934229034 2:90160992-90161014 ACAATAAGCCAAAGCAGTGAAGG + Intergenic
934687828 2:96334618-96334640 AAAATGAGCGACAGCACTGATGG + Intergenic
934957513 2:98634997-98635019 AGCATGACACACAGCACGGAAGG + Intronic
934999618 2:99000678-99000700 AGTGTGAGCCAAAGCAGGGCAGG + Intronic
935982725 2:108643344-108643366 AGGATGAGCCGAAGCAGGGTGGG + Intronic
936649909 2:114413973-114413995 AGGGTAAGCCAAAGCAGGGAGGG - Intergenic
936769609 2:115895376-115895398 AGGATGAGCCAAAGCAGGGTGGG - Intergenic
937355309 2:121194745-121194767 AGGAGCAGCCACAGCAGTGAGGG + Intergenic
938165004 2:129018420-129018442 AGAATTAGTCCCTGCAGGGAAGG - Intergenic
938181518 2:129189101-129189123 AGAGGGAGACAGAGCAGGGAGGG - Intergenic
938409512 2:131052522-131052544 AGGATGAGGCCCAGCAGGGTCGG + Intronic
939854906 2:147346493-147346515 AGCTTGTGCCTCAGCAGGGATGG + Intergenic
940093948 2:149952531-149952553 TGCTTGAGCCACAGCTGGGAAGG + Intergenic
942779884 2:179629689-179629711 AGGATGAGCCAAAGCAGGGTGGG + Intronic
942958754 2:181804540-181804562 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
943112426 2:183622247-183622269 AGGATGAGCCAAAGCAGGGTGGG - Intergenic
943628420 2:190223932-190223954 AATATGAGCCAAAGCAGGGCGGG + Intronic
943710753 2:191092718-191092740 AGGGTGAGCCAAAGCAGGGCAGG + Intronic
944165123 2:196710473-196710495 AGGGTGAGCCAAAGCAGGGCAGG - Intronic
944597520 2:201274841-201274863 AGAATGAGACATGGCAGGAAAGG - Intronic
944613049 2:201430792-201430814 AGGGTGAGCCAAAGCAGGGCAGG - Intronic
944676393 2:202036334-202036356 AGACTTAGCCACAGCAGCAAGGG + Exonic
944954816 2:204796615-204796637 AGAATGAGCATCACCAGAGAAGG + Intronic
945048875 2:205805142-205805164 AGAATGAAAGACAGCTGGGAGGG + Intergenic
945161915 2:206900202-206900224 AGGGTGAGCCAAAGCAGGGCAGG - Intergenic
945788877 2:214278287-214278309 AGGGTGAGCCAAAGCAGGGTGGG - Intronic
945827671 2:214744162-214744184 TAAATGAGTGACAGCAGGGAAGG + Intronic
945993186 2:216413179-216413201 AAAGGGAGCCCCAGCAGGGAAGG + Intronic
946425354 2:219592254-219592276 GGAATGATCCACAGCAAGGGAGG - Intergenic
946719015 2:222584518-222584540 AGTGTGAGCCAAAGCAGGGCAGG + Intronic
947011792 2:225573943-225573965 AGAATGTGTAAAAGCAGGGAAGG + Intronic
947196562 2:227573816-227573838 AAAATGAGTCCCAGCAGGGAGGG + Intergenic
947492042 2:230603491-230603513 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
947534874 2:230934157-230934179 AGAAACAGCCAGTGCAGGGAGGG - Intronic
948951334 2:241253832-241253854 AGAATGAGACAGAGCACGGATGG + Intronic
948988836 2:241541688-241541710 AGAATGTGCCGCGGAAGGGAAGG + Intergenic
1168997290 20:2142921-2142943 AGAATAAGCCACTGAAGGGCAGG + Intronic
1169126923 20:3135459-3135481 AGTAGGAGCCACAGCTGGGAAGG + Intronic
1169397128 20:5242010-5242032 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1169745219 20:8936147-8936169 GTCATGAGCCTCAGCAGGGACGG - Intronic
1169795789 20:9461429-9461451 AGTGTGAGCCAAAGCAGGGTGGG + Intronic
1170171770 20:13421836-13421858 ATAATGAGCCACTACAGGTAGGG + Intronic
1170608810 20:17895134-17895156 AAAGGGAGCCAGAGCAGGGAGGG - Intergenic
1171050454 20:21853584-21853606 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1171236447 20:23529270-23529292 AGAATGAGTCAGGGCAGAGAAGG + Intergenic
1172202438 20:33136035-33136057 AGAGTGCACCCCAGCAGGGAGGG - Intergenic
1172941092 20:38655257-38655279 GAAATGAGCCTCAGCAGGGGCGG + Intergenic
1173318727 20:41968475-41968497 AGGATGAGCCAAAGCAGGGTGGG - Intergenic
1173334978 20:42105271-42105293 AAAGTGAGGCAGAGCAGGGAAGG - Intronic
1173543903 20:43877109-43877131 AGTGTGAGCCAAAGCAGGGCAGG - Intergenic
1173701994 20:45080505-45080527 AGAATGGGCCACACCAGGGCAGG - Intergenic
1173977100 20:47195324-47195346 CGTATGAGCCTCCGCAGGGAGGG + Intergenic
1174603349 20:51742487-51742509 AGGAGGAGCAACAGCAGGGTAGG - Intronic
1174933420 20:54841263-54841285 AGAATTAGTAACAGCAGGGATGG + Intergenic
1176097760 20:63352148-63352170 GGAATGAGGCAGAGGAGGGATGG - Intronic
1177155884 21:17501015-17501037 GGAAACAGCCACAGCAGGGACGG + Intergenic
1177425810 21:20921926-20921948 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1178459402 21:32788680-32788702 AGAATGGGCTACTGCATGGAAGG + Intergenic
1179088587 21:38242653-38242675 AGAAAGAGCTTTAGCAGGGAAGG - Intronic
1180224840 21:46386213-46386235 GAAATGAGACACAGCAGGCAGGG - Intronic
1180641039 22:17299608-17299630 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1181486423 22:23234581-23234603 AGGTTAAGTCACAGCAGGGATGG + Intronic
1182169162 22:28209314-28209336 AGTGTGAGCCAAAGCAGGGCGGG + Intronic
1183114873 22:35683999-35684021 AGAATGAGAGACAGGAGAGAAGG + Intergenic
1183698685 22:39437730-39437752 AGACTGAGCCCCTGCAGGGCCGG - Intergenic
1184025539 22:41853129-41853151 AGAATGAGCAACTGCTGGGCTGG + Intronic
1184095216 22:42312699-42312721 AGCCTGAGGCTCAGCAGGGATGG - Intronic
949373998 3:3366670-3366692 AGAAAGAGCCACAGCACTGCTGG + Intergenic
950299919 3:11867968-11867990 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
950359467 3:12440313-12440335 AGAAAGAGCCCTAGCAGGGGTGG - Intergenic
950649131 3:14396387-14396409 AGAAGGAGCCAGACCTGGGAAGG + Intergenic
951007901 3:17639984-17640006 AGAGTGGGCTAGAGCAGGGATGG - Intronic
951434309 3:22643734-22643756 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
951439559 3:22707350-22707372 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
951469144 3:23036403-23036425 AGCATGAGCCGAAGCAGGGTGGG - Intergenic
951684442 3:25328701-25328723 AACATGAGCCAAAGCAGGGCGGG + Intronic
951687678 3:25362766-25362788 AGGATGAGCCAAAGCAGGGTGGG - Intronic
951826018 3:26869603-26869625 AGAATGAGACACAGAAGAGAGGG + Intergenic
952501883 3:33970610-33970632 AGCATGAGCCGAAGCAGGGCAGG - Intergenic
952514034 3:34085680-34085702 AGCATGAGCCAAAGCAGGGCGGG - Intergenic
952695933 3:36264927-36264949 AGAATGAAGAAAAGCAGGGAAGG - Intergenic
952863954 3:37838957-37838979 AGGGTGAGCCAAAGCAGGGCAGG + Intergenic
952935353 3:38393558-38393580 AGAATGTGCCACAGAATGGGTGG + Intronic
953150497 3:40320024-40320046 AAAATGAGACAGAGAAGGGAAGG - Intergenic
953454546 3:43031302-43031324 ATCATGAGCCACAAAAGGGAAGG - Intronic
953820627 3:46204823-46204845 AGAATGATGCACAGCTGGGTTGG - Intronic
955630340 3:60966402-60966424 AGCATGAGCCAAAGCAGGGCGGG - Intronic
955637204 3:61043131-61043153 AGTGTGAGCCAAAGCAGGGCAGG + Intronic
955895327 3:63694072-63694094 AGAGTGAGCCAAAGCAGGGTAGG + Intergenic
956300305 3:67764769-67764791 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
956862502 3:73338826-73338848 AGTGTGAGCCAAAGCAGGGCGGG - Intergenic
956993259 3:74794284-74794306 AGGGTGAGCCAAAGCAGGGCAGG + Intergenic
957131736 3:76231371-76231393 AGAATGAGCCTGAGAAGGAATGG - Intronic
958422998 3:93949860-93949882 AGTGTGAGCCAAAGCAGGGGGGG + Intronic
958793509 3:98681664-98681686 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
959091890 3:101911679-101911701 AGGATGAGCCAAAGCAGAGTGGG - Intergenic
959160423 3:102717084-102717106 AGAATGAGCCACACCAGAGAAGG - Intergenic
959615137 3:108338813-108338835 AGAATGAGATAAAACAGGGAGGG + Intronic
959616346 3:108352404-108352426 AGAAAGAGCCCCAGAAGGGAAGG + Intronic
960317946 3:116201124-116201146 AGAAGGAGGTACAGCGGGGAGGG - Intronic
960423195 3:117474535-117474557 AGCATGAACTACAGCAGGGAAGG - Intergenic
960504250 3:118473492-118473514 AGCATGAGCCACAGCTGGGCTGG - Intergenic
960565774 3:119130229-119130251 AGGGTGAGCCAAAGCAGGGCAGG + Intronic
961857247 3:129884842-129884864 CAAATGAGCTACAGCAGGCAGGG + Intronic
963160020 3:142141340-142141362 AGGGTGAGCCGAAGCAGGGAAGG - Intronic
963483379 3:145904448-145904470 AGAATGACCGACTGCAGAGAGGG + Intergenic
963714450 3:148786603-148786625 AGTGTGAGCCAAAGCAGGGCAGG - Intergenic
964049555 3:152373605-152373627 AGCACGAGCCAAAGCAGGGGGGG - Intronic
964974018 3:162598700-162598722 TGAATGAGCTACAGCTGTGATGG - Intergenic
965220542 3:165921252-165921274 CGAATGAGCTACAGCTGTGACGG - Intergenic
965818996 3:172665954-172665976 AGTGTGAGCCAAAGCAGGGTGGG - Intronic
965880364 3:173381997-173382019 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
966450848 3:180059786-180059808 AGAATTAGGCAAAGCTGGGATGG + Intergenic
966537070 3:181046740-181046762 AGTGTGAGCCAAAGCAGGGTGGG - Intergenic
966920766 3:184610130-184610152 AGATGGGGCCACAGCAGGCAAGG + Intronic
967181588 3:186909843-186909865 AGAGCGAGCCAAAGCAGGGTGGG - Intergenic
967199339 3:187058266-187058288 AGGACGAGCCAAAGCAGGGTGGG - Intronic
967979703 3:195058543-195058565 AGAGGGGGCCACAGGAGGGAGGG - Intergenic
968739778 4:2321669-2321691 AGAGTGAAACAGAGCAGGGAAGG + Intronic
968938083 4:3624069-3624091 AGCCTGAGCCAGAGCTGGGAGGG - Intergenic
969278346 4:6152156-6152178 AGAGTGAGAGAGAGCAGGGAGGG + Intronic
969691999 4:8708906-8708928 AGGATGGGACAGAGCAGGGAAGG + Intergenic
970263429 4:14254321-14254343 AAAATGAGCCACGGCAAGGAAGG + Intergenic
971302908 4:25456551-25456573 GGAATGAGCCAAAAGAGGGAGGG - Intergenic
971437205 4:26640578-26640600 AGGGTGAGCCGAAGCAGGGAGGG + Intronic
971705283 4:30034231-30034253 AGAAGGAGCTACACCAGGCATGG + Intergenic
971883159 4:32409229-32409251 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
972884842 4:43472584-43472606 TGAATGAGCTACAGCTGTGATGG - Intergenic
973598942 4:52522022-52522044 AGGATGAGCCAAAGAAGGGCAGG + Intergenic
973712746 4:53645372-53645394 AGAACAGCCCACAGCAGGGAAGG - Intronic
973801250 4:54481132-54481154 AGGATGAGATTCAGCAGGGAAGG + Intergenic
975345971 4:73293066-73293088 AGCATGAGCCAAAGCAGGGCAGG - Intergenic
975462464 4:74670359-74670381 ACAATGAGCTACAGCAGAGTGGG + Intergenic
975500597 4:75080226-75080248 AGAGTGAGCCAAAGCAGGGCGGG - Intergenic
975521034 4:75300959-75300981 AGAGTGAGCCAAAGCAGGACGGG - Intergenic
975726954 4:77301456-77301478 AGTGTGAGCCAAAGCAGGGTGGG - Intronic
975727203 4:77303559-77303581 AGGATGAGCCAAAGCAGGGTGGG - Intronic
975729897 4:77327581-77327603 AGTGTGAGCCAAAGCAGGGTGGG - Intronic
976439197 4:85054647-85054669 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
976993946 4:91405840-91405862 AGATTAAGCCAAAGCAGGGTGGG - Intronic
978187953 4:105880324-105880346 AGCGTGAGCCAAAGCAGGGCAGG + Intronic
979272910 4:118783075-118783097 AGGGTGAGCCAAAGCAGGGCGGG - Intronic
979457512 4:120943916-120943938 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
979730191 4:124014378-124014400 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
981199641 4:141965851-141965873 AGGGTGAGCCAAAGCAGGAAGGG + Intergenic
981254741 4:142648341-142648363 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
981655886 4:147112101-147112123 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
981668185 4:147255187-147255209 AGCATGAGCCAAAGCAGGGCAGG + Intergenic
982785717 4:159534023-159534045 AGTGTGAGCCAAAGCAGGGTGGG - Intergenic
983331467 4:166334037-166334059 AGGATTAGCCAAAGCAGGGTGGG - Intergenic
983362353 4:166743631-166743653 AGTATGAGCCGAAGCAGGGCGGG + Intronic
983677771 4:170316556-170316578 AGAGTGAGCCAAAGCAGGGTGGG + Intergenic
983727391 4:170945591-170945613 AGACTGAGCATCAGCAGAGAAGG - Intergenic
983820661 4:172190140-172190162 AGAAAGAGAGATAGCAGGGAGGG - Intronic
983879029 4:172912393-172912415 AGTGTGAGCCAAAGCAGGGCAGG + Intronic
983949126 4:173619207-173619229 AGGGTGAGCCAAAGCAGGGCAGG - Intergenic
986083884 5:4423130-4423152 AGAATTAGCCACTGCAGTCAGGG + Intergenic
986750207 5:10780097-10780119 AGTGTGAGCCAAAGCAGGGCGGG + Intergenic
987528287 5:19080954-19080976 ACAGTGAGCCAAAGCAGGGTGGG - Intergenic
988202597 5:28086619-28086641 AGAATGAGCTACAGCAGGGCGGG + Intergenic
988444445 5:31269827-31269849 AGAAGGAGGGGCAGCAGGGAAGG - Intronic
988581758 5:32474602-32474624 GGCACCAGCCACAGCAGGGAGGG + Intergenic
989291591 5:39772633-39772655 AGAATGGATCAGAGCAGGGAGGG - Intergenic
989345330 5:40423183-40423205 AGGATGAGCCGAAGCAGGGCGGG - Intergenic
989614783 5:43328846-43328868 AGGGTGAGCCAAAGCAGGGCGGG - Intergenic
989619134 5:43367527-43367549 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
989636815 5:43544822-43544844 ATAATGAGACACCTCAGGGAGGG - Intronic
989670247 5:43908846-43908868 AGGGTGAGCCAAAGCAGGGAGGG + Intergenic
989671181 5:43918399-43918421 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
990369858 5:55106571-55106593 AGAATTAGCCTCAGCATGGAAGG + Intronic
991223497 5:64242935-64242957 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
991417276 5:66405651-66405673 AGAGTGACCCAAAGCAGGGTGGG - Intergenic
992506160 5:77389364-77389386 AGGGTGAGCCAAAGCAGGGTGGG - Intronic
992830871 5:80592373-80592395 AGAATTAGCAACACAAGGGAAGG - Intergenic
992970524 5:82052105-82052127 AGAATGATCAACTGCAGGAAGGG - Intronic
993033712 5:82733743-82733765 AGGATGAGAGACAGGAGGGAAGG + Intergenic
993069056 5:83135188-83135210 AGCATGAGCCGAAGCAGGGTGGG - Intronic
993358309 5:86941789-86941811 AGGGTGAGCCAAAGCAGGGCAGG - Intergenic
993379594 5:87191367-87191389 AGAAAGAGGAAAAGCAGGGAAGG + Intergenic
993460252 5:88173405-88173427 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
993757711 5:91751496-91751518 AGGATGAGCCGAAGCAGGGTGGG - Intergenic
994039635 5:95244351-95244373 AGGATGAGCCAAAGCAGGGCGGG + Intronic
994127926 5:96190470-96190492 AGAAGGGGCCACAGCAAAGATGG - Intergenic
994387179 5:99146319-99146341 AGTGTGAGCCAAAGCAGGGCGGG + Intergenic
994586567 5:101716246-101716268 AGGGTGAGCCAAAGCAGGGCGGG - Intergenic
994893799 5:105674430-105674452 AAAATGAGACAGAGCAGTGAAGG - Intergenic
995459725 5:112390218-112390240 AGGGTGAGCCAAAGCAGGGCGGG + Intronic
995695653 5:114876040-114876062 AAAGTGAGCCAAAGCAGGGTGGG + Intergenic
996229936 5:121050131-121050153 ATAATGAGCAAAAGCAGAGATGG + Intergenic
996324149 5:122253039-122253061 AGTGTGAGCCAAAGCAGGGTGGG - Intergenic
996593907 5:125179587-125179609 AGAATGACAGACAGCATGGAAGG + Intergenic
997114644 5:131112834-131112856 AGAATGTGGCTCTGCAGGGAGGG - Intergenic
997115641 5:131123146-131123168 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
997465075 5:134082036-134082058 AGCATGATCGTCAGCAGGGAGGG + Intergenic
997697107 5:135870370-135870392 AGAAGGATCCATAGCAGAGAAGG + Intronic
998752160 5:145334067-145334089 AGGTTGAGCCAAAGCAGGGTGGG - Intergenic
998801908 5:145877734-145877756 AGGGTGAGCCAAAGCAGGGCGGG + Intergenic
999247642 5:150163716-150163738 AGAATGAGCCAGAGGAGAGGCGG - Intergenic
999279073 5:150352886-150352908 AGAATGAACAACAGAAGAGAAGG - Intergenic
999488795 5:152027301-152027323 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
999688235 5:154121977-154121999 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
999736499 5:154517280-154517302 AGGCTGAGCCACAGTGGGGAGGG - Intergenic
1000033568 5:157424499-157424521 AGTGTGAGCCAAAGCAGGGCGGG + Intronic
1000412361 5:160947050-160947072 AGCATGAGCCGAAGCAGGGTGGG - Intergenic
1001076329 5:168630849-168630871 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1002516150 5:179760499-179760521 AGCATGCTGCACAGCAGGGAGGG + Intronic
1003082467 6:3032529-3032551 AGAATGCGCCACACTAGGGGTGG + Intergenic
1003477351 6:6496022-6496044 AGAATGAGTCACAGAAGATATGG - Intergenic
1004368571 6:15032857-15032879 AGAACGTGCCACAGCATGGGTGG + Intergenic
1004431577 6:15549648-15549670 ACAATGAGCCTCAACAGGGGAGG - Intronic
1004947951 6:20636268-20636290 AAAATGAACAACAGCAGTGATGG - Intronic
1005558093 6:27008543-27008565 AGTGTGAGCCAAAGCAGGGTGGG + Intergenic
1006731638 6:36240363-36240385 AGAAGGAGACAAAGAAGGGAAGG - Intergenic
1006843615 6:37047974-37047996 CACCTGAGCCACAGCAGGGAGGG - Intergenic
1007249057 6:40483315-40483337 GGAAGGAGACAGAGCAGGGAGGG - Intronic
1008537517 6:52518141-52518163 ACAGTGAGCCACAGCAGGCGAGG + Intronic
1009339385 6:62534351-62534373 AGAAGGAGCCACAGAAGGTAAGG - Intergenic
1009361422 6:62818752-62818774 AGCATGAGCCAAAGCAGGGCAGG - Intergenic
1009655578 6:66541067-66541089 AGGGTGAGCCAAAGCAGGGCAGG + Intergenic
1010102532 6:72125959-72125981 AGGGTGAGCCAAAGCAGGGCAGG - Intronic
1010820711 6:80411928-80411950 AGGCTGAGCCAAAGCAGGGCAGG - Intergenic
1011288569 6:85751803-85751825 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1011340381 6:86307183-86307205 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1011706128 6:90003233-90003255 AGAGTGAGCCAAGGCAGGGTGGG - Intronic
1012340732 6:98119896-98119918 AGGATGAGGCACAGCATGGCTGG - Intergenic
1012799011 6:103801998-103802020 AGCATGAGCCGAAGCAGGGCGGG + Intergenic
1012933195 6:105338565-105338587 AGCATGAGCCGAAGCAGGGCGGG + Intronic
1013391564 6:109690968-109690990 AAAATGGGCCGCAGCAGGCAGGG + Intronic
1013607591 6:111764871-111764893 AGAATGAGCCACAGCAGGGAAGG - Intronic
1013640440 6:112071992-112072014 AGAATGGCCCACAGGAGGTACGG + Exonic
1013685892 6:112581898-112581920 AAAATGAGCCACAGTAGTGGCGG - Intergenic
1014013260 6:116501011-116501033 AGAGTGAGCCGAAGCAGGGCAGG + Intronic
1014128527 6:117804915-117804937 AGTGTGAGCCAAAGCAGGGCGGG - Intergenic
1014184622 6:118421173-118421195 AGGGTGAGCCAAAGCAGGGCAGG + Intergenic
1015211232 6:130701459-130701481 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1015290384 6:131532107-131532129 AGGGTGAGCCAAAGCAGGGCAGG - Intergenic
1016875910 6:148864467-148864489 AGCATGAGCCGAAGCAGGGCGGG - Intronic
1017197504 6:151717151-151717173 AGGGTGAGCCAAAGCAGGGTGGG - Intronic
1018608827 6:165626694-165626716 AAAGTGAGCCGCACCAGGGAGGG - Intronic
1019349498 7:547579-547601 AGAATGAGAAACAGCAGGCCGGG - Intergenic
1019703845 7:2488151-2488173 GGGATGAGCCTCGGCAGGGATGG + Intergenic
1019981853 7:4627538-4627560 AGAATGACCCACCGCATGCAAGG + Intergenic
1020795632 7:12675809-12675831 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1021616226 7:22505781-22505803 AGCCTGAGGCACTGCAGGGATGG - Intronic
1021776533 7:24059920-24059942 AGACTGAGCCCCTGCGGGGAGGG + Intergenic
1021978727 7:26033680-26033702 AGAAGGAGAAACAGCTGGGAAGG - Intergenic
1022528966 7:31055109-31055131 GGAATGACACACAGCTGGGACGG + Intronic
1022901383 7:34814081-34814103 AGGGTGAGCCAAAGCAGGGCAGG + Intronic
1022926016 7:35056996-35057018 AGCCTGAGGCACTGCAGGGATGG - Intergenic
1023294297 7:38699129-38699151 AGAATGATCCAGAGAAGTGAAGG - Intergenic
1023651245 7:42371413-42371435 AGGGTGAGCCAAAGCAGGGCAGG - Intergenic
1023916350 7:44592241-44592263 AGAGTTAACCCCAGCAGGGAAGG + Intergenic
1024232812 7:47375526-47375548 AGAAGGATCCCCTGCAGGGAAGG - Intronic
1024252272 7:47515249-47515271 AGAATGAGCCAGAAAAGGAACGG + Intronic
1024738284 7:52328780-52328802 AGTGTGAGCCAAAGCAGGGTGGG - Intergenic
1026276078 7:68877851-68877873 TTTATAAGCCACAGCAGGGATGG - Intergenic
1026325753 7:69307998-69308020 AAAATGAGCCAAAGCAATGAAGG + Intergenic
1026424790 7:70279935-70279957 AGAATGAGGCACACCTGGGTTGG + Intronic
1027701750 7:81478612-81478634 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1027933513 7:84571047-84571069 ACAATCAGCCACAGGAGGGAGGG - Intergenic
1028142696 7:87290034-87290056 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1028340892 7:89718854-89718876 AGGGTGAGCCAAAGCAGGGAGGG + Intergenic
1028376243 7:90148557-90148579 AGCCTGAGGCACTGCAGGGATGG + Intergenic
1028405060 7:90465646-90465668 AGCCTGACCCACAGCAGGGAAGG - Intronic
1028523558 7:91758887-91758909 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
1028646887 7:93108478-93108500 AGTGTGAGCCAAAGCAGGGCAGG + Intronic
1028718265 7:93999777-93999799 GGAAAGAGCCAAAGCAGGGAGGG + Intronic
1029062238 7:97810514-97810536 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1029324850 7:99797027-99797049 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1029824026 7:103171685-103171707 AGCCTGAGGCACTGCAGGGATGG - Intergenic
1029952006 7:104596031-104596053 AGGGTGAGCCAAAGCAGGGTGGG - Intronic
1030142569 7:106320320-106320342 AGCATGAGCCAAAGCAGGGAGGG + Intergenic
1030181027 7:106709550-106709572 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1030958775 7:115889014-115889036 AGAGTGAGCCGAAGCAGGGTGGG + Intergenic
1031679137 7:124649478-124649500 AGAATAAGCCACAGGAGGGCAGG - Intergenic
1032130511 7:129224358-129224380 AGAAAGCGCCACAGCAAGCAAGG + Intergenic
1032468717 7:132162987-132163009 AGAGGGAGCCACAGCAGGCTGGG - Intronic
1032764315 7:134976138-134976160 AGTGTGAGCCAAAGCAGGGCGGG + Intergenic
1032848883 7:135775436-135775458 AAAATGAACCACAGCAGGAATGG - Intergenic
1033022113 7:137736113-137736135 AGAATGAACTGAAGCAGGGAAGG - Intronic
1034208992 7:149345789-149345811 AGCATGAGCCGAAGCAGGGCAGG - Intergenic
1034360816 7:150496384-150496406 AGAATGAGCTGAAGCAGGGCAGG + Intergenic
1034973227 7:155432125-155432147 AGAAGGAAGCACAGCAGGGAAGG + Intergenic
1035748201 8:1976571-1976593 AGCCTGACCCACAGCAGGGTGGG - Intronic
1036771115 8:11578922-11578944 AAACTGAGGCACAGCAGAGAGGG - Intergenic
1036804537 8:11820839-11820861 AGGGTGAGCCAAAGCAGGGCAGG - Intronic
1037545474 8:19915964-19915986 AGTGTGAGCCAAAGCAGGGCGGG - Intronic
1037642758 8:20763008-20763030 AGAATGAGACAAACTAGGGAGGG - Intergenic
1037654835 8:20873935-20873957 TGAATGTGCCACAGGAGGCATGG + Intergenic
1037735932 8:21566210-21566232 AGAAAGAGTCACAGAAGGAAGGG + Intergenic
1039624383 8:39032641-39032663 AGGGTGAGCCAAAGCAGGGCGGG - Intronic
1039923553 8:41909367-41909389 AGTATGAGCCCCAGGAGGGTAGG + Intergenic
1040554938 8:48469985-48470007 TGAGTGGCCCACAGCAGGGAAGG + Intergenic
1041143481 8:54846802-54846824 AGAATGAGACACCTCAGGGAAGG - Intergenic
1041275414 8:56152125-56152147 ACCATGAGCCAAAGCAGGGCAGG - Intergenic
1041423485 8:57695006-57695028 AGGGTGAGCCAAAGCAGGGTCGG + Intergenic
1041621231 8:59971952-59971974 AGAAACTGCCAAAGCAGGGAAGG + Intergenic
1041987323 8:63938396-63938418 ACAAAGAGCTCCAGCAGGGATGG - Intergenic
1042096474 8:65221438-65221460 AGAATGAGGCAAGGAAGGGAGGG + Intergenic
1042645325 8:70980232-70980254 AGGGTGAGCCAAAGCAGGGCGGG - Intergenic
1042812986 8:72846240-72846262 AGGGTGAGCCAAAGCAGGGTGGG - Intronic
1042942131 8:74118404-74118426 AGATTGCGCCACTGGAGGGAGGG - Intergenic
1043089225 8:75876295-75876317 AGGATGAGCCGAAGCAGGGCAGG - Intergenic
1043388660 8:79770272-79770294 GAAATGAGCCAAAGCAGGAAAGG - Intergenic
1044007860 8:86960161-86960183 AGTGTGAGCCAAAGCAGGGTGGG + Intronic
1044030640 8:87231335-87231357 AGAATGAGACAGAGAGGGGAGGG + Intronic
1044113235 8:88302862-88302884 AGAATGAAGAAAAGCAGGGAGGG + Intronic
1044131012 8:88525033-88525055 AGGATGAGCCAAAGCAAGGTGGG + Intergenic
1044889082 8:96813258-96813280 AGAATAAGCCAAGGCTGGGAGGG + Intronic
1045949370 8:107834100-107834122 AGGGTGAGCCAAAGCAGGGCAGG + Intergenic
1047125482 8:121954970-121954992 AGTGTGAGCCAAAGCAGGGCGGG - Intergenic
1047250021 8:123174951-123174973 AGAAAGGGCAGCAGCAGGGACGG - Intergenic
1047467287 8:125129247-125129269 AGAAGGAGCCACTGGAGGGTAGG + Intronic
1048105347 8:131402612-131402634 AGAATGTGCCACTGTAGGGCAGG - Intergenic
1048286160 8:133143260-133143282 ATAAGGAGCCACAGTAAGGAAGG - Intergenic
1048539566 8:135330610-135330632 AGAAAGAACCACAGCAAGCATGG + Intergenic
1048858410 8:138703802-138703824 AGTGTGAGCCAAAGCAGGGCAGG + Intronic
1049007584 8:139865482-139865504 AGAAAGAGCCACCCCTGGGATGG + Intronic
1049214963 8:141403292-141403314 AGCATCAGCAACACCAGGGAGGG - Intronic
1049826394 8:144671583-144671605 AGAAAGAGCCTCAGGCGGGAGGG - Intergenic
1050201419 9:3149278-3149300 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1051199356 9:14599293-14599315 AGGATGAGCCAAAGCAGGGTGGG + Intergenic
1051218867 9:14827846-14827868 TGCTTGAGCCACAGCTGGGATGG - Intronic
1051614797 9:18997116-18997138 AGGATGAGCCAAAGCAGGGCAGG + Intronic
1052125218 9:24765700-24765722 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1052170762 9:25393500-25393522 TGAATGAGGCAGAGAAGGGAGGG + Intergenic
1052382416 9:27785479-27785501 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1052395306 9:27931156-27931178 AGAATGAGCCAAATCAAGTAGGG - Intergenic
1052770460 9:32684283-32684305 AGGGTGAGCCAAAGCAGGGCAGG + Intergenic
1052799988 9:32957955-32957977 AGGGTGAGCCAAAGCAGGGCAGG + Intergenic
1052861463 9:33440371-33440393 AGAGTGAGGCAGAGCAGGGATGG + Intergenic
1053269453 9:36740118-36740140 AGAGGGAGCCACAGAAGGTAAGG - Intergenic
1053582927 9:39425792-39425814 AGCATGAGCCAAAGCAGGGCGGG + Intergenic
1053847110 9:42250657-42250679 AGCATGAGCCAAAGCAGGGCGGG + Intergenic
1054104506 9:60984535-60984557 AGCATGAGCCAAAGCAGGGCGGG + Intergenic
1054435801 9:65203865-65203887 AGGATGTGCCAGAGCAGGGCTGG - Intergenic
1054453089 9:65413637-65413659 AGCCTGAGCCAGAGCTGGGAGGG + Intergenic
1054581837 9:66922314-66922336 AGCATGAGCCAAAGCAGGGCAGG - Intronic
1055053254 9:72000462-72000484 AGGGTGAGCCAAAGCAGGGCAGG - Intergenic
1055494493 9:76841162-76841184 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
1055571687 9:77623616-77623638 AGAGTGAGCCAAAGCAGGGTGGG + Intronic
1055614209 9:78054369-78054391 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1055934044 9:81588673-81588695 AGTGTAAGCCCCAGCAGGGACGG + Intronic
1056494264 9:87140699-87140721 AGCAGGAGCCACAGCAGGCTAGG + Intergenic
1056653403 9:88488604-88488626 AGAATGAGTGGTAGCAGGGAAGG + Intergenic
1056750243 9:89345386-89345408 TGAATGAGCCAAAGCAGAGCGGG + Intronic
1056840852 9:89997019-89997041 AGAATGAGTCACAGAATGCAGGG + Intergenic
1056899292 9:90583520-90583542 GTAATGAGCCCCACCAGGGATGG + Intergenic
1057257067 9:93558378-93558400 TGAATGACCCACTGCAGGGAGGG + Intronic
1059699161 9:116758564-116758586 AGATTGTGCCACAGCTGAGAGGG + Intronic
1059794084 9:117672449-117672471 AGAATAAACCACAGGAAGGATGG - Intergenic
1060152741 9:121299284-121299306 AGCATGCGCCGCAGCAGGGCAGG - Intronic
1061119181 9:128632771-128632793 AGCAAGAGCCTGAGCAGGGAGGG - Intronic
1062136921 9:134934004-134934026 AGAGTGAGCCACGGAAGGCAGGG + Intergenic
1062328128 9:136022521-136022543 GGAAGGGGCAACAGCAGGGAAGG - Intronic
1062387101 9:136317001-136317023 AGGAGGACACACAGCAGGGAAGG + Intergenic
1186144849 X:6614577-6614599 AGAAAGAATCACAGCAGGGAAGG - Intergenic
1186961033 X:14736532-14736554 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1187164964 X:16796534-16796556 TGAATGAGCCAGAGCAATGAAGG + Intronic
1187631886 X:21182349-21182371 AGACTGACACACAGCAAGGATGG - Intergenic
1187729487 X:22238281-22238303 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
1187892797 X:23953009-23953031 AGTATGTGTCACAGCAGGGTAGG - Intergenic
1188017673 X:25123000-25123022 AGTGTGAGCCAAAGCAGGGCAGG - Intergenic
1188084079 X:25882386-25882408 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1188893379 X:35636657-35636679 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1189017724 X:37301549-37301571 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1189099674 X:38175671-38175693 AGTATTAGCCAGACCAGGGACGG - Intronic
1189189555 X:39088651-39088673 AGAGGGAGCCAAAGCAGGGTGGG + Intergenic
1189243267 X:39542005-39542027 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1189713509 X:43840636-43840658 AGGATGAGCCTAAGCAGGGTGGG + Intronic
1189952705 X:46248770-46248792 AAAATGGTCCAAAGCAGGGAGGG - Intergenic
1190113213 X:47608623-47608645 AGAGGGAGCAACAGGAGGGAGGG + Intronic
1191099059 X:56705250-56705272 AGGGTGAGCCAGAGCAGGGTGGG - Intergenic
1191168618 X:57418524-57418546 AGGATGAGCCAAAGCAGGGTGGG - Intronic
1191197855 X:57744143-57744165 AGGGTGAGCCAAAGCAGGGCAGG + Intergenic
1191222268 X:58002558-58002580 AGTGTGAGCCAAAGCAGGGTGGG + Intergenic
1191610136 X:63103064-63103086 AGTTTGAGCCAAAGCAGGGTGGG + Intergenic
1191745095 X:64477922-64477944 AGGGTGAGCCAAAGCAGGGTAGG - Intergenic
1192066406 X:67889923-67889945 AGTGTGAGCCAAAGCAGGGCAGG - Intergenic
1192358070 X:70422125-70422147 AGCATCAGCATCAGCAGGGAAGG - Intergenic
1192406376 X:70890364-70890386 AGGGTGAGCCAAAGCAGGGCAGG + Intronic
1192674507 X:73182231-73182253 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1192992049 X:76471074-76471096 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1193542410 X:82788416-82788438 AGGGTGAGCCAAAGCAGAGAGGG + Intergenic
1193811312 X:86054692-86054714 AGCGTGAGCCAAAGCAGGGCAGG - Intergenic
1194021177 X:88694344-88694366 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1194098508 X:89673963-89673985 AGGACGAGCCAAAGCAGGGTGGG + Intergenic
1194961131 X:100236774-100236796 AGAATGAGCCGAAGCAGGGTGGG - Intergenic
1195519332 X:105812747-105812769 AGGGTGAGCCAAAGCAGGGAGGG - Intergenic
1195808326 X:108800973-108800995 ACAGTGAGCCAAAGCAGGGCGGG + Intergenic
1195858030 X:109351736-109351758 AGAATGAGGCATACCAGGGCAGG + Intergenic
1195932901 X:110096651-110096673 AGCATGAGCCGAAGCAGGGCAGG - Intronic
1195985491 X:110626156-110626178 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1196230235 X:113212506-113212528 AGGGTGAGCCAAAGCAGGGTGGG - Intergenic
1196257529 X:113539131-113539153 AGATTGAGAGACAGGAGGGAAGG + Intergenic
1196279919 X:113812129-113812151 AGAATGAATCAGAGAAGGGAGGG + Intergenic
1196587127 X:117443293-117443315 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1196717423 X:118824554-118824576 AGATTGCGCCACAGCGGAGAAGG - Intronic
1197489748 X:127102391-127102413 AGGATGAGCCAAAGCAGGGTGGG + Intergenic
1198858471 X:141044457-141044479 AGCATGAGCCCAAGCAGGGCAGG + Intergenic
1199354639 X:146847826-146847848 AGAAGGAACGACAACAGGGAAGG - Intergenic
1199469897 X:148182342-148182364 AGGTTGAGCCAAAGCAGGGTGGG - Intergenic
1199853026 X:151738843-151738865 TGGATGCCCCACAGCAGGGAAGG + Exonic
1200178609 X:154136669-154136691 AGGATGTGACAAAGCAGGGAGGG + Intergenic
1200269776 X:154671304-154671326 AGGGTGAGCCAAAGCAGGGCAGG - Intergenic
1200333140 X:155319404-155319426 AGGGTGAGCCAAAGCAGGGTGGG + Intronic
1200451530 Y:3335338-3335360 AGGACGAGCCAAAGCAGGGTGGG + Intergenic
1201913570 Y:19158198-19158220 AGGGTGAGCCAAAGCAGGGTGGG + Intergenic
1201992625 Y:20043695-20043717 AGGAGGAGCCAAAGCAGGGTAGG - Intergenic
1202042052 Y:20695884-20695906 AGGGTGAGCCAAAGCAGGGTTGG - Intergenic
1202064987 Y:20929622-20929644 AGTGTGAGCCAAAGCAGGGTGGG + Intergenic
1202083594 Y:21111200-21111222 AGAAAAAGTCAAAGCAGGGAGGG + Intergenic
1202301764 Y:23423183-23423205 ACACTGAGCCCCATCAGGGAGGG + Intergenic
1202569047 Y:26247415-26247437 ACACTGAGCCCCATCAGGGAGGG - Intergenic