ID: 1013607592

View in Genome Browser
Species Human (GRCh38)
Location 6:111764875-111764897
Sequence AGAGAGAATGAGCCACAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1310
Summary {0: 1, 1: 0, 2: 18, 3: 246, 4: 1045}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013607592_1013607602 11 Left 1013607592 6:111764875-111764897 CCCTGCTGTGGCTCATTCTCTCT 0: 1
1: 0
2: 18
3: 246
4: 1045
Right 1013607602 6:111764909-111764931 GCTGGCAGCTGGAGGCAGGAGGG No data
1013607592_1013607595 0 Left 1013607592 6:111764875-111764897 CCCTGCTGTGGCTCATTCTCTCT 0: 1
1: 0
2: 18
3: 246
4: 1045
Right 1013607595 6:111764898-111764920 TGTTCCCCTTTGCTGGCAGCTGG No data
1013607592_1013607596 3 Left 1013607592 6:111764875-111764897 CCCTGCTGTGGCTCATTCTCTCT 0: 1
1: 0
2: 18
3: 246
4: 1045
Right 1013607596 6:111764901-111764923 TCCCCTTTGCTGGCAGCTGGAGG 0: 1
1: 1
2: 2
3: 40
4: 288
1013607592_1013607603 22 Left 1013607592 6:111764875-111764897 CCCTGCTGTGGCTCATTCTCTCT 0: 1
1: 0
2: 18
3: 246
4: 1045
Right 1013607603 6:111764920-111764942 GAGGCAGGAGGGTGCTCTGATGG 0: 1
1: 0
2: 6
3: 58
4: 577
1013607592_1013607601 10 Left 1013607592 6:111764875-111764897 CCCTGCTGTGGCTCATTCTCTCT 0: 1
1: 0
2: 18
3: 246
4: 1045
Right 1013607601 6:111764908-111764930 TGCTGGCAGCTGGAGGCAGGAGG 0: 1
1: 1
2: 9
3: 99
4: 898
1013607592_1013607600 7 Left 1013607592 6:111764875-111764897 CCCTGCTGTGGCTCATTCTCTCT 0: 1
1: 0
2: 18
3: 246
4: 1045
Right 1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG No data
1013607592_1013607594 -7 Left 1013607592 6:111764875-111764897 CCCTGCTGTGGCTCATTCTCTCT 0: 1
1: 0
2: 18
3: 246
4: 1045
Right 1013607594 6:111764891-111764913 TCTCTCTTGTTCCCCTTTGCTGG 0: 1
1: 0
2: 2
3: 37
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013607592 Original CRISPR AGAGAGAATGAGCCACAGCA GGG (reversed) Intronic
900708981 1:4099390-4099412 AGAAAGAATGAGTGCCAGCAGGG - Intergenic
900911905 1:5602749-5602771 AGAAAGAATGAGTGCCAGCAGGG + Intergenic
901003343 1:6160050-6160072 AGAGAAGAAGAGCCACAGCCAGG + Intronic
901629706 1:10642151-10642173 AGAGAGTATGAGAGACAGGACGG + Intronic
901637299 1:10676255-10676277 AGAGGGAATGAGAAGCAGCATGG - Intronic
901785534 1:11622168-11622190 AGAGAGAATGGGTCACAGAGTGG - Intergenic
901871331 1:12140757-12140779 AGGGAGAAGGAGCCACAGCTGGG - Intronic
901923704 1:12553022-12553044 AGGGAGAAGGTGCCAGAGCAGGG - Intergenic
902096096 1:13947236-13947258 AGAGATAATGAGCAAGAGCAGGG + Intergenic
902122427 1:14178113-14178135 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
902209160 1:14892412-14892434 AGAGAGAAAGAGAGACAGCAGGG - Intronic
902546637 1:17194416-17194438 AGAGAGACAGAGACACTGCAAGG - Intergenic
902602248 1:17547952-17547974 ACATAGAAAGAGCCCCAGCAGGG - Intronic
902807099 1:18867983-18868005 AGGGAGAGTGAGCCTCAGCGAGG - Intronic
902808572 1:18875573-18875595 GGAGAGGGTGAGCCAGAGCAGGG - Intronic
902893381 1:19461357-19461379 AGAGAGAAGGAGGCAGAGCCTGG - Intronic
902912903 1:19613902-19613924 AGAGATACTGAGGCACAGAAAGG - Intronic
902943186 1:19815005-19815027 AGCCAGAATGACCCCCAGCAGGG + Exonic
903694472 1:25196958-25196980 TGAGAGAATGAGGCCCAGCGTGG + Intergenic
904174025 1:28613056-28613078 AGGGAGAATGAGCCCAGGCATGG - Intronic
904295349 1:29516694-29516716 AGAGAGGATAAGGCACAGGAAGG - Intergenic
904794143 1:33046096-33046118 AGAGAAATTGAGGCCCAGCAGGG - Intronic
905631647 1:39522092-39522114 AGAGAGGAGGAGGCACAGGATGG + Intronic
905666106 1:39764080-39764102 AGAGAGGAGGAGGCACAGGATGG - Intronic
906082674 1:43103775-43103797 AGAGAGAATGAGCGCAAGCAAGG + Intergenic
906529105 1:46512978-46513000 AGAGAGAAGGAGAAACAGAAGGG - Exonic
906589039 1:47006605-47006627 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
906663721 1:47602388-47602410 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
907161127 1:52370141-52370163 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
907875101 1:58478200-58478222 AGAGAGAGTGAGTAAGAGCAGGG - Intronic
907887873 1:58610410-58610432 AGAGAGAGTGAGCAAGAGCAGGG + Intergenic
907936792 1:59048864-59048886 ATAGGGAATGAGAGACAGCATGG + Intergenic
908263609 1:62357941-62357963 GGAGAAAATGAGCAACAGCTCGG - Intergenic
908328504 1:63047134-63047156 AAAGAGAATGGGCCCCAGCTGGG + Intergenic
908638134 1:66190805-66190827 ACCGAGTATGAGCCAAAGCAGGG - Intronic
908703431 1:66925447-66925469 AAAGAGGCGGAGCCACAGCAGGG - Intronic
909129210 1:71714154-71714176 AGAGAGAATGAGGGCCAGGAAGG + Intronic
909426164 1:75527291-75527313 AGAGAGAAAGAGAGACAGAAAGG + Intronic
909446512 1:75754783-75754805 ACAGAGCATGAGCCGAAGCAGGG + Intronic
909756922 1:79239019-79239041 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
910051954 1:82985238-82985260 AGAGAGAATGAAACGCAGGAGGG - Intergenic
910279742 1:85486070-85486092 AGAGAGCAAGAGTGACAGCAGGG - Intronic
910472780 1:87572970-87572992 AAAGAGAATGAGTGCCAGCAAGG + Intergenic
910666571 1:89731380-89731402 AGTGAGAATTAGCCAAAGAAAGG + Intronic
911228334 1:95332462-95332484 AGAGAGAATGAGTGCCAGCTGGG - Intergenic
911554929 1:99331980-99332002 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
911689765 1:100820099-100820121 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
912518766 1:110231501-110231523 AGACAGAAGGAGTCACAGCAAGG - Intronic
912544304 1:110440045-110440067 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
913284960 1:117217754-117217776 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
913548321 1:119892451-119892473 AGAGAAACTGAGGCACTGCAAGG - Intergenic
913607358 1:120478304-120478326 ATAGAGGATGAGCCAAAGCAGGG + Intergenic
914209075 1:145561835-145561857 ACGGAGGATGAGCCAAAGCAGGG - Intergenic
914267994 1:146054201-146054223 ACGGAGGATGAGCCAAAGCAGGG - Intergenic
914369100 1:147006658-147006680 ATGGAGGATGAGCCAAAGCAGGG + Intergenic
914583836 1:149043530-149043552 ATAGAGGATGAGCCAAAGCAGGG - Intronic
914873287 1:151493236-151493258 AGAGTGAATGAGCCACTGAAGGG + Intergenic
915771859 1:158433344-158433366 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
915802275 1:158807108-158807130 AGAGAGAATGAGGCTGAGGAGGG + Intergenic
915805136 1:158840388-158840410 AGAGAGAATGAGTGCTAGCAGGG + Intronic
915828193 1:159101275-159101297 AGAGAGAATGAGTGCCAGAAGGG - Intronic
915828466 1:159103183-159103205 AGACAGAATGAGTGCCAGCAGGG - Intronic
915869024 1:159538373-159538395 ATTGAGCATGAGCCAAAGCAGGG + Intergenic
915886751 1:159730593-159730615 ACAGAGCATGAGCCAAAGCAGGG + Intergenic
916358470 1:163939577-163939599 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
916603472 1:166316849-166316871 ACTGAGCATGAGCCAAAGCAGGG - Intergenic
916868707 1:168888467-168888489 AGAGGGAGTGTACCACAGCAAGG + Intergenic
917139986 1:171826323-171826345 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
917181396 1:172302049-172302071 ACAGAGGACGAGCCAAAGCAGGG + Intronic
917533944 1:175861128-175861150 AGAGAAACTGAGGCAAAGCAAGG - Intergenic
917642882 1:176999822-176999844 AGAGAGAATAAGTGCCAGCAGGG - Intronic
917914732 1:179690021-179690043 ACAGAGCATGAGCCGAAGCAGGG - Intronic
918209090 1:182335021-182335043 AGAGAGAAAGAGACAGAGGAAGG + Intergenic
918354023 1:183688463-183688485 AGAGAGAGAGAGAGACAGCAAGG + Intronic
918686489 1:187422188-187422210 AGAGAGAATGAGTGCTAGCAGGG + Intergenic
919261892 1:195207455-195207477 AGAGAGAATGAGCGCAAGCAAGG - Intergenic
919394211 1:197023899-197023921 AGAGAGAGAGAGAGACAGCAAGG - Intergenic
919940944 1:202285696-202285718 AGAGGAGATGAGACACAGCATGG - Intronic
920299617 1:204980529-204980551 AGAGAGTCTGAACCACATCATGG - Intronic
920687661 1:208121561-208121583 AGAGAGAATGAGTGCCAGTAGGG - Intronic
920704205 1:208240010-208240032 AGAGAGACAGAACCAGAGCAGGG + Intronic
920739039 1:208562720-208562742 AGAAAGAATGAGTGCCAGCAGGG + Intergenic
921288461 1:213631178-213631200 ACAGAGCATGAGCCAAAGCAGGG - Intergenic
921605539 1:217149658-217149680 AGAGAAAAACAGCCACAGAATGG + Intergenic
921640671 1:217548780-217548802 GGAGAGAATGAGTGCCAGCAGGG - Intronic
921718879 1:218448695-218448717 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
921821649 1:219623482-219623504 GCAGAGATTCAGCCACAGCAAGG + Intergenic
922470308 1:225872987-225873009 AGAGAAAAGGAGTCACAGCCAGG - Intronic
922826741 1:228526654-228526676 ACCGAGCATGAGCCAAAGCAGGG - Intergenic
923311831 1:232742982-232743004 AGAGAGAATGAGCTTGTGCAGGG - Intergenic
923410200 1:233700571-233700593 AGAGAAAATTAGAAACAGCAGGG - Intergenic
924463308 1:244278762-244278784 AGAGAGAATGAGTGCCAGTAGGG - Intergenic
924474433 1:244370966-244370988 GTAGAGGATGAGCCCCAGCAGGG + Intronic
924819941 1:247479533-247479555 ACACAGGTTGAGCCACAGCATGG + Intergenic
1063101837 10:2956906-2956928 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
1063265499 10:4444914-4444936 AGAGAGAACAAGCAAGAGCAGGG - Intergenic
1063769547 10:9182304-9182326 AGAGAGAGTGAGCAAGAGCAGGG + Intergenic
1063950802 10:11221509-11221531 AAAGAGAATGACACCCAGCACGG - Intronic
1065156984 10:22880798-22880820 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
1065649766 10:27875719-27875741 ACCGAGCATGAGCCAAAGCAGGG + Intronic
1067756270 10:49008216-49008238 ACAGAGAAGGAGCCTCTGCAGGG + Intergenic
1067816275 10:49479772-49479794 AGAGAGCAGGAGCCACAGCCCGG - Intronic
1068148724 10:53104779-53104801 AGAGAGAAAGAGACAGAGGAGGG + Intergenic
1068434239 10:56970243-56970265 AGAGAGAGCAAGCAACAGCAAGG + Intergenic
1068452519 10:57211060-57211082 AGGGAGAACGAGCAACAGCAGGG + Intergenic
1068549579 10:58391336-58391358 GGAAAGACTAAGCCACAGCAGGG - Intronic
1068614308 10:59095869-59095891 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
1068799758 10:61126869-61126891 AGAGAAAATGAACCCAAGCAGGG - Intergenic
1069349057 10:67503266-67503288 ACAGAGGGTGAGCCAAAGCAGGG - Intronic
1069418568 10:68224797-68224819 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1069803068 10:71094259-71094281 AGACAGAGTGAGCAAGAGCAGGG - Intergenic
1070032408 10:72690345-72690367 AGAGAGAAAATGGCACAGCATGG + Intergenic
1070064645 10:73021658-73021680 ATAGAGAATGAGCCAAAGCAGGG + Intronic
1070068917 10:73066807-73066829 AAAGAGAATGAGGGCCAGCAGGG - Intronic
1070217695 10:74403715-74403737 ACAGAGTGTGAGCCAAAGCAGGG - Intronic
1070346150 10:75543946-75543968 AGAAAGCACAAGCCACAGCAAGG - Intronic
1071192958 10:83123658-83123680 AGGGAAAGTGAGGCACAGCAAGG + Intergenic
1071244455 10:83747171-83747193 AGGGAGTGTGAGCCAAAGCAGGG - Intergenic
1071245162 10:83753881-83753903 AGAGAGAATGAGTGCTAGCAGGG + Intergenic
1071297372 10:84232055-84232077 AGAGAGACTGGGCTACAGCGAGG - Exonic
1071372932 10:84972110-84972132 ACAGAGTGTGAGCCAAAGCAGGG + Intergenic
1071424158 10:85531730-85531752 AGAGAGAATCAGCAAAAGTAGGG + Intergenic
1071740846 10:88356184-88356206 ACCGAGCATGAGCCAAAGCAGGG - Intronic
1071899655 10:90106649-90106671 AGAGAGAATGTGTGTCAGCAGGG - Intergenic
1071899774 10:90107838-90107860 AGAGAGAGTGAGTGTCAGCAGGG - Intergenic
1071900833 10:90119029-90119051 ACAGAGCATGAGCCAAAGCAGGG - Intergenic
1072287246 10:93927839-93927861 ACGGAGCATGAGCCAAAGCAGGG + Intronic
1072364508 10:94695656-94695678 AATGAGCATGAGCCAAAGCAGGG + Intronic
1072394771 10:95027079-95027101 ACGGAGAGTGAGCCAAAGCAGGG - Intergenic
1072735800 10:97878806-97878828 AGGGAAACTGAGGCACAGCATGG + Intronic
1073573695 10:104602645-104602667 AGGGAGATTGAGACACAGAAAGG + Intergenic
1073752223 10:106541642-106541664 ACATGGAATGAGACACAGCATGG + Intergenic
1073829256 10:107363005-107363027 AGAGGGAATGAGTGCCAGCAGGG - Intergenic
1073929130 10:108554490-108554512 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
1074017096 10:109545480-109545502 ACAGAGGGTGAGCCACAGCAGGG + Intergenic
1074017247 10:109546438-109546460 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
1074441246 10:113479136-113479158 TGATAGAATGGGCCACAGCCTGG + Intergenic
1074734787 10:116418658-116418680 AAAGAGAATGAGTGCCAGCAGGG - Intergenic
1074937102 10:118192321-118192343 TCAGAGAATGAGGCACAGCCAGG - Intergenic
1075989226 10:126819657-126819679 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1076106080 10:127824741-127824763 AGAGAGAATGAATGCCAGCAGGG + Intergenic
1076107095 10:127832261-127832283 AGGGAAAATGAGACACAGGAGGG + Intergenic
1076222691 10:128747297-128747319 AAAGCTAATGAGCCACAACAGGG - Intergenic
1076531978 10:131150923-131150945 AGAGAGAATGAGTGCCAGCAGGG + Intronic
1076585046 10:131541350-131541372 AGAGAGAGTGAGCAGGAGCAGGG + Intergenic
1076719771 10:132387975-132387997 AGAGAGCAGCAGCCGCAGCAGGG + Intergenic
1077047529 11:553005-553027 AGAAAGAAGGAGCCACCCCAGGG + Intronic
1077193199 11:1264573-1264595 AGAGAGAATGAGACCTAGCAGGG + Intergenic
1077862280 11:6193590-6193612 TGAGAGAATGAGGCACTACAGGG + Intergenic
1078158911 11:8823624-8823646 AGAGAGAATGAGTGTAAGCAGGG - Intronic
1078193075 11:9109446-9109468 AGAGAGAATGAGTACCAGCAGGG - Intronic
1078200011 11:9172609-9172631 AGAGAGAATGAGTACCAGGAGGG - Intronic
1078452041 11:11447664-11447686 AGAGAGAATGAGAGCCAGCAGGG + Intronic
1078689964 11:13569986-13570008 AGAGAGGGTGAGCCGAAGCAGGG + Intergenic
1078977671 11:16496492-16496514 ACCGAGCATGAGCCAAAGCAGGG + Intronic
1079008702 11:16811077-16811099 GGAGAAACTGAGCCACAGAATGG - Intronic
1079157865 11:17965236-17965258 AGAGAGAATGAGAGCCAGCAGGG - Intronic
1079322005 11:19458936-19458958 AGACAGCATGAGCCACAGCAGGG + Intronic
1079573536 11:21974937-21974959 AGAGAGAATGGACCAGAGAAGGG + Intergenic
1079687906 11:23384245-23384267 AGAGAGAGTTAGCAAAAGCAGGG - Intergenic
1079694566 11:23464219-23464241 AAAGAAGATGAGCCACAGCCTGG + Intergenic
1079718946 11:23786786-23786808 AGAGAGAATGAGTGTCAGCAGGG + Intergenic
1079752529 11:24217263-24217285 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
1079804453 11:24911534-24911556 AGAGAGAGTGAGTGCCAGCAGGG - Intronic
1079827356 11:25213943-25213965 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1080031416 11:27665440-27665462 ACGGAGCATGAGCCAAAGCAGGG + Intronic
1080245621 11:30176717-30176739 AGAGAGAATGAGAACCAGCAGGG + Intergenic
1080959160 11:37137700-37137722 AGAGAGAATGAGGGCCAGCAGGG + Intergenic
1081143866 11:39536781-39536803 ACAGAGAGTGAGCCAAAGCAGGG - Intergenic
1081180820 11:39984167-39984189 ACAGAGCATGAGCCAAGGCAGGG + Intergenic
1081192217 11:40117802-40117824 AGAGAAATTAAGCCACAGAAAGG - Intronic
1081220683 11:40456860-40456882 AGAGAGAAAGAGAAAGAGCATGG + Intronic
1081275364 11:41141668-41141690 AGAGAGAATGAATGCCAGCAGGG - Intronic
1081393686 11:42559984-42560006 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1081445004 11:43122692-43122714 AGGGAGAATGAGTGCCAGCAGGG - Intergenic
1081454452 11:43207199-43207221 ACCGAGCATGAGCCAAAGCAGGG - Intergenic
1081709396 11:45207216-45207238 AGTCAGAAAGAGCCACACCACGG - Intronic
1082127878 11:48453936-48453958 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
1082253233 11:50005146-50005168 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
1082617798 11:55382777-55382799 AGAGAGAATGAGTGCCAGGAGGG - Intergenic
1082621186 11:55424215-55424237 AGAGAGAATAAGTGCCAGCAGGG - Intergenic
1082809192 11:57468303-57468325 AGAGAGAGAGAGGAACAGCAAGG - Intronic
1082966579 11:58972430-58972452 ACCGAGCATGAGCCAAAGCAGGG + Intronic
1083014407 11:59438023-59438045 AGAGAGAGAGAGCAACAGAAAGG - Intergenic
1084669591 11:70597229-70597251 AGAGAGAATGAGGGACAGGGAGG - Intronic
1084719987 11:70899311-70899333 AGAGAGAATGAGTGTCAGCAGGG - Intronic
1085533216 11:77203662-77203684 AGAGAGAGGGAGCAGCAGCAAGG + Intronic
1085824467 11:79829561-79829583 AGAGAAAATAAGGCAAAGCAGGG - Intergenic
1085827574 11:79864546-79864568 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
1085884368 11:80505394-80505416 ATGGAGGATGAGCCAAAGCAGGG + Intergenic
1085969831 11:81574471-81574493 AGAGAGAATGAATGCCAGCAGGG - Intergenic
1086424337 11:86669511-86669533 AGAGAGAATGAGCGCTAGCAGGG + Intronic
1086534583 11:87829503-87829525 AGAGAGAGTGACCAAGAGCAGGG + Intergenic
1086612914 11:88778428-88778450 ACAGAGGGTGAGCCAAAGCAGGG - Intronic
1086837004 11:91637426-91637448 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1087670466 11:101100279-101100301 AGAGAGAATGAGTGCCAGTAGGG - Intronic
1087793780 11:102433844-102433866 AGAGAGAATGAGTGCCAGCAGGG - Intronic
1087877615 11:103376116-103376138 AGAGAGAATGAGTGCCAGCAGGG - Intronic
1087989346 11:104729175-104729197 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1088144095 11:106653206-106653228 AGAGAGAATGAATGCCAGCAGGG - Intergenic
1088309057 11:108440994-108441016 AAGGAGCATGAGCCAAAGCAGGG + Intronic
1088341734 11:108776360-108776382 AAACAGAGTGAGCCACAGAAAGG - Intronic
1088447108 11:109943350-109943372 AGAGAGAAATAGCAGCAGCAAGG + Intergenic
1088533502 11:110836065-110836087 AGAGAGGATGAGTGCCAGCAGGG - Intergenic
1088551251 11:111014440-111014462 ACAGAGAAGGAGGCACTGCATGG + Intergenic
1089037702 11:115412639-115412661 AGAGATAATAATCCACAGGAGGG + Intronic
1089151718 11:116369553-116369575 AGAGAGAGGGAGCCACAGAAAGG + Intergenic
1089192812 11:116666860-116666882 ATGGAGCATGAGCCAAAGCAGGG + Intergenic
1089616431 11:119697314-119697336 AGAGATGAAGAGACACAGCAGGG - Intronic
1089655077 11:119941278-119941300 AGAAAGGAGGATCCACAGCAGGG - Intergenic
1089696716 11:120220388-120220410 AGGGTGAATGAACAACAGCATGG - Intronic
1090047922 11:123352146-123352168 AGAAAGAAAAGGCCACAGCAAGG - Intergenic
1090126466 11:124090449-124090471 AGAGAGAATGAGAGAGAGAAGGG + Intergenic
1090166952 11:124559670-124559692 AGCGAGAATGAGTGCCAGCAGGG + Intergenic
1090321048 11:125844255-125844277 ACAGAGAGTGAGCAAAAGCAGGG + Intergenic
1090322249 11:125857504-125857526 ATGGAGCATGAGCCAAAGCAGGG + Intergenic
1090356545 11:126144297-126144319 AGGGAGAAGGAGGCACATCATGG + Intergenic
1090531998 11:127600606-127600628 AGAGAGAATGAGACCAGGCACGG - Intergenic
1090543933 11:127740514-127740536 GGAGAGAATGAGTGCCAGCAGGG - Intergenic
1090896199 11:130977386-130977408 ACAGAGAGAGAGCCAAAGCAGGG - Intergenic
1091148462 11:133302325-133302347 AGAGAGAATGAGAGCCGGCAGGG - Intronic
1091547977 12:1517204-1517226 AGAGAGAATGATCCACTCCTGGG - Intergenic
1091709413 12:2727269-2727291 AGAGAGGAAGAACCACATCATGG - Intergenic
1092181594 12:6450506-6450528 AGACAGAATGAGTAGCAGCAGGG - Intronic
1092604346 12:10102197-10102219 AGGGAGAGTGTGCCACATCAAGG + Intronic
1093092427 12:14936730-14936752 AGAGAGAATGAGCACAAGCAGGG - Intronic
1093672901 12:21899484-21899506 ACCGAGCATGAGCCAAAGCAGGG + Intronic
1093786305 12:23195561-23195583 GAAGAGAATGAGTCATAGCAAGG + Intergenic
1094236870 12:28177989-28178011 AGAGAGAATGAGCAAGAGCAGGG - Intronic
1095051245 12:37556116-37556138 AGAGAGAAAGAGACAGAGAAAGG + Intergenic
1095492816 12:42753069-42753091 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
1095576346 12:43744428-43744450 AGAGAGAATGAATGCCAGCAGGG - Intronic
1095706490 12:45242548-45242570 ACAGAGGGTGAGCCAAAGCAGGG - Intronic
1095805354 12:46313016-46313038 ACTGAGCATGAGCCAAAGCAGGG - Intergenic
1096044945 12:48554169-48554191 ACAGAGCATGAGCCAAAGCAGGG - Intergenic
1096565966 12:52479498-52479520 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
1096579629 12:52576315-52576337 AGAGAAAATCAGCCACAGCAAGG + Intergenic
1096976121 12:55700048-55700070 AGGGAGACAGAGCCACAGAAAGG + Intronic
1097158907 12:57031866-57031888 AGAGAGAAGGAGGAAGAGCATGG - Intronic
1097159377 12:57035580-57035602 AGAGAGAAGGAGGAAGAGCATGG - Intronic
1097364891 12:58701472-58701494 ACAGAGGGTGAGCCAAAGCAGGG + Intronic
1097774291 12:63628240-63628262 ACCGAGCATGAGCCAAAGCAGGG + Intronic
1097917517 12:65036422-65036444 ACAGAGCATGAGCCAAAGCAGGG - Intergenic
1098130929 12:67348931-67348953 AGAGAAGATGAGCCAAAGGAAGG - Intergenic
1098638554 12:72813536-72813558 AAGGAGCATGAGCCAAAGCAGGG - Intergenic
1098642675 12:72857393-72857415 ACCGAGCATGAGCCAAAGCAGGG - Intergenic
1098730113 12:74025132-74025154 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1098768332 12:74518470-74518492 AGATAGAATAAGCCATACCATGG + Intergenic
1099141256 12:78978415-78978437 TGAAAGAATGAGACACAGCATGG - Intronic
1099740331 12:86626887-86626909 ACAGAGGGTGAGCCAAAGCAGGG + Intronic
1099806852 12:87531125-87531147 AGGGAGCATGAGCCAAAGCAGGG + Intergenic
1099838631 12:87938190-87938212 AGAGAGAATGAGTGCCAGCAAGG - Intergenic
1099840164 12:87954895-87954917 AGAGAGAATGAGTACAAGCAGGG - Intergenic
1099965482 12:89440792-89440814 ACAGAGCATGAGCCGAAGCAGGG + Intronic
1100235261 12:92654424-92654446 AAAGAGAATGAGTGCCAGCAGGG + Intergenic
1100563788 12:95775355-95775377 ACTGAGCATGAGCCAAAGCAGGG + Intronic
1100999704 12:100345151-100345173 CGAGGGAATGGGCCACAGAATGG - Intergenic
1101010322 12:100443050-100443072 AGAGAGAAAGAGACAAAGGAAGG - Intergenic
1101012733 12:100467698-100467720 AGAGAGAAAGAGAAAGAGCATGG - Intergenic
1101308223 12:103552893-103552915 AGAGAGAACAAGCAAGAGCAGGG + Intergenic
1101339608 12:103831253-103831275 AGAGAGAATGAGTGCCAGCAGGG - Intronic
1101581273 12:106043299-106043321 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
1101645426 12:106627006-106627028 AGAGGGAACGGGACACAGCATGG - Intronic
1102437817 12:112938913-112938935 AGAGAAAATGAGGCACAGAGAGG + Intronic
1103203663 12:119110793-119110815 ACGGAGCATGAGCCAAAGCAGGG - Intronic
1103431589 12:120892402-120892424 AGAAAGAAGGCTCCACAGCAAGG + Intronic
1104130000 12:125884360-125884382 AGAGAGAATGAGTGCCAGCTGGG - Intergenic
1104610763 12:130225913-130225935 ACAAAGAAAGAGCAACAGCAGGG + Intergenic
1104746370 12:131213520-131213542 AGAGAGAATGAGCACCAGCAGGG + Intergenic
1105063107 12:133172238-133172260 AGGGAAAATGAACCACAGAAAGG - Intronic
1105608316 13:21945598-21945620 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1105809844 13:23985416-23985438 AGAGGAAAGAAGCCACAGCAGGG - Intronic
1106243837 13:27930029-27930051 AGAGAGAATGAGACAGAGAATGG - Intergenic
1106426677 13:29636958-29636980 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
1106497022 13:30287384-30287406 AGAGAGAATGAATGCCAGCAGGG - Intronic
1106838492 13:33661616-33661638 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
1107240669 13:38230774-38230796 ACAGAGAATGAAGCAAAGCAGGG + Intergenic
1107541911 13:41396681-41396703 AGAGAGAAAGAGAGAAAGCAAGG + Intergenic
1108106544 13:47016764-47016786 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1108587740 13:51885402-51885424 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
1108818811 13:54321097-54321119 AGAGGGAGTGCACCACAGCAAGG + Intergenic
1109363206 13:61323719-61323741 ACAGAGTGTGAGCCAAAGCAGGG + Intergenic
1109467214 13:62751433-62751455 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1110169140 13:72479612-72479634 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
1110359543 13:74609826-74609848 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1110401208 13:75093887-75093909 AGAGAGAATGAGAGCCAGCAGGG - Intergenic
1110546944 13:76766232-76766254 AGAGAGGAGAAGCCACACCATGG - Intergenic
1110897484 13:80773088-80773110 AGAGAGGATCAACAACAGCAGGG - Intergenic
1111071238 13:83171319-83171341 ATGGAGCATGAGCCAAAGCAGGG + Intergenic
1111107935 13:83670189-83670211 AGAGAGAAGGAGTGCCAGCAGGG - Intergenic
1111199842 13:84920175-84920197 AGAGAGAATGAGTACAAGCAGGG - Intergenic
1111400095 13:87722675-87722697 AGAGATAATGAGTAGCAGCAAGG + Intergenic
1111414182 13:87917447-87917469 AGAGAGAATGAATGCCAGCAGGG - Intergenic
1111457610 13:88505574-88505596 AGAGAGAATGAGTATCAGCAGGG - Intergenic
1111687613 13:91520475-91520497 AGAGAGAATGAGGTTCAACAAGG + Intronic
1112554617 13:100455308-100455330 GGAGAGAATGAGTGACAGAATGG - Intronic
1113205645 13:107912916-107912938 AGAGGGAATGAGAGTCAGCAGGG - Intergenic
1113284815 13:108835304-108835326 AGAGAGAATGAGTGCCAGCAGGG - Intronic
1113341295 13:109428713-109428735 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1113542406 13:111119145-111119167 ACAGAGAAGAAACCACAGCACGG - Intronic
1113556380 13:111239019-111239041 AGAGAGAATGAGTGCCAACAGGG + Intronic
1113559426 13:111266254-111266276 ACCGAGAATGAGGAACAGCATGG - Intronic
1113667861 13:112153484-112153506 AGAGAGATGGAGCCTCAGCTTGG + Intergenic
1114147304 14:19992973-19992995 AGAGAGAGTGAGTGCCAGCAGGG + Intergenic
1114147639 14:19995389-19995411 AGAGAGAATGAGTACCAGTAGGG + Intergenic
1114584591 14:23799001-23799023 AGAGAGAATGAATAAAAGCATGG - Intergenic
1114646987 14:24261364-24261386 AGAGAGAACCAGCCACATCCTGG + Intronic
1114961237 14:27892577-27892599 AGAGAAAATGAGCACAAGCATGG + Intergenic
1115307110 14:31944611-31944633 AGAGAGTAAGAGCCACACCCAGG - Intergenic
1115511183 14:34139483-34139505 ACAGAGGGTGAGCCAAAGCAGGG + Intronic
1115630858 14:35243730-35243752 GGGGAAACTGAGCCACAGCAAGG - Intronic
1115792789 14:36898501-36898523 ACTGAGAGTGAGCCAAAGCAGGG - Intronic
1115888039 14:37995350-37995372 AGACAGAATGAGAAAAAGCATGG - Intronic
1115959869 14:38823505-38823527 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1116267496 14:42712498-42712520 AGAGAGAATGAGGGCCAGCAGGG + Intergenic
1116272065 14:42785259-42785281 AGAGAGAATGAGTGCCAGTAGGG - Intergenic
1116332982 14:43618307-43618329 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1116511965 14:45757054-45757076 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
1117664398 14:58041136-58041158 ACTGAGCATGAGCCAAAGCAGGG + Intronic
1117994781 14:61468269-61468291 ATAGAAAATGAGCCAGAACATGG + Intronic
1118212459 14:63778213-63778235 AGAGGGCATGAGCAAGAGCAGGG - Intergenic
1118497924 14:66327336-66327358 AGAGACAATGAGGGACAGTAAGG + Intergenic
1119273575 14:73331762-73331784 AGAGAGAATGAGAGCCAGCAAGG - Intronic
1119586361 14:75839557-75839579 AGAGAGAATGAGTGCCAGCAGGG + Intronic
1120272716 14:82335018-82335040 AGAGAGAGTGGGCAAGAGCAGGG + Intergenic
1120279684 14:82423063-82423085 AGAGAGAATGAGTTCCAGCAGGG + Intergenic
1120334960 14:83142964-83142986 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
1120373594 14:83671007-83671029 AGAGGGAATGAGTGCCAGCAGGG + Intergenic
1120971715 14:90213479-90213501 AGTGTGAAGGAGCCCCAGCAGGG - Intergenic
1121488296 14:94338400-94338422 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
1121893431 14:97621291-97621313 AGAGAGAATGAAAGACAACAGGG - Intergenic
1122357160 14:101130464-101130486 AGAGAGAATGAGAGAGAGAATGG + Intergenic
1122477190 14:102018534-102018556 GGATGGAATGAGCCTCAGCATGG - Exonic
1122477287 14:102019380-102019402 AGAGCGAGGGAGACACAGCAGGG - Intronic
1123420117 15:20124613-20124635 TGAGAGCATGAGAGACAGCAGGG - Intergenic
1123445745 15:20328919-20328941 TGAGAGCATGAGAGACAGCAGGG + Intergenic
1123529341 15:21131149-21131171 TGAGAGCATGAGAGACAGCAGGG - Intergenic
1123576719 15:21676795-21676817 ACGGAGGATGAGCCAAAGCAGGG - Intergenic
1123613341 15:22119263-22119285 ACGGAGGATGAGCCAAAGCAGGG - Intergenic
1123628635 15:22245346-22245368 AGAGAGAAAGAGTGCCAGCAGGG - Intergenic
1123776363 15:23584490-23584512 AGAGAGAAGGATCGACAACAGGG - Intronic
1124013250 15:25856304-25856326 AGAGAGAATGAGTGCAAGCAGGG - Intronic
1124036763 15:26060414-26060436 AGAGAGAATGAGTGCTAGCAGGG - Intergenic
1124125612 15:26936103-26936125 AGAGAGAATGAGTGCGAGCAGGG - Intronic
1124210141 15:27756322-27756344 ACTCAGAAAGAGCCACAGCAAGG + Intronic
1125209614 15:37197891-37197913 AGAGAGAGTGAGTGCCAGCAAGG + Intergenic
1125288431 15:38119564-38119586 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
1125421331 15:39507633-39507655 ACAGAGAATACTCCACAGCAGGG + Intergenic
1125525681 15:40372725-40372747 AGGGACAATGAGCCACAGGGAGG + Intergenic
1125909313 15:43421815-43421837 AGAGAGAGAGAGCCACAGCAGGG - Intronic
1125971238 15:43913411-43913433 AGAGAGAATGAGCTGCACCAGGG + Intronic
1125973888 15:43934317-43934339 AGAGAAACTGAGGCACAGAAAGG - Intronic
1126064190 15:44812544-44812566 AAAGAGGATGAGCCACTGCAGGG - Intergenic
1127057103 15:55143340-55143362 AGCAAGCATGAGCCAAAGCAGGG + Intergenic
1127373639 15:58362740-58362762 ACGGAGAGTGAGCCAAAGCAGGG + Intronic
1127527017 15:59803513-59803535 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
1127656879 15:61063966-61063988 AGCGAGAAAGAGCCCCGGCAAGG - Intronic
1128869012 15:71138228-71138250 AGAGAGAACAAGCAAGAGCAGGG + Intronic
1129542556 15:76362710-76362732 AGAGAGAAAGAGAGAGAGCAAGG - Intronic
1130026986 15:80278527-80278549 TGAGAGAAAGAGGCAAAGCAAGG + Intergenic
1130210500 15:81917644-81917666 AGAGAGAATGAGTACCAACAGGG - Intergenic
1130572287 15:85057506-85057528 ATGGAGCATGAGCCAGAGCAGGG - Intronic
1130778125 15:87006659-87006681 ACAAAGCATGAGCCAAAGCAGGG - Intronic
1130798453 15:87235716-87235738 ACCGAGCATGAGCCAAAGCAGGG - Intergenic
1131558427 15:93418887-93418909 AGAGAGAACGAGTACCAGCAGGG - Intergenic
1131589318 15:93731184-93731206 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
1131705903 15:94995772-94995794 AGAGTGAATGAGTCTTAGCATGG + Intergenic
1131921568 15:97333767-97333789 AGAGAGAATGAGTGTCAGCAGGG - Intergenic
1132061294 15:98694375-98694397 AGAGAAGATGAGCCATAGGAAGG + Intronic
1132281212 15:100617489-100617511 AGAGAGAAGCAGGCAGAGCAAGG - Intronic
1132311883 15:100863196-100863218 AGAGAGGCTGAGCCAGAGCTGGG - Intergenic
1132421750 15:101676008-101676030 AGTGAGACTGAGCTGCAGCAGGG + Intronic
1202985587 15_KI270727v1_random:411040-411062 ACGGAGGATGAGCCAAAGCAGGG - Intergenic
1134452159 16:14370244-14370266 AGAGGGAGTGAGCCAGAGCCTGG + Intergenic
1134593644 16:15477232-15477254 AGAGAGAATGAGTGCAAGCAGGG + Intronic
1134600607 16:15530778-15530800 AGAGAGAATGAATGCCAGCAGGG - Intronic
1134751910 16:16631860-16631882 AGAGAGAATGAGCAGGAGCAGGG - Intergenic
1134754829 16:16657819-16657841 AGAGAGAAAGAGAGACAGAAAGG - Intergenic
1134871759 16:17658250-17658272 AGAGAGTGTGAGCAAGAGCAGGG + Intergenic
1134993560 16:18721843-18721865 AGAGAGAATGAGCAGGAGCAGGG + Intergenic
1135544813 16:23358447-23358469 AGGGAAACTGAGGCACAGCAAGG - Intronic
1135812884 16:25605679-25605701 AGAGAGAATGAGTGTAAGCAGGG - Intergenic
1136251780 16:29009947-29009969 AGGGAGACTGAGGCACAGAAAGG + Intergenic
1136600604 16:31284693-31284715 ACAGAGTATGAGCCAAAGCAGGG - Intronic
1136720999 16:32319689-32319711 TGAGAGCATGAGAGACAGCAGGG - Intergenic
1136727642 16:32373664-32373686 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
1136839384 16:33525975-33525997 TGAGAGCATGAGAGACAGCAGGG - Intergenic
1137027014 16:35486525-35486547 AGAGAGAATGGGCCAGAAGAGGG - Intergenic
1137033221 16:35544065-35544087 AGAGAGAATGGGCCATAAAAGGG - Intergenic
1137877766 16:52013580-52013602 AGTGAGCATGAGCCGAAGCAGGG - Intronic
1137907023 16:52333566-52333588 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
1138183827 16:54961581-54961603 AGAGAGACAGAGCCACAGAGAGG - Intergenic
1138552725 16:57756289-57756311 AGACAGAAAGAGAAACAGCAAGG - Intronic
1138722293 16:59096579-59096601 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
1138785126 16:59836668-59836690 ACCGAGCATGAGCCAAAGCAGGG - Intergenic
1139297291 16:65912833-65912855 AGAGAGATTGAGAAACACCATGG - Intergenic
1139370659 16:66467413-66467435 AGAGAGAATGAGTACAAGCAGGG + Intronic
1139706352 16:68743270-68743292 AGAAAGAAAGAGACCCAGCAAGG - Intronic
1140132353 16:72174705-72174727 AGAGAGAATGAGTGCCAGCATGG + Intronic
1140179142 16:72696345-72696367 ACCGAGCATGAGCCAAAGCAGGG - Intergenic
1140492959 16:75355756-75355778 AGAGAGAATGAGTGCAAGCAGGG - Intronic
1140908769 16:79432201-79432223 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1140997166 16:80272256-80272278 AGAGAGAATGAGAGCCAGGAGGG + Intergenic
1141246192 16:82309714-82309736 ACAGATAGTGAGCCAAAGCAGGG - Intergenic
1141366650 16:83449827-83449849 AGAGAAAATGAGCTAATGCAAGG + Intronic
1141550855 16:84805833-84805855 AGAGAGACTGAGGCTGAGCATGG + Intergenic
1141636702 16:85317727-85317749 AAAGCGAATGAGCCAGCGCAGGG - Intergenic
1141777908 16:86136527-86136549 GGAGAGAACCAGCCACAGGAGGG + Intergenic
1202998790 16_KI270728v1_random:144086-144108 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
1203005433 16_KI270728v1_random:198081-198103 TGAGAGCATGAGAGACAGCAGGG + Intergenic
1203130389 16_KI270728v1_random:1680494-1680516 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
1203136983 16_KI270728v1_random:1734202-1734224 TGAGAGCATGAGAGACAGCAGGG + Intergenic
1203149549 16_KI270728v1_random:1826260-1826282 TGAGAGCATGAGAGACAGCAGGG - Intergenic
1142489019 17:265993-266015 AGAGGGTCTGAGCCACACCAGGG + Intronic
1143238230 17:5421304-5421326 GGAGAGAATGAGAAACAGCCGGG + Exonic
1144351791 17:14403600-14403622 CGAGAGAAAGAGAGACAGCAAGG - Intergenic
1144575947 17:16429609-16429631 AGAATGATTCAGCCACAGCAGGG + Intronic
1145118222 17:20231883-20231905 AGAGAGAGTGATCCACACCTCGG - Intronic
1145371880 17:22313053-22313075 AGAGAGAAAGAGACAGAGAAAGG + Intergenic
1146157436 17:30535791-30535813 TGAGAACATGAGCCCCAGCAGGG - Intergenic
1146460535 17:33042737-33042759 AGAAAGAATATACCACAGCAGGG + Intronic
1146561869 17:33877292-33877314 ACCGAGCATGAGCCAAAGCAGGG + Intronic
1146686911 17:34847251-34847273 AGAGAGGCTGAGCCCCAGCAAGG + Intergenic
1146936369 17:36814869-36814891 AGAGAGAATGAGAAAGAGGAAGG - Intergenic
1147141182 17:38461411-38461433 GGGGAGCAAGAGCCACAGCAAGG - Intronic
1147429018 17:40360267-40360289 AGAGAGACTGAGCCAGAGGAAGG + Intergenic
1147527493 17:41240090-41240112 ACTGAGCATGAGCCAAAGCAGGG + Intronic
1147586858 17:41657849-41657871 AGAGAGAGAGAGAGACAGCAGGG + Intergenic
1147646229 17:42035870-42035892 AGAGAGTGAGAGCCACAGCCAGG + Intronic
1149145097 17:53480846-53480868 GGAGAGAATGAGTGCCAGCAGGG - Intergenic
1149225570 17:54465904-54465926 AAGGAGAGTGAGCCAAAGCAGGG - Intergenic
1149392980 17:56210775-56210797 AGAGAGAATGAGAGCCAGCAAGG + Intronic
1149546289 17:57506214-57506236 AAAGAGAAAGAGCCGGAGCAGGG - Intronic
1149608750 17:57943449-57943471 ATGGGGAATGAGCCACAGCGTGG - Intronic
1149635770 17:58168126-58168148 AGAGAGATTGAGACAGGGCAGGG + Intergenic
1149999961 17:61428108-61428130 AGAGAGAATGAGTATAAGCAGGG - Intergenic
1150203160 17:63377892-63377914 AGAGAGAATGAGTGCCAGCCAGG + Intronic
1150204391 17:63391080-63391102 TGAGAGAATGAGCAACACCGTGG - Intronic
1150472299 17:65447408-65447430 AGAGAGATAGGGCCACAGGATGG + Intergenic
1150882444 17:69045730-69045752 AGAGAGAATGAGTGCAAGCAGGG + Intronic
1151086486 17:71387080-71387102 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1151189954 17:72391068-72391090 AGAGAGAATGAGAGCCAGCAGGG + Intergenic
1151265338 17:72950964-72950986 ACAGAGAATGAGCCAGGGCCAGG + Intronic
1151291325 17:73152392-73152414 AGAGAGAATGAGGTTCAGCAGGG - Intergenic
1152254800 17:79232017-79232039 AGACAGAATGAGCGCAAGCAGGG + Intronic
1152975885 18:217907-217929 GGAGAGTATGAGCCAGACCAAGG + Intronic
1153135297 18:1911035-1911057 ACAGAGCATGAGCCGAAGCAGGG + Intergenic
1153165607 18:2258370-2258392 AGAGAGAAAGAGCAAGAGCAAGG + Intergenic
1153695436 18:7636013-7636035 GGAGAGAATGAGAGACTGCAGGG + Intronic
1154315938 18:13303429-13303451 AGAGAGAAAGAGCGAGAGAAAGG - Intronic
1155327431 18:24679008-24679030 AGAGAGAAAGACACATAGCAGGG - Intergenic
1155340932 18:24813525-24813547 AGTGAGATTGAGCCATAACATGG + Intergenic
1155356357 18:24957650-24957672 AGTGAGAATGAGTGCCAGCAGGG + Intergenic
1155364187 18:25033876-25033898 AGAGAGAGAGAACCACAACATGG + Intergenic
1156434419 18:37111695-37111717 TGGGAGTATGAGCCAAAGCAGGG + Intronic
1156796704 18:41054600-41054622 AGAGTGAACCAGCCACATCAAGG + Intergenic
1157695191 18:49716751-49716773 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
1157920177 18:51706548-51706570 ATCGAGCATGAGCCAAAGCAGGG - Intergenic
1158206742 18:55001425-55001447 AGAGAGCTGGAGCCTCAGCAGGG + Intergenic
1158620639 18:59029796-59029818 AGGGAGGATGAGACCCAGCAAGG - Intergenic
1158728121 18:59993339-59993361 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1158799346 18:60888159-60888181 AGAGAGAATGAATGCCAGCAGGG + Intergenic
1158975607 18:62708726-62708748 AGTGAGCATCACCCACAGCAAGG - Intergenic
1159003786 18:62995170-62995192 AGCGAGAATGAGCGCCAGCAGGG - Intergenic
1159115448 18:64107958-64107980 GGAGAGAATGAGCACAAGCAGGG + Intergenic
1159349890 18:67258864-67258886 AGAGAGAATGAGCCTATTCAGGG - Intergenic
1159375259 18:67584687-67584709 AGAGAGAATGAGTGCCATCAAGG - Intergenic
1159436850 18:68429270-68429292 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
1159603588 18:70452212-70452234 AGAGAGGATGAGTGCCAGCAGGG + Intergenic
1160291671 18:77600336-77600358 AGAGAGAATGAGTGCCAGCAAGG + Intergenic
1160302877 18:77702199-77702221 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
1160469029 18:79109946-79109968 TCAGAGAATGAGCCACATCCTGG + Intronic
1161491765 19:4566263-4566285 AGAGAAACTGAGGCACAGAAAGG + Intergenic
1162152437 19:8655828-8655850 AGAGAGAAAGAGACACAGCATGG - Intergenic
1162217929 19:9151814-9151836 AAAGTGAATGAGACACAGAATGG - Intronic
1163157343 19:15446634-15446656 AGGGACAATGAGCCAGACCAAGG - Intronic
1163597497 19:18228701-18228723 ATGGAGAAAGAGTCACAGCAAGG + Intronic
1164265554 19:23613571-23613593 ACTGAGCATGAGCCAAAGCAGGG + Intronic
1164568323 19:29348509-29348531 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
1164569795 19:29365303-29365325 AGAGAGAATGAGGGAGAGAAAGG - Intergenic
1164908582 19:31987229-31987251 AAAGAAAATGAGACAAAGCAAGG + Intergenic
1164989272 19:32672999-32673021 AGACAGGAAGAGCCCCAGCAGGG + Intronic
1165198996 19:34130206-34130228 AGAGAGAATGAGAGCAAGCAGGG + Intergenic
1165345638 19:35247754-35247776 AGTGAGGAGGAGCCACAGGAGGG + Intergenic
1165386598 19:35513801-35513823 ACAGAGAGTGAGCCGCATCAGGG + Intergenic
1165849675 19:38842460-38842482 AGAGAGAAAGAGACGCAACATGG - Intronic
1165923004 19:39310428-39310450 GGATAGTGTGAGCCACAGCAAGG - Intronic
1165956748 19:39505859-39505881 AGTGAGATGGAGCCACAGGAAGG + Intronic
1166074795 19:40407802-40407824 GGAGAGAATGAGGCACAGAGAGG + Intronic
1166116076 19:40655345-40655367 AGAGAAACTGAGCCACAGAGTGG - Intergenic
1166171808 19:41033220-41033242 ACAGAGCGTGAGCCAAAGCAGGG + Intergenic
1166942407 19:46374838-46374860 AGAGAAACTGAGCCACAGAGAGG + Intronic
1166979549 19:46624429-46624451 AGAGAGAAAGAGAAACAGGAAGG - Intronic
1167177711 19:47877130-47877152 GGAGAGGATGAGCCAGAGGAAGG + Intronic
1167454409 19:49591058-49591080 AGAGAGACTGAGCGCGAGCAGGG - Intergenic
1167682523 19:50932839-50932861 AGTGAGAATCAGCCACCGCTGGG + Intergenic
1168095677 19:54113584-54113606 AGAGTGAAGGAGCCACTGAAGGG - Intronic
1168191690 19:54742924-54742946 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168193964 19:54759556-54759578 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168196009 19:54774281-54774303 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168197906 19:54789144-54789166 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168204374 19:54838527-54838549 ACAGAGAAAGAGCCAGAGGAAGG + Intronic
1168206600 19:54854700-54854722 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168236668 19:55068026-55068048 AGAGAGAAGGAGACACAGGAGGG - Intronic
1168696530 19:58407004-58407026 AGAGAGAAAGGGACACAGCGGGG + Intronic
1202709246 1_KI270714v1_random:8045-8067 ACGGAGGATGAGCCAAAGCAGGG + Intergenic
925037131 2:696697-696719 AGAGAGGCTGAGACACAGCTGGG + Intergenic
925170789 2:1749228-1749250 ACAGAGAATGTGCCGCAGCTCGG + Intergenic
925511691 2:4634161-4634183 AGAGAGAGCGAGCAAGAGCAGGG + Intergenic
925642593 2:6000513-6000535 AAGGGGAATGAGCCACAGGAAGG - Intergenic
926059007 2:9793606-9793628 AGAGAGAGTGAGCAAAAGCAGGG - Intergenic
926147957 2:10408253-10408275 AGAGAGAGAGAGACCCAGCAGGG - Intronic
926711965 2:15889036-15889058 AGAGAGAATGTGCCACAGACTGG - Intergenic
927117067 2:19916090-19916112 AAGGAGGATGAGCCAAAGCAGGG + Intronic
927221181 2:20711555-20711577 AGGGAGGGTGAGCCAAAGCAGGG + Intronic
927357695 2:22192165-22192187 AGAGAGAATGAGTGGCAGTAGGG - Intergenic
927446961 2:23171690-23171712 AGGGAGCATGAGCCAAAGAAGGG + Intergenic
927646940 2:24883602-24883624 AGAAAGCATGAGCAAAAGCATGG - Intronic
927660908 2:24991914-24991936 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
927683406 2:25154817-25154839 AGAGAGTGAGAGACACAGCAGGG - Exonic
927880641 2:26687807-26687829 AGTGAGAGTGAGGAACAGCAGGG - Intergenic
928640805 2:33296925-33296947 AGAGAGAATGAGTTAAAGCAGGG + Intronic
928749030 2:34449670-34449692 AGAGAGAATGAGTGCCAGCCGGG - Intergenic
928836866 2:35558083-35558105 ATAGAGAATGAGCGTCAGCAGGG - Intergenic
929009367 2:37425637-37425659 AGAGAGAAGAGGCCAGAGCAGGG + Intergenic
929090025 2:38206820-38206842 AGACAGAATGAGTACCAGCAGGG - Intergenic
930258845 2:49122056-49122078 AAAGAAAATAAGCTACAGCAAGG - Intronic
930675164 2:54192823-54192845 AGAGAGAATGAGTACCAGCAGGG + Intronic
930877208 2:56232555-56232577 AGAGAGAATGAGGGCCAGCAGGG - Intronic
931004016 2:57827764-57827786 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
931437049 2:62256649-62256671 AGAGAGACCGAGCAAGAGCAGGG - Intergenic
931627886 2:64273152-64273174 AGAGAGAGAGAGAGACAGCAGGG - Intergenic
931784251 2:65604948-65604970 AGAGAGAGAGAGAGACAGCAAGG - Intergenic
932311837 2:70749148-70749170 AGAAAGAATGAGAGCCAGCAGGG + Intronic
932508855 2:72264783-72264805 AGAGAGAATGAGAGGCAGTAGGG - Intronic
932915848 2:75856777-75856799 AGAGAGAATGAGGGCAAGCAAGG - Intergenic
933221819 2:79699235-79699257 AGCGTAAATGAGCAACAGCAAGG + Intronic
933236539 2:79870733-79870755 GGAGAGAGTGAGCAAGAGCAGGG + Intronic
933464786 2:82638823-82638845 AGAGAGAATGAGTGCTAGCAGGG - Intergenic
933493327 2:83016643-83016665 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
933532701 2:83530616-83530638 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
933593836 2:84262529-84262551 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
934061394 2:88297482-88297504 AAAGAGGATGAGCCAGAGCCAGG - Intergenic
934516502 2:94991377-94991399 ACAGGGAATGTGCCACAGCAGGG + Intergenic
934855412 2:97726279-97726301 AGAGAGCAACAGCCCCAGCAGGG - Intronic
934999617 2:99000674-99000696 ACAGAGTGTGAGCCAAAGCAGGG + Intronic
935403118 2:102681136-102681158 AGAAAGGATAAGCCACAGCTTGG + Intronic
935478956 2:103561406-103561428 AGAGATAATGAGTGCCAGCAGGG + Intergenic
935556379 2:104513755-104513777 AGAGAGAGTGAGCAAGAGCAGGG - Intergenic
936148321 2:109996563-109996585 TGAGAGCATGAGAGACAGCAGGG - Intergenic
936162186 2:110092268-110092290 ACAGGGAATGTCCCACAGCATGG - Intronic
936182476 2:110279086-110279108 ACAGGGAATGTCCCACAGCATGG + Intergenic
936196356 2:110374805-110374827 TGAGAGCATGAGAGACAGCAGGG + Intergenic
936739673 2:115490289-115490311 AGAGAGAATGAGTGCCAGCAGGG + Intronic
936769611 2:115895380-115895402 ACGGAGGATGAGCCAAAGCAGGG - Intergenic
936915597 2:117636475-117636497 AGAGAGAATGAGCATGTGCAGGG - Intergenic
937151252 2:119687496-119687518 AGAGAGAATGAGTGTCAGCAGGG + Intergenic
937209140 2:120256558-120256580 AGAGAGAATGAGTGCCAGCAGGG - Intronic
937261644 2:120590392-120590414 AGACAGGATGAGCCACGACATGG - Intergenic
937423225 2:121775795-121775817 ACACAGAATGAGTCACAGAATGG - Intergenic
938168178 2:129050662-129050684 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
938579774 2:132635545-132635567 AGAGAGAAGGAGGAAAAGCAGGG + Intronic
938861135 2:135370933-135370955 AGAGAGAATGAGTGCAAGCAGGG - Intronic
939044835 2:137238030-137238052 AGAGAGAAAGGGCCATATCATGG + Intronic
939252854 2:139705424-139705446 AGAGAGAATGAATGCCAGCAGGG + Intergenic
939532309 2:143379540-143379562 AGAGAGAATCAGCTTCATCATGG + Intronic
940080614 2:149796573-149796595 ATCGAGCATGAGCCAAAGCAGGG - Intergenic
940122220 2:150279334-150279356 AGAGAGAATGAGTGCCAGCAAGG - Intergenic
940568794 2:155404370-155404392 AGAGAGATAGAGCCACTGTATGG - Intergenic
940751879 2:157635190-157635212 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
940986306 2:160055590-160055612 ATACAGAATGAACCACACCATGG + Intronic
941133816 2:161687806-161687828 AGAGAGAATGAGTGCCAGCAGGG - Intronic
941971496 2:171355935-171355957 ACGGAGCATGAGCCAAAGCAGGG - Intronic
942380380 2:175385064-175385086 AGACAGAATGAGTGCCAGCAGGG - Intergenic
942442928 2:176054791-176054813 GGAGGGAATGAGCCATAGAAAGG + Intergenic
942502001 2:176601130-176601152 AGGGAGAATAATCCACATCAAGG - Intergenic
942559718 2:177207712-177207734 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
942779882 2:179629685-179629707 ATGGAGGATGAGCCAAAGCAGGG + Intronic
942920727 2:181370339-181370361 ATAGAGAAAAAGCCACATCATGG - Intergenic
943031057 2:182686703-182686725 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
943082152 2:183268106-183268128 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
943112428 2:183622251-183622273 ATGGAGGATGAGCCAAAGCAGGG - Intergenic
943448703 2:188020939-188020961 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
943628418 2:190223928-190223950 ACAGAATATGAGCCAAAGCAGGG + Intronic
943999626 2:194816444-194816466 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
944165124 2:196710477-196710499 ACAGAGGGTGAGCCAAAGCAGGG - Intronic
944196747 2:197062505-197062527 ACAGAGCATGAGCCCAAGCAGGG + Intronic
944427737 2:199600704-199600726 AGAGAGAATGACACATAGTAGGG + Intergenic
944872822 2:203931436-203931458 AGAGAGAATGAGTGCCAGCAAGG - Intergenic
945031530 2:205668910-205668932 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
945161916 2:206900206-206900228 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
945258353 2:207821162-207821184 ATTGAAAATGAGCCACAGCCAGG - Intergenic
945443715 2:209911127-209911149 AGAGAGAATGAGTGCAAGCAGGG + Intronic
945533807 2:210987285-210987307 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
945842811 2:214908241-214908263 AGAGAGAATGAGTGACAGCAGGG + Intergenic
946142161 2:217700613-217700635 AGAGAGAATGAGAGTAAGCAGGG - Intronic
946561349 2:220917081-220917103 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
946666114 2:222051581-222051603 AGAGAGAAACAGACACAGAAAGG + Intergenic
946761275 2:222995504-222995526 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
947011357 2:225570524-225570546 AGAGAGAATGAGTGCCAACAGGG + Intronic
947031614 2:225802256-225802278 AAAGAGAATGAGTGCCAGCAGGG - Intergenic
947366777 2:229404361-229404383 AGACAGAATGAGAGCCAGCAGGG + Intronic
947492040 2:230603487-230603509 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
948099190 2:235359918-235359940 GAAGAGAGGGAGCCACAGCAAGG + Intergenic
948328846 2:237149614-237149636 AATCAGACTGAGCCACAGCATGG + Intergenic
948344824 2:237286921-237286943 AGAGAGAGTGAGTAAGAGCAGGG + Intergenic
948452332 2:238083824-238083846 AGAGAGAAACAGGAACAGCATGG + Intronic
948493413 2:238329074-238329096 AGAGAGAGAGAGCCAAAGCCCGG + Exonic
948945362 2:241216520-241216542 AGAAAGCATGGGCCAGAGCAAGG + Intronic
948951333 2:241253828-241253850 ATAAAGAATGAGACAGAGCACGG + Intronic
1168799352 20:634410-634432 AGAGAGAATGAGACTCAGATGGG + Intergenic
1169249079 20:4046462-4046484 AGAGAGCATGAGCCAAATCCTGG + Intergenic
1169592659 20:7162732-7162754 AGAGAGAATGAGTGCCAACAGGG - Intergenic
1170491972 20:16886472-16886494 ACAGAGATTGAGCCACTGCTTGG + Intergenic
1170696462 20:18663798-18663820 AGAGAGAATGAGTGCCAGCGGGG + Intronic
1170752892 20:19167652-19167674 ACAGAGTGTGAGCCAAAGCAGGG - Intergenic
1170782352 20:19437349-19437371 AGAGAGAATGAGTGACAGCAGGG - Intronic
1171050452 20:21853580-21853602 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
1171110015 20:22472350-22472372 AAAGAGAATGAGTAACTGCACGG + Intergenic
1171167226 20:22982558-22982580 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
1171454575 20:25260652-25260674 TGAGAGCATGAGCTAAAGCAGGG + Intronic
1172806394 20:37615086-37615108 AGAGAGAGTTAGCCACAGGGTGG + Intergenic
1173318729 20:41968479-41968501 ACAGAGGATGAGCCAAAGCAGGG - Intergenic
1173393263 20:42654202-42654224 ATAGAGAATGAACAGCAGCAAGG + Intronic
1173770395 20:45651610-45651632 ACCGAGCATGAGCCAAAGCAGGG + Intronic
1174207752 20:48853414-48853436 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1174685744 20:52453209-52453231 AGAGAGAGTGAGCAAGAGCAGGG - Intergenic
1174891967 20:54404945-54404967 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1175375637 20:58521836-58521858 AGAGAGACTGAGGCACAGCAAGG + Intergenic
1176028302 20:62997651-62997673 AGTGAGACTGAGTCACAACAGGG - Intergenic
1176743643 21:10631248-10631270 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
1176870100 21:14077071-14077093 AGAGAGAAAGAGACATAGAAAGG + Intergenic
1177244789 21:18509570-18509592 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
1177259472 21:18711653-18711675 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1177259723 21:18713603-18713625 AGAGAGAATGAGGGCCTGCAGGG - Intergenic
1177334319 21:19703838-19703860 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1177359431 21:20049172-20049194 AGAGAGAATGAGTTCCAGCAGGG - Intergenic
1177425808 21:20921922-20921944 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
1177472982 21:21583109-21583131 AGAGATAATGAGTGCCAGCAGGG - Intergenic
1177861420 21:26459070-26459092 AGAGAAAATGTGGCACACCATGG - Intergenic
1177892473 21:26823136-26823158 AGAAAGAATGAGTGCCAGCAGGG - Intergenic
1178224232 21:30696809-30696831 TGAGAAAATAAGCCACAGAATGG - Intergenic
1178489922 21:33043086-33043108 AGAAGGAAAGAGCCACAGCCTGG - Intergenic
1178667774 21:34564103-34564125 AGAGAGAATGAGTGCCAGCAGGG + Intronic
1178850732 21:36210088-36210110 AGAGACAAGAAGCCAGAGCAGGG - Intronic
1179049031 21:37872899-37872921 AGAGAGAATGAGTGACAGCAGGG - Intronic
1180551771 22:16546621-16546643 TGAGAGCATGAGAGACAGCAGGG + Intergenic
1180941762 22:19664102-19664124 AGAGGGGAGGAGGCACAGCAGGG - Intergenic
1181352238 22:22267302-22267324 TGAGAGCATGAGAGACAGCAGGG - Intergenic
1181961093 22:26622353-26622375 AGAGTCAATGAGACCCAGCAAGG + Intronic
1182169160 22:28209310-28209332 ACAGAGTGTGAGCCAAAGCAGGG + Intronic
1182253915 22:29024223-29024245 CGAGAGACTGAACCACAGAAAGG - Intronic
1182843502 22:33411265-33411287 AGGCAGAGTTAGCCACAGCAAGG + Intronic
1182992013 22:34777281-34777303 AGAGAAAGTGAGCAAGAGCAGGG - Intergenic
1183802631 22:40180381-40180403 AGAGAGGAGGAACCAGAGCAGGG + Intronic
1183945698 22:41324619-41324641 AGGGAGCATTAGCCACAGGAGGG + Intronic
1184157439 22:42677380-42677402 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1184157763 22:42679657-42679679 AGAGAGAATGAGCACTAGCAGGG - Intergenic
1184586810 22:45453476-45453498 AAAGAGAATGTGCCACAGGAAGG - Intergenic
1185272865 22:49936675-49936697 ACAGGGAATGAGCCTCAGCCAGG + Intergenic
949262546 3:2119272-2119294 AGAAAGAAAGAGACACACCAAGG - Intronic
949834344 3:8251810-8251832 ACAGAGAGTGAGCAAGAGCAGGG + Intergenic
950071522 3:10156632-10156654 AGAGAGAATGAATGCCAGCAGGG + Intergenic
950579069 3:13850960-13850982 AGAGAGCCTGGGCCACAGCCTGG - Intronic
950604924 3:14070257-14070279 ACCGAGCATGAGCCAAAGCACGG + Intronic
950822774 3:15778945-15778967 AGAGAGAATGACTGCCAGCAGGG - Intronic
951262767 3:20531144-20531166 AGAGAGTATGAAAAACAGCATGG + Intergenic
951725193 3:25750143-25750165 AGAGAGAATGAGTGCAAGCAGGG + Intronic
951746179 3:25980214-25980236 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
951862034 3:27263784-27263806 ACCGAGCATGAGCCAAAGCAGGG - Intronic
952501884 3:33970614-33970636 ACAGAGCATGAGCCGAAGCAGGG - Intergenic
952514036 3:34085684-34085706 ACGGAGCATGAGCCAAAGCAGGG - Intergenic
952608848 3:35182659-35182681 AGAAAGAATGAGTGCCAGCAGGG + Intergenic
952952040 3:38533141-38533163 AAAGAGTATGAGCCTCAGCTGGG - Intronic
953644007 3:44736913-44736935 TGAGAAAATAAGCCACAGCCTGG - Exonic
954775759 3:53016721-53016743 TGAAAAAATGAGCCACAGAATGG - Intronic
954841538 3:53515910-53515932 AGAGAGAGAGAGCCAGAGCAGGG - Intronic
954911689 3:54116105-54116127 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
955039020 3:55296906-55296928 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
955135427 3:56213189-56213211 ACCGAGCATGAGCCAAAGCAAGG + Intronic
955268900 3:57477098-57477120 ACTGAGCATGAGCCAAAGCAGGG + Intronic
955626346 3:60923732-60923754 ACTGAGCATGAGCCAAAGCAGGG + Intronic
955630342 3:60966406-60966428 ACGGAGCATGAGCCAAAGCAGGG - Intronic
955895326 3:63694068-63694090 ATGGAGAGTGAGCCAAAGCAGGG + Intergenic
956534977 3:70265818-70265840 AGAGAGAATGAGTGCCAGCCGGG + Intergenic
956822010 3:72962466-72962488 GAAGAGAAAGAGCCACAGCAAGG + Intronic
956862504 3:73338830-73338852 ACAGAGTGTGAGCCAAAGCAGGG - Intergenic
956875545 3:73459121-73459143 AGAGAGAATGAGTGCCAGCAAGG + Intronic
957113437 3:75994508-75994530 AGAGAAAATGAGTGCCAGCAGGG - Intronic
957113668 3:75996359-75996381 AGAGAGAATGAGTGCCAGGAGGG - Intronic
957306842 3:78468018-78468040 ACAGAGGATGAGCCAAAACATGG - Intergenic
957327590 3:78716380-78716402 AGAGAGAATGAGTGCCAGCAGGG + Intronic
957418395 3:79935600-79935622 AGAGAGAATGAGTTTCGGCAGGG + Intergenic
957456052 3:80447597-80447619 AGAGAGAATGAAAGACAGCATGG + Intergenic
957867052 3:86039241-86039263 ACTGAGCATGAGCCAAAGCAGGG + Intronic
957956716 3:87196926-87196948 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
958161774 3:89825877-89825899 AGAGAGAGTGGGCTACAACATGG + Intergenic
958422994 3:93949856-93949878 ACAGAGTGTGAGCCAAAGCAGGG + Intronic
958539610 3:95453986-95454008 AGAGAGAATGAGTGCCAGTAGGG - Intergenic
958548240 3:95584728-95584750 AGAGAGAGAGAGACAAAGCAAGG - Intergenic
958829959 3:99074490-99074512 ACGGAGAGTGAGCCAAAGCAGGG - Intergenic
958832906 3:99111160-99111182 AGAGAGAATGAATGCCAGCAGGG + Intergenic
958957863 3:100480546-100480568 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
959810526 3:110613771-110613793 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
960225870 3:115167955-115167977 AGAGAGAGCCAGCAACAGCAGGG + Intergenic
960400606 3:117193117-117193139 AGAGAGAATGAGCTCAAGTAGGG + Intergenic
960504251 3:118473496-118473518 AATGAGCATGAGCCACAGCTGGG - Intergenic
960520008 3:118643885-118643907 AGAGAGAGAGAGCCACAACTTGG + Intergenic
960565773 3:119130225-119130247 ACAGAGGGTGAGCCAAAGCAGGG + Intronic
960957021 3:123039842-123039864 AGAGAGAAAGAGCCCTAGGAGGG + Intergenic
960963769 3:123090596-123090618 AGAGAAAATGAGAGACAGCGGGG - Intronic
961194867 3:124993197-124993219 ATGCAGAATGAGACACAGCAGGG - Intronic
961357553 3:126348719-126348741 CGGGAGCCTGAGCCACAGCAGGG + Intronic
961387236 3:126529643-126529665 AGACAGAAGGAGACAAAGCATGG - Intronic
961625750 3:128262482-128262504 GGAGAAAGTGAGGCACAGCAAGG - Intronic
962422321 3:135239517-135239539 AGAGAGACAGAGCCTAAGCATGG + Intronic
963003893 3:140707972-140707994 AGAGAGAGTGAGAGAGAGCATGG - Intergenic
963014051 3:140803584-140803606 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
963109003 3:141670068-141670090 ACAGAGCGTGAGCCAAAGCAGGG + Intergenic
963296978 3:143557186-143557208 AGAGAGAATGAGTGCAAGCAGGG - Intronic
963526629 3:146423224-146423246 AGAGAGAGAGAGGCACTGCAAGG - Intronic
963878134 3:150499989-150500011 AGACAGAATGAGTGCCAGCAGGG + Intergenic
964049559 3:152373609-152373631 ACAGAGCACGAGCCAAAGCAGGG - Intronic
964635907 3:158858620-158858642 AGAGGGAGTGTGCCACAACAAGG - Intergenic
964930596 3:162017207-162017229 AGAGAGAATGAGAGCAAGCAGGG - Intergenic
964945320 3:162216504-162216526 AGAAAGAATGAGTACCAGCAGGG + Intergenic
964994973 3:162867943-162867965 ACAGAGGGTGAGCCAAAGCATGG + Intergenic
965065278 3:163840362-163840384 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
965100316 3:164289647-164289669 AGAGAGAATGAGTGGCAGCAGGG + Intergenic
965638452 3:170808329-170808351 AGAGAGAATGAGTGCCAGCAGGG - Intronic
965709779 3:171545608-171545630 AGAGAGAAAGAGACAGAGCATGG - Intergenic
965964775 3:174473969-174473991 AGAGAGAATGAGTGCCAGCAGGG + Intronic
966350371 3:179027707-179027729 AGTGAGCCTGAGCCACAGCTGGG + Exonic
966537072 3:181046744-181046766 ACAGAGTGTGAGCCAAAGCAGGG - Intergenic
966701660 3:182860132-182860154 AAAGAGAATAAGCCACAGGTAGG - Intronic
967050138 3:185775538-185775560 AAGGAGAATGATCCAGAGCAAGG + Intronic
967050575 3:185780041-185780063 AAAGTGAATGAGCCAGATCATGG + Intronic
967525060 3:190482798-190482820 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
967607767 3:191467893-191467915 AGAGAGAATGAGTGCCAGCGGGG + Intergenic
967797232 3:193611003-193611025 ACCGAGCATGAGCCAAAGCAGGG - Intronic
968037390 3:195559443-195559465 AGAAAGAATCAGTCACAGAAGGG - Intergenic
968488169 4:874831-874853 AGAGAGACTGTGGCACTGCAGGG - Intronic
968748968 4:2376571-2376593 AGAGAGAGTGAGTGCCAGCAGGG + Intronic
968893166 4:3383176-3383198 AGTGAGCCTCAGCCACAGCACGG - Intronic
968980328 4:3845173-3845195 AGAGAGAATGAGTGTCAGCAGGG + Intergenic
969131898 4:4996236-4996258 AGACAGATTGAGCCTGAGCAGGG - Intergenic
969216252 4:5724595-5724617 AGAGAAAATGAGTCACAGAGAGG - Intronic
969278344 4:6152152-6152174 AGAGAGAGTGAGAGAGAGCAGGG + Intronic
969561303 4:7950105-7950127 AGAGAGACTGAGCCACAGGCTGG - Intergenic
969627633 4:8315821-8315843 AGACAGAATGTGCCCCTGCAGGG + Intergenic
969628467 4:8320969-8320991 AGAGAGAATGAGAGCAAGCAGGG + Intergenic
969747053 4:9080737-9080759 AGTGAGCATGAGCCCAAGCAGGG + Intergenic
970263428 4:14254317-14254339 GCAGAAAATGAGCCACGGCAAGG + Intergenic
970361624 4:15314615-15314637 AGAGAAACTGAGGCACAGTATGG - Intergenic
970796559 4:19920294-19920316 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
971697806 4:29929458-29929480 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
972340875 4:38151581-38151603 AGAAAGTATGAGCAAGAGCAGGG + Intergenic
972475509 4:39446160-39446182 ACAGAGAAGGAGCCACACCCAGG - Intronic
972569623 4:40298752-40298774 AGAGAGAGTGAGCAAGAGCAGGG + Intergenic
973712224 4:53641339-53641361 AGTGAGAGGGTGCCACAGCAGGG + Intronic
973732211 4:53833491-53833513 ATGGAGAGTGAGCCAAAGCAGGG + Intronic
974023636 4:56712798-56712820 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
974100072 4:57406716-57406738 AGAGAGAATGAGCGCCAAAAGGG + Intergenic
974319804 4:60333022-60333044 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
974320037 4:60334980-60335002 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
974344512 4:60661872-60661894 AGAGAGAACGAGTGTCAGCAGGG - Intergenic
974347027 4:60695998-60696020 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
974525177 4:63042298-63042320 AGAGAGAATGAGTGCCAGCCGGG + Intergenic
974525445 4:63044269-63044291 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
974658492 4:64855750-64855772 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
974702622 4:65471659-65471681 AGAGAGAGAGAGCAAGAGCAGGG + Intronic
974939454 4:68447576-68447598 AAACAGTATGAGCCACACCAAGG + Intronic
974959846 4:68683497-68683519 ACCGAGCATGAGCCAAAGCAGGG - Intergenic
974962419 4:68720652-68720674 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
975036335 4:69687591-69687613 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
975345972 4:73293070-73293092 ATGGAGCATGAGCCAAAGCAGGG - Intergenic
975498889 4:75063061-75063083 AGAGAGTTTGAGCTATAGCATGG - Intergenic
975500599 4:75080230-75080252 ACGGAGAGTGAGCCAAAGCAGGG - Intergenic
975726956 4:77301460-77301482 ACAGAGTGTGAGCCAAAGCAGGG - Intronic
975727205 4:77303563-77303585 ATGGAGGATGAGCCAAAGCAGGG - Intronic
975809008 4:78145908-78145930 AAAGAGAACGAGCACCAGCAGGG - Intronic
976040329 4:80876405-80876427 AGAGAGAATGAGTGCCAGCAGGG - Intronic
976125446 4:81829289-81829311 AGAGTCAATCAGCCACAGCCAGG - Intronic
976263042 4:83164213-83164235 ACAGACCATGAGCCAAAGCAGGG + Intergenic
976805805 4:89045726-89045748 AGAAAGTATGAGCCAAGGCAGGG + Intronic
976978010 4:91187127-91187149 ACAGAGTGTGAGCCAAAGCAAGG - Intronic
977005917 4:91569579-91569601 AGAGAGAATGAGTGCCAGCAGGG + Intronic
977360754 4:96000993-96001015 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
977425120 4:96859102-96859124 GGAGAGAGTGAGCAAGAGCAGGG + Intergenic
977897468 4:102380719-102380741 ACCGAGCATGAGCCAAAGCAGGG - Intronic
977952974 4:102994755-102994777 AAAGAGAATGAGTGAAAGCAGGG + Intronic
978056740 4:104279131-104279153 AGAGAAAATGAGGCAGAGAAAGG - Intergenic
978187952 4:105880320-105880342 ACAGAGCGTGAGCCAAAGCAGGG + Intronic
978234786 4:106445888-106445910 AGAGAGAATGGGTGACACCAGGG + Intergenic
978245246 4:106564057-106564079 ACTGAGCATGAGCCAAAGCAGGG - Intergenic
978246940 4:106584326-106584348 AGAGATGTAGAGCCACAGCAGGG - Intergenic
978467090 4:109019568-109019590 CGAGAGAGTGAGCAAGAGCAGGG + Intronic
978718355 4:111873832-111873854 AGAAAGAATAAGCCACTGGATGG + Intergenic
978769693 4:112442073-112442095 AGAGAGAATGAGTGCCAGCAGGG + Exonic
979045593 4:115858604-115858626 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
979204724 4:118024521-118024543 AGAGAGAATGAGCGCCAGTAGGG - Intergenic
979272912 4:118783079-118783101 ACAGAGGGTGAGCCAAAGCAGGG - Intronic
979434813 4:120675063-120675085 TGAGAGAATGAGACACTTCAAGG + Intergenic
979650171 4:123119911-123119933 AGAGAGAATGAGTGCAAGCAGGG + Intronic
979732911 4:124045816-124045838 ACAGAGAATGAGGAAAAGCAGGG - Intergenic
979776333 4:124592872-124592894 AGAGAGAATTAGTGCCAGCAGGG - Intergenic
979909223 4:126339770-126339792 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
980413686 4:132457957-132457979 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
980579748 4:134733519-134733541 AGAGAGAATGAGAGCCAGCAGGG - Intergenic
980742855 4:136974450-136974472 ATAGAGAATGAGTGCCAGCATGG + Intergenic
980814894 4:137932382-137932404 AGAGAGAATGAGTGACAGCAGGG + Intergenic
981188449 4:141833781-141833803 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
981273086 4:142867559-142867581 ACAGAGAGTGAGCCAAAGCAGGG + Intergenic
981350345 4:143722178-143722200 AGAGAGAGTGAGACAAAGAATGG + Intergenic
981359499 4:143830566-143830588 AGAGAGAATGAGAGCCAGCAGGG - Intergenic
981359767 4:143832520-143832542 AGAGAGAATGAGAGTCAGCAGGG - Intergenic
981370265 4:143951625-143951647 AGACAGAATGAGAGCCAGCAGGG - Intergenic
981370528 4:143953595-143953617 AGAGAGAATGAGAGTCAGCAGGG - Intergenic
981380023 4:144061585-144061607 AGAGAGAATGAGAGCCAGCAGGG - Intergenic
981380289 4:144063519-144063541 AGAGAGAATGAGAGTCAGCAGGG - Intergenic
981655884 4:147112097-147112119 ATAGAGGGTGAGCCAAAGCAGGG + Intergenic
981668184 4:147255183-147255205 ACAGAGCATGAGCCAAAGCAGGG + Intergenic
981844981 4:149157145-149157167 GGAGAGAATGAGTGTCAGCAGGG + Intergenic
981915246 4:150026132-150026154 AGAGAGAAGGAGCAAGAACAGGG - Intergenic
982045378 4:151440107-151440129 AGAGAGAATGAGTGCCAGCAGGG + Intronic
982234700 4:153241622-153241644 AGGGAGCAGGAGCAACAGCAGGG + Intronic
982751833 4:159171397-159171419 GGAGAGACTGAGCCACAGAGAGG + Intronic
982818754 4:159919790-159919812 AGAGAGAAAGAGAGAGAGCATGG - Intergenic
982900452 4:160993395-160993417 AGTGAGAATGACTGACAGCAGGG + Intergenic
983254796 4:165385956-165385978 ATAAAGAAAGAGCCCCAGCAGGG - Intronic
983362351 4:166743627-166743649 ACAGAGTATGAGCCGAAGCAGGG + Intronic
983396517 4:167204452-167204474 AGAGAGAATGAGTGCCACCAGGG + Intronic
983677769 4:170316552-170316574 ATGGAGAGTGAGCCAAAGCAGGG + Intergenic
983868609 4:172798089-172798111 AGTGAATATGAGCCACATCAAGG - Intronic
984015265 4:174417860-174417882 ACTGAGCATGAGCCAAAGCAGGG - Intergenic
984189505 4:176588545-176588567 AGAGAGATTGAGTGCCAGCAGGG + Intergenic
984636550 4:182116532-182116554 ACAGAGAATGAGTGCCAGCAGGG - Intergenic
984818447 4:183859189-183859211 AGAGAGAATGGGCCAGAGCAGGG - Intronic
985438864 4:189963909-189963931 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
986115293 5:4768004-4768026 AGAAAGAATGAGTCACGGAATGG + Intergenic
986431142 5:7682423-7682445 GGTGAGAATGAGCAACAGAAGGG - Intronic
986532974 5:8758554-8758576 AGAGAGAATGAATGCCAGCAGGG - Intergenic
986533508 5:8762656-8762678 AGAGAGAATGAGTGCGAGCAGGG - Intergenic
987337591 5:16910725-16910747 AGGGAGCCTGAGGCACAGCATGG + Intronic
987580309 5:19782234-19782256 AGAGAGAATGAGTGCAAGCAGGG + Intronic
987610808 5:20199867-20199889 AGAGAGAATGAATGCCAGCAGGG - Intronic
987681443 5:21140958-21140980 AGAGAGAATGAATGCCAGCAGGG - Intergenic
987890489 5:23869935-23869957 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
987916292 5:24218888-24218910 AGAGAGAATGAGAGCCAGCAGGG - Intergenic
988138021 5:27200427-27200449 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
988140641 5:27234800-27234822 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
988202595 5:28086615-28086637 GCTGAGAATGAGCTACAGCAGGG + Intergenic
988676227 5:33435723-33435745 AGAGAAAATGAGTGCCAGCAGGG - Intergenic
989063695 5:37436819-37436841 GAAGAGAAAGAGCCATAGCAGGG + Intronic
989347541 5:40446711-40446733 AGAGAGAATGAGCACAAGCAGGG + Intergenic
989422729 5:41258808-41258830 AGAGAGAATGAGTGCAAGCAGGG + Intronic
989522505 5:42418398-42418420 AGAGAGAATAAGCTGAAGCAGGG - Intergenic
989619136 5:43367531-43367553 AAAGAGGGTGAGCCAAAGCAGGG - Intergenic
989670245 5:43908842-43908864 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
989674014 5:43953046-43953068 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
989972338 5:50540044-50540066 AGAGAGAAAGAGACAAAGAAAGG + Intergenic
990031924 5:51271831-51271853 AGAGAGAATGAGTGTAAGCAGGG + Intergenic
990122757 5:52475666-52475688 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
990186465 5:53215218-53215240 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
990352843 5:54936087-54936109 AGGGAGAATGAGACTCAGGAAGG - Intergenic
990369857 5:55106567-55106589 AGGTAGAATTAGCCTCAGCATGG + Intronic
990560982 5:56982605-56982627 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
990706054 5:58531058-58531080 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
990721398 5:58699939-58699961 ACAGAGGGTGAGCCAAAGCAGGG - Intronic
990787410 5:59437968-59437990 AGAGAGAATGAGTGCCAGCAGGG + Intronic
990903449 5:60778509-60778531 AGAGAGAATGAGTGCCAGCAGGG + Intronic
990903761 5:60780694-60780716 AGAGAGAATGAGTGCCAGCAGGG + Intronic
990913895 5:60881827-60881849 ACTGAGCATGAGCCAAAGCAGGG - Intronic
991026755 5:62037956-62037978 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
991086858 5:62655778-62655800 ACAGAGCGTGAGCCAAAGCAGGG + Intergenic
991223495 5:64242931-64242953 ACAGAGGGTGAGCCAAAGCAGGG + Intronic
991243499 5:64484969-64484991 ACAGACAGTGAGCCAAAGCAGGG - Intergenic
991496362 5:67230148-67230170 ACCGAGCATGAGCCAAAGCAGGG - Intergenic
992018375 5:72598354-72598376 AGAGAGAATGAGTGCCAGTAGGG + Intergenic
992075889 5:73192325-73192347 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
992885694 5:81157725-81157747 AGAGAGAATGAGTGCCAGCAGGG + Intronic
992979818 5:82157174-82157196 AAAGTGAATTAGCAACAGCATGG - Intronic
993069058 5:83135192-83135214 ACAGAGCATGAGCCGAAGCAGGG - Intronic
993127652 5:83855237-83855259 AGAGAGAATGGGTCAAAGAATGG + Intergenic
993619054 5:90146920-90146942 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
993682185 5:90893312-90893334 AGAGAGAATGAGCATGACCAAGG + Intronic
993757713 5:91751500-91751522 ACAGAGGATGAGCCGAAGCAGGG - Intergenic
994039633 5:95244347-95244369 ACGGAGGATGAGCCAAAGCAGGG + Intronic
994294093 5:98068145-98068167 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
994590972 5:101771172-101771194 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
994873350 5:105381486-105381508 AGAGAGAATGAATGACAGCAGGG + Intergenic
995050209 5:107694761-107694783 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
995152141 5:108860892-108860914 AGAGAGACTGAGCAAGAGTAGGG + Intronic
995443664 5:112219328-112219350 AGAGAGAATGAGTGCCAGCAGGG - Intronic
995457990 5:112372245-112372267 ATAGAGAATGAGAGCCAGCAGGG + Intronic
995459723 5:112390214-112390236 ACAGAGGGTGAGCCAAAGCAGGG + Intronic
995561705 5:113388836-113388858 AGACAGTATGAGGCACAGCCTGG + Intronic
995665461 5:114536617-114536639 AGTGAGCATGAGCCAAAGCAGGG - Intergenic
995695651 5:114876036-114876058 AGAGAAAGTGAGCCAAAGCAGGG + Intergenic
995709035 5:115016045-115016067 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
995981300 5:118107515-118107537 AGAGAGAATGAGAACCAGCAGGG - Intergenic
995981697 5:118112231-118112253 AGAGAGAATGAGACCCAGCAGGG - Intergenic
996033253 5:118730294-118730316 AGAGAGAATGAGTGAAAGCAGGG + Intergenic
996122130 5:119684471-119684493 AGAGAGAATGAGAGCTAGCAGGG + Intergenic
996453836 5:123657352-123657374 AGAGAGAAAGAGACAGAGTAAGG + Intergenic
996685134 5:126271485-126271507 AGAGAGGATGAGTCACAAGAAGG + Intergenic
997021903 5:130012577-130012599 AGAGAGAATGAGTGCCAGCTGGG + Intronic
997086618 5:130807070-130807092 AGAGAGAATGAGAGCCAACAGGG - Intergenic
997613909 5:135233277-135233299 GGAGAGAGTGAGCCACAGGAGGG + Intronic
998645405 5:144055882-144055904 ACTGAGCATGAGCCAAAGCAGGG - Intergenic
998687696 5:144548591-144548613 AGAGAGAATGAGCACAAGCAGGG - Intergenic
998803133 5:145891307-145891329 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
998804248 5:145903225-145903247 TGAGAAAATGAGACATAGCACGG + Intergenic
999008556 5:148009041-148009063 AAAGAGAGTGAGCAACAGCAGGG + Intergenic
999017649 5:148125777-148125799 AGAGAGAATGACCCAGTGCACGG + Exonic
999191348 5:149749795-149749817 AAAGATAATGAGTCACAGGATGG - Intronic
999488797 5:152027305-152027327 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
999507822 5:152216615-152216637 AGAGAAAATGAGGCTCAGAAAGG + Intergenic
999682158 5:154070435-154070457 AGATAGAATGAGGCAGGGCATGG + Intronic
999764288 5:154726858-154726880 AGAGAGAATGAGAACCAGCAGGG + Intronic
999925146 5:156367741-156367763 AGCGAGGCTGAGCCACAGCTGGG - Intronic
1000033566 5:157424495-157424517 ACAGAGTGTGAGCCAAAGCAGGG + Intronic
1000040100 5:157479108-157479130 AGCAAGGATGACCCACAGCAAGG + Exonic
1000580869 5:163034262-163034284 AGAGAGAATGCGTGCCAGCAGGG - Intergenic
1000581173 5:163036537-163036559 ACAGAGAATGAGTGTCAGCAGGG - Intergenic
1000601147 5:163276180-163276202 ACAGAGAATGAGACCCAGAAGGG + Intergenic
1001152329 5:169243037-169243059 AGAGAGACTGAGTCAAAGAATGG - Intronic
1001202071 5:169727305-169727327 AGAGAAAATGAGGCTCAGAAAGG + Intronic
1001786061 5:174414568-174414590 ACAGAGAAATAGTCACAGCAAGG + Intergenic
1001885822 5:175289342-175289364 AGAGAAAATGAGTGCCAGCAGGG + Intergenic
1002290607 5:178198229-178198251 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
1002792784 6:447889-447911 AGGGAGAACGAGCCAGAGGAAGG + Intergenic
1003462430 6:6342340-6342362 AGAGAGAATGAGAGACAGCAGGG - Intergenic
1004056018 6:12139504-12139526 ACAGAGGGTGAGCCAAAGCAGGG + Intronic
1004184370 6:13409350-13409372 AGAGAGAAAGAGACAGAGGAAGG + Intronic
1004317064 6:14598894-14598916 AGAGAGAAAGATCCACAACCAGG - Intergenic
1004576398 6:16899760-16899782 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
1004578953 6:16928762-16928784 AGAGAGAAACAGACATAGCAGGG + Intergenic
1004598153 6:17121102-17121124 AGAGAGAATGAGTGCAAGCAGGG - Intronic
1004839891 6:19570843-19570865 AGAGAGAATGTGCGAGAGAAAGG - Intergenic
1004886390 6:20055049-20055071 AGAGAGAAGCAGCCACATGATGG + Intergenic
1005152438 6:22767705-22767727 AGATAGAATGAGCTACGACAGGG + Intergenic
1005558091 6:27008539-27008561 ACAGAGTGTGAGCCAAAGCAGGG + Intergenic
1005941217 6:30561801-30561823 AGAGAGAGAGAGACACAGAAAGG - Intronic
1006170314 6:32088263-32088285 AGAGAACATGAGCTACAGCGAGG + Intronic
1006215482 6:32438743-32438765 AGAGATAATAACCCACAGAACGG - Intergenic
1007021363 6:38525246-38525268 AGAGAGAGCGAGCAAGAGCAGGG - Intronic
1007021674 6:38527519-38527541 AGAGAGAGTGAGCAAGAGCAGGG - Intronic
1007288126 6:40762751-40762773 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1007309550 6:40934643-40934665 AGAGGGAATGGGGAACAGCAGGG + Intergenic
1007448266 6:41923728-41923750 AGAGAGTATGAGACACGGCAGGG - Intronic
1007965508 6:46000675-46000697 AGAGAGAATGACTGCCAGCAGGG + Intronic
1008158150 6:48042921-48042943 AAAAAGAAAGAGCCAAAGCAAGG + Intronic
1008233506 6:49014373-49014395 AGAGAGAATGAGTGTCAGCAGGG + Intergenic
1008598182 6:53064117-53064139 AGAGAGAACGAGCTACAATAAGG - Intronic
1009011069 6:57843002-57843024 AGAGATAATGAGCAGGAGCAGGG - Intergenic
1009361423 6:62818756-62818778 AGGAAGCATGAGCCAAAGCAGGG - Intergenic
1009684836 6:66943880-66943902 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1009726694 6:67543922-67543944 AGAGAGAATGAGTGCTAGCAGGG - Intergenic
1009971519 6:70629780-70629802 AGAAAGAATGAGTGCCAGCAGGG - Intergenic
1010027336 6:71234853-71234875 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1010476962 6:76299504-76299526 ATCCAGCATGAGCCACAGCAGGG - Intergenic
1010698581 6:79010642-79010664 AGAGAGATAGAGACACAGCTAGG + Intronic
1010820712 6:80411932-80411954 ACAGAGGCTGAGCCAAAGCAGGG - Intergenic
1010851502 6:80783193-80783215 AAAGAGCATGAGCCGAAGCAGGG + Intergenic
1010900684 6:81423703-81423725 AGAGAGAATGAGTGCCAGCAAGG - Intergenic
1011032801 6:82941775-82941797 AGAGAGAATGAGTGCCAACAGGG - Intronic
1011346470 6:86374589-86374611 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1011358570 6:86498074-86498096 ACAGTGCATGAGCCAAAGCAGGG - Intergenic
1011376771 6:86695342-86695364 ACTGAGCATGAGCCAAAGCAGGG - Intergenic
1011728405 6:90234327-90234349 AGAGAGCATGCTCCCCAGCAAGG + Intronic
1011750738 6:90452297-90452319 GGAGAGAATGAGAGCCAGCAGGG - Intergenic
1012675606 6:102107957-102107979 AGCCAGGATGAGCCACAGAAAGG - Intergenic
1012750077 6:103149700-103149722 AGATAGTATGAGCAACATCAAGG + Intergenic
1013151000 6:107446694-107446716 AGAGAGAATGAGTGCCAGTAGGG + Intronic
1013151300 6:107448856-107448878 AGAGAGAATGAGTGCCAGCAGGG + Intronic
1013607592 6:111764875-111764897 AGAGAGAATGAGCCACAGCAGGG - Intronic
1013715819 6:112960279-112960301 AAAGAAAATGTGGCACAGCATGG + Intergenic
1013956833 6:115852145-115852167 ACAGAGGGTGAGCCATAGCAGGG + Intergenic
1014049296 6:116933527-116933549 AGAGAAAATGACCCAGAGCAGGG + Intergenic
1014139624 6:117926266-117926288 AGAGAGAATGAGTGCAAGCAGGG - Intronic
1014211689 6:118715191-118715213 AGAGAGAACTAGCAAGAGCAGGG + Intergenic
1014485602 6:121995269-121995291 AGAAAGAATGGGTCACATCAGGG + Intergenic
1014639523 6:123892420-123892442 AGAGAGAATGAGTGCAAGCAGGG + Intronic
1014740207 6:125140495-125140517 AGAGAGAATGAGTGCCAGCAGGG - Intronic
1014837548 6:126176694-126176716 AGAGAGAAAGAGGCAAAGTATGG + Intergenic
1014838357 6:126185832-126185854 AGAGAGAATGAGTGTAAGCAGGG + Intergenic
1014842950 6:126241176-126241198 ACCGAGCATGAGCCAAAGCAGGG - Intergenic
1014912476 6:127111413-127111435 AGAAGGGATGAGCCTCAGCAGGG + Intergenic
1015031155 6:128597555-128597577 AGAACGAATGAGCCATGGCAGGG - Intergenic
1015173374 6:130279376-130279398 AGAGAGAATGAGTGCCAGCAGGG - Intronic
1015713519 6:136166871-136166893 AGAAATAAGGAGCCACTGCAAGG - Intronic
1015966834 6:138702688-138702710 AGAGAGAAAGAGACAGAGAAGGG - Intergenic
1016174809 6:141068276-141068298 AGAGAGAATGAGTGCCAGCATGG + Intergenic
1016566782 6:145464211-145464233 AGAGACAGTGAGCAAGAGCAGGG - Intergenic
1016574472 6:145553156-145553178 AGAGAGAATGAGTGCAAGCAGGG - Intronic
1016583238 6:145653312-145653334 AGAGAGAGTGAGCAAGAGCAGGG - Intronic
1016645270 6:146399736-146399758 AGAGAGAAAGAGACAGAGAAAGG - Intronic
1016703126 6:147076415-147076437 AGAGAGAATGAGTACAAGCAGGG - Intergenic
1016717466 6:147251130-147251152 ACAGAGAGTGAGCCGAAGCAGGG + Intronic
1016828149 6:148406909-148406931 AGAGAGAATCAGCCTCTCCAAGG + Intronic
1017197506 6:151717155-151717177 ACAGAGGGTGAGCCAAAGCAGGG - Intronic
1017208195 6:151826298-151826320 AGAGCGAATGAGTTACAGCCTGG + Intronic
1017658994 6:156655739-156655761 AGAGAAAGAGAGCCACAGCATGG + Intergenic
1018491609 6:164299450-164299472 AGAGAGAATGAGGACCAGCAGGG - Intergenic
1019788552 7:2995395-2995417 AGAGAGAATGAGTGCAAGCAGGG - Intronic
1020388485 7:7633074-7633096 AGAGAGAGAGAGCAAGAGCAGGG - Intergenic
1020400839 7:7775439-7775461 AAAGAGAATGAGAGACAGCAGGG - Intronic
1020407528 7:7854476-7854498 AGAGAGAATGAGTACCAGCAAGG + Intronic
1020407811 7:7856376-7856398 AGAGAGAATGAGTGCCAGCAGGG + Intronic
1020429514 7:8104850-8104872 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
1020581663 7:10010781-10010803 AGAGAGAATGAGTGCTAGCAGGG - Intergenic
1020611153 7:10400381-10400403 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1020622314 7:10533374-10533396 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
1020737836 7:11973747-11973769 AGAGAGAATAAGTGCCAGCAGGG + Intergenic
1021143179 7:17053102-17053124 ACAGAGCATGAGCCAAAGCAGGG + Intergenic
1021325290 7:19258804-19258826 AGAGAGAATGAGTTTCGGCAGGG - Intergenic
1021400819 7:20208036-20208058 AGAAAGGATGAGTCCCAGCAGGG - Intronic
1021401081 7:20209938-20209960 AGAGAGAATGAGTGCCAGCAGGG - Intronic
1021654765 7:22864181-22864203 AAAGAGAATGAGTGCCAGCAGGG - Intergenic
1021830483 7:24602917-24602939 AAAGAGAATGAGTGGCAGCAGGG - Intronic
1022289155 7:28984737-28984759 AGAGAGAATTAGGAACAGCTGGG + Intergenic
1022491907 7:30827259-30827281 AGGGACACTGAGGCACAGCAAGG + Intronic
1022528965 7:31055105-31055127 AGAGGGAATGACACACAGCTGGG + Intronic
1022588230 7:31636049-31636071 AGAGAGAATGAGAGCTAGCAGGG + Intronic
1022776466 7:33532510-33532532 AGAGAGAATGAGTGCCAGCAGGG + Intronic
1022819610 7:33946143-33946165 AGAGAGAATGAGAGCCAGCAGGG + Intronic
1022982605 7:35618521-35618543 AGAGACAATGAGAGCCAGCAGGG - Intergenic
1023201640 7:37704436-37704458 AGAGAGAATGAGACCCAGTAGGG + Intronic
1023218174 7:37887805-37887827 AGAGAGAATGAGTGCCAGCAGGG + Intronic
1024173143 7:46810839-46810861 AGAGTGACAGAGCCACAGAATGG - Intergenic
1024173718 7:46816251-46816273 AAAGAGAAAGAATCACAGCAAGG + Intergenic
1024721053 7:52138154-52138176 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
1024738286 7:52328784-52328806 AAAGAGTGTGAGCCAAAGCAGGG - Intergenic
1024859558 7:53823193-53823215 AGAGAGAGTGAGGAAAAGCAGGG + Intergenic
1024937815 7:54729430-54729452 AGAAAGAATGAGTCCCAGCAGGG - Intergenic
1025297185 7:57784649-57784671 AGAGAGAAAGAGACAGAGAAAGG + Intergenic
1025577496 7:62667020-62667042 AATGAGTGTGAGCCACAGCAGGG + Intergenic
1025868506 7:65407773-65407795 ACCAAGAATGAGCCAAAGCAGGG - Intergenic
1026323205 7:69285475-69285497 AGAGAGAATGAGTGAAAGCAGGG - Intergenic
1027495917 7:78887903-78887925 ACCGAGCATGAGCCATAGCAGGG + Intronic
1027701748 7:81478608-81478630 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
1027793932 7:82668433-82668455 AGAGAGAATGAATGCCAGCAAGG + Intergenic
1027907663 7:84206908-84206930 AGATAGAATGAGTTACAGAAAGG - Intronic
1028055362 7:86234013-86234035 CCAAAGAAGGAGCCACAGCATGG + Intergenic
1028142698 7:87290038-87290060 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
1028159022 7:87465049-87465071 ACCGAGCATGAGCCAAAGCAGGG + Intronic
1028292999 7:89091686-89091708 AGGGAGAATGAGCCACACAAGGG - Intronic
1028529874 7:91826841-91826863 AGAGGGAAGGAGCCACTGGAAGG - Intronic
1029914135 7:104189300-104189322 AGAGAGAATGAGTGCCAGCAGGG + Intronic
1029979425 7:104864287-104864309 ACCGAGCATGAGCCAAAGCAGGG + Intronic
1030142567 7:106320316-106320338 ACGGAGCATGAGCCAAAGCAGGG + Intergenic
1031141048 7:117944044-117944066 AAAGAAACTGAGCCCCAGCAAGG - Intergenic
1031170728 7:118289627-118289649 AGAGAGAATGAGTACAAGCAGGG - Intergenic
1031323245 7:120359874-120359896 AGAGAGAGTGAGCAAGAGCAGGG - Intronic
1031445554 7:121849301-121849323 AGAGAGAATGAGCTCCAGCAGGG + Intergenic
1031470575 7:122164408-122164430 AGAGAGTATGAGCAACAGAGTGG + Intergenic
1031645717 7:124222516-124222538 AGAGAGAATGAGTTTCAGCAGGG - Intergenic
1031648845 7:124260526-124260548 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1031679138 7:124649482-124649504 GTAGAGAATAAGCCACAGGAGGG - Intergenic
1031690882 7:124786262-124786284 AGAGAGAATGAGTGCCAGGAGGG - Intronic
1031847555 7:126824601-126824623 AGATAAAATGATCCACAGCTTGG - Intronic
1031899750 7:127395482-127395504 AGAGAGAATGAGTGCCAGCAGGG - Intronic
1033314432 7:140285776-140285798 AGAGAGAAGGAGTCTCAGGAAGG - Intergenic
1033492111 7:141853979-141854001 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1033505393 7:141994771-141994793 AGAGAGAGTGAGCAAGAGCAGGG - Intronic
1033634517 7:143199192-143199214 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1033789826 7:144778098-144778120 AGAGAGAATGAGTGCCAGCAGGG + Intronic
1033878958 7:145858022-145858044 AGAGAGAATGAGTGCCAACAGGG + Intergenic
1033995289 7:147338188-147338210 AGAGAGAATGAATGCCAGCAGGG + Intronic
1034090724 7:148361856-148361878 AGAGAGAATGAGTGCCAGCAGGG + Intronic
1034097591 7:148424535-148424557 ACAGAGGGTGAGCCAGAGCAGGG + Intergenic
1034229591 7:149511335-149511357 AGAGAGAATGAGTGCTAGCAGGG - Intergenic
1034360815 7:150496380-150496402 ACAGAGAATGAGCTGAAGCAGGG + Intergenic
1034510534 7:151531290-151531312 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1034565718 7:151913647-151913669 AGAGAGAGTAAGCAAGAGCAGGG + Intergenic
1034973226 7:155432121-155432143 AGAAAGAAGGAAGCACAGCAGGG + Intergenic
1035141319 7:156765361-156765383 AGAGAGAATGAGTGCCAGCGGGG - Intronic
1035790644 8:2301323-2301345 AGAGAGAAGGAGTGCCAGCAGGG + Intergenic
1035802161 8:2420382-2420404 AGAGAGAAGGAGTGCCAGCAGGG - Intergenic
1035871315 8:3138760-3138782 ACAGAGAAAGAACCACAGCCTGG + Intronic
1036629998 8:10505708-10505730 AGAGAGAATGAGTGCCACCAGGG - Intergenic
1036648663 8:10627964-10627986 ACAGAGACTGAGGCACAGCTTGG + Intronic
1036765529 8:11547401-11547423 AGAGAGCCTGCGTCACAGCAGGG + Intronic
1037007027 8:13794774-13794796 AGACAGAATGAGTGCCAGCAGGG - Intergenic
1037249757 8:16878442-16878464 ACAGAGTGTGAGCCAAAGCAGGG + Intergenic
1037459591 8:19095484-19095506 GGAGAGAATGGGCCACAGGCAGG + Intergenic
1037620501 8:20559416-20559438 AGAAAGACTGAGGCACAGAAAGG + Intergenic
1037621463 8:20567042-20567064 AGAGAGACAGACCCACAGCAGGG + Intergenic
1037666762 8:20976431-20976453 AGAGAGACAGAGACACAGAATGG + Intergenic
1038819768 8:30941645-30941667 ACAGTGAAAGAGTCACAGCATGG - Intergenic
1039118087 8:34114690-34114712 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1039624385 8:39032645-39032667 ACAGAGGGTGAGCCAAAGCAGGG - Intronic
1040279296 8:46030141-46030163 AGAGAGAAAGAGACATAGAAAGG + Intergenic
1040369795 8:46758072-46758094 ATTGAGCATGAGCCAAAGCAGGG - Intergenic
1040403364 8:47075673-47075695 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
1040449861 8:47534099-47534121 AGAGAGAATGAGTGCCAGCAGGG - Intronic
1040710711 8:50185266-50185288 AAAGAGAATGAGTGCCAGCAGGG - Intronic
1040838094 8:51753834-51753856 AGAGATATTGACCCACAGCCTGG + Intronic
1041121083 8:54586962-54586984 ACCGAGCATGAGCCAAAGCAGGG - Intergenic
1041302641 8:56429258-56429280 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
1041849988 8:62379614-62379636 AGAGAGAATGAGTACAAGCAGGG - Intronic
1042029863 8:64464174-64464196 AGAGAGAGTGAGTGCCAGCAGGG - Intergenic
1042204777 8:66317965-66317987 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
1042645327 8:70980236-70980258 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
1043089226 8:75876299-75876321 ACAGAGGATGAGCCGAAGCAGGG - Intergenic
1043289728 8:78582375-78582397 AGAGAGAATGAGTGCAAGCAGGG + Intronic
1043366403 8:79537738-79537760 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
1043646641 8:82529729-82529751 AGAGAGAAAGAGAAACAGCGGGG - Intergenic
1043704259 8:83329476-83329498 AGAGAGAATGAGCGCAAGCAGGG + Intergenic
1043704498 8:83331352-83331374 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1044007858 8:86960157-86960179 ACAGAGTGTGAGCCAAAGCAGGG + Intronic
1044131010 8:88525029-88525051 ATGGAGGATGAGCCAAAGCAAGG + Intergenic
1044164125 8:88959477-88959499 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
1044275683 8:90297031-90297053 AGAGAAAATGAGTGCCAGCAGGG + Intergenic
1044358837 8:91257964-91257986 AGAGAGAATGAGTGCAAGCAGGG + Intronic
1044534101 8:93339813-93339835 AGAAAGAATGAGTGGCAGCAGGG + Intergenic
1044546533 8:93466473-93466495 ACGGAGCATGAGCCAAAGCAGGG + Intergenic
1044839475 8:96325718-96325740 AGAGAGAATGATTCTTAGCAGGG - Intronic
1045143586 8:99314135-99314157 AACGAGCATGAGCCAAAGCAGGG - Intronic
1045360219 8:101425925-101425947 ACCGAGCATGAGCCAAAGCATGG + Intergenic
1045603899 8:103750727-103750749 AGAGAGAATGAGTGCCAGCAGGG - Intronic
1045838399 8:106550655-106550677 AGAGAGAATGATCAAGAGCAGGG - Intronic
1046136817 8:110037919-110037941 AAAGAGAATGAGTGCCAGCAGGG - Intergenic
1047060593 8:121220369-121220391 AGAGAGAATGGGTACCAGCAGGG + Intergenic
1047347899 8:124046336-124046358 AGAGAGAAAGAAACACAGAAAGG - Intronic
1047613144 8:126540311-126540333 AGAAAGAATGAGAGCCAGCAGGG - Intergenic
1047666720 8:127099670-127099692 AGAGAAAATGAGGCACAGTGAGG + Intergenic
1047869820 8:129070509-129070531 AGAGAGAATGAATGCCAGCAGGG - Intergenic
1048069669 8:131008437-131008459 AGAGAGAATGAGTGCCAGCAGGG - Intronic
1048069807 8:131009476-131009498 AGATAGAATGAGTGCCAGCAGGG - Intronic
1048377470 8:133835188-133835210 AAGGAGAATGAGGCACAGAAAGG + Intergenic
1048510495 8:135057487-135057509 AGAGAGAGTGAGTGCCAGCAGGG - Intergenic
1048519464 8:135140255-135140277 AGAGAGAATGAGTGCCTGCAGGG - Intergenic
1048552793 8:135449241-135449263 AGAAAGAAAGGGCCACAACAGGG + Intergenic
1048673301 8:136747850-136747872 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
1048681790 8:136850806-136850828 AGAGAGAGTGAGCAAGAGCAGGG + Intergenic
1048702819 8:137112858-137112880 AGTGAAAATCAGCCACAGAATGG - Intergenic
1048757115 8:137752017-137752039 AGAGAGAATGAGTGCAAGCACGG + Intergenic
1049395954 8:142400827-142400849 GGAGAGACTGAGACACAGAATGG - Intronic
1049489424 8:142886893-142886915 AGAGAGAATGAGTGCAAGCACGG + Intronic
1049529866 8:143148862-143148884 AGAGAGAATGAGCCACCGGGTGG + Intergenic
1049746604 8:144265756-144265778 AGAGGGAAGGACCCTCAGCAGGG - Intronic
1049998556 9:1052482-1052504 AGAGTGGTTGATCCACAGCACGG + Intronic
1050201421 9:3149282-3149304 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
1051199354 9:14599289-14599311 ACAGAGGATGAGCCAAAGCAGGG + Intergenic
1051285731 9:15493704-15493726 AGAGGGAATGAGCGCAAGCAGGG + Intronic
1051431343 9:16983829-16983851 AGAAAGAATGAGTGCCAGCAGGG - Intergenic
1051551387 9:18333364-18333386 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1051614796 9:18997112-18997134 ACAGAGGATGAGCCAAAGCAGGG + Intronic
1052125220 9:24765704-24765726 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
1052382418 9:27785483-27785505 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
1052770459 9:32684279-32684301 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
1052799987 9:32957951-32957973 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
1052813970 9:33085587-33085609 ACAGAGTGTGAGCCAAAGCAAGG + Intergenic
1053371193 9:37563143-37563165 AGAGAGAATGAGTGCAAGCAGGG - Intronic
1053474939 9:38375851-38375873 AGAGAGAATCAGCCCCAGCCTGG - Intergenic
1053481895 9:38422234-38422256 AAAGAGACTGAGACACAGCAAGG - Intronic
1053582925 9:39425788-39425810 ATGGAGCATGAGCCAAAGCAGGG + Intergenic
1053847108 9:42250653-42250675 ATGGAGCATGAGCCAAAGCAGGG + Intergenic
1054104504 9:60984531-60984553 ATGGAGCATGAGCCAAAGCAGGG + Intergenic
1054581838 9:66922318-66922340 ATGGAGCATGAGCCAAAGCAGGG - Intronic
1055372404 9:75614096-75614118 AAAGAAACTGAGACACAGCAAGG + Intergenic
1055504451 9:76933570-76933592 AGAGAAAATGAGTCACAGAGAGG + Intergenic
1055559443 9:77508096-77508118 ATAGAGAATGAGAGAGAGCAGGG - Intronic
1055571685 9:77623612-77623634 ACGGAGAGTGAGCCAAAGCAGGG + Intronic
1055767041 9:79674495-79674517 AGATAGGAGGAGCCCCAGCAAGG + Intronic
1056005170 9:82261757-82261779 AGAGAGAATGAGTGCCAGCAAGG - Intergenic
1056041345 9:82670476-82670498 AGAGAGAAAGAGACAGAGGAAGG + Intergenic
1056083458 9:83121663-83121685 ATGGAGCATGAGCCAGAGCAGGG - Intergenic
1056742840 9:89275130-89275152 AGAGAGAATGAGTAACAGCAGGG + Intergenic
1056771708 9:89482227-89482249 ACAGAGAATGTGCACCAGCAAGG + Intronic
1057138433 9:92711514-92711536 TGAGAAAATGAGGCAGAGCATGG - Exonic
1057711943 9:97453521-97453543 AGAGAGAATGAAGAACAGTATGG + Intronic
1057914648 9:99046598-99046620 AGAGAGAATAAGTGCCAGCAGGG + Intronic
1058120522 9:101133902-101133924 GGAGAAAATGAAGCACAGCAAGG - Intronic
1058161210 9:101572316-101572338 AGAGAGAAAAAGGCAAAGCAAGG - Exonic
1058367110 9:104221282-104221304 ACTGAGCATGAGCCAAAGCAGGG - Intergenic
1059350789 9:113663377-113663399 AGGGAGAATGTGGCACAGGATGG - Intergenic
1059474652 9:114535426-114535448 ACAGAGAATGAGCGCCAGCAGGG + Intergenic
1059532053 9:115044155-115044177 TGAGAGGAGGAGCTACAGCAGGG + Intronic
1059822239 9:117986050-117986072 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1060147000 9:121261508-121261530 CGAGAAACTGAGGCACAGCAAGG - Intronic
1060487072 9:124054516-124054538 AGAGAGCCTGAGGCACAGCTGGG - Intergenic
1060598323 9:124861565-124861587 AGAGAGAGTGTGCCTCAGCCAGG + Intronic
1060740860 9:126096780-126096802 GGAGAGACAGAGTCACAGCAGGG - Intergenic
1060861816 9:126960928-126960950 AGAGAGACTGAGAGACAGGAAGG - Intronic
1060902247 9:127269876-127269898 AGAGTAAATAAGCCACAGAATGG - Intronic
1061603377 9:131688059-131688081 AAGGAAAATGAGCCACAGCCAGG + Intronic
1061779787 9:132988864-132988886 AGGGAGACTGAGCCACAGAGAGG + Intronic
1062217678 9:135398181-135398203 AGGGATACTGAGGCACAGCACGG + Intergenic
1185792081 X:2934866-2934888 AGGGGGAACGGGCCACAGCAGGG + Exonic
1185925942 X:4146537-4146559 AGATTTAATGAGCCACAGCAAGG - Intergenic
1186045502 X:5532535-5532557 AGACAGAAGGAGCAACAGAAAGG + Intergenic
1186385513 X:9106616-9106638 AGAGAGAATGAGTGCCAGCAGGG - Intronic
1186775885 X:12864262-12864284 ACCGAGCATGAGCCAAAGCAGGG - Intergenic
1186845244 X:13524307-13524329 AGAGTCAAGGAACCACAGCATGG + Intergenic
1187626576 X:21121363-21121385 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1187711818 X:22061997-22062019 AGAGAGAGTGAGCAAGAGCAGGG + Intronic
1187941115 X:24382603-24382625 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1188084077 X:25882382-25882404 AGGGAGGGTGAGCCAAAGCAGGG + Intergenic
1188587808 X:31799380-31799402 AGGGAGAATGAGTGCCAGCAGGG + Intronic
1188588075 X:31801242-31801264 AGAGAGAATGAGTGCCAGCAAGG + Intronic
1188735881 X:33715148-33715170 AGAGAGAATAAGTGCCAGCAGGG + Intergenic
1188974017 X:36651986-36652008 AGAGAGAATGAGTGAAAGCAGGG + Intergenic
1189071429 X:37867601-37867623 AGAGAGAATGAGTGCAAGCAGGG + Intronic
1189176691 X:38964461-38964483 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1189200086 X:39186328-39186350 ACCGAGTATGAGCCAAAGCAGGG - Intergenic
1189277404 X:39797102-39797124 AGAGAGAATGATTCACCACAGGG - Intergenic
1189589455 X:42496177-42496199 AGAGTGAATGAGGCATAGCATGG + Intergenic
1189713507 X:43840632-43840654 ATAGAGGATGAGCCTAAGCAGGG + Intronic
1189887180 X:45559553-45559575 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
1190903055 X:54697649-54697671 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
1191099061 X:56705254-56705276 ACAGAGGGTGAGCCAGAGCAGGG - Intergenic
1191168620 X:57418528-57418550 ATGGAGGATGAGCCAAAGCAGGG - Intronic
1191172837 X:57467274-57467296 AATGAGAGTGAGCCAAAGCAGGG + Intronic
1191593759 X:62919110-62919132 AGAGAGAATGAGTGACAGGAGGG - Intergenic
1191990119 X:67026337-67026359 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
1192045240 X:67665083-67665105 ACCGAGCATGAGCCAAAGCAGGG - Intronic
1192154339 X:68732687-68732709 AGAGAGAACGAGCAAGAGCAGGG + Intergenic
1192159725 X:68775473-68775495 GGGGAGACTGAGACACAGCAAGG - Intergenic
1192243163 X:69350917-69350939 AACGAGCATGAGCCAGAGCAGGG + Intergenic
1192525924 X:71843889-71843911 ACTGAGCATGAGCCAAAGCAGGG - Intergenic
1192545191 X:72007113-72007135 AAAGAGAAGGAGCCAAGGCAAGG + Intergenic
1192685989 X:73305550-73305572 ACCGAGCATGAGCCAAAGCAGGG - Intergenic
1192797791 X:74438781-74438803 ACAGAGAAGAAGCCTCAGCAAGG - Intronic
1193049976 X:77089434-77089456 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
1193051405 X:77103369-77103391 ACTGAGCATGAGCCAAAGCAGGG - Intergenic
1193055213 X:77142999-77143021 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
1193154411 X:78157848-78157870 ATCGAGCATGAGCCAAAGCAGGG - Intergenic
1193510031 X:82388440-82388462 ACTGAGGATGAGCCAAAGCAGGG + Intergenic
1193592472 X:83407291-83407313 AGTGAGAGTGAGCCAAAGCAGGG + Intergenic
1193683998 X:84555704-84555726 ACAGAGTGTGAGCCAAAGCAGGG + Intergenic
1193864878 X:86719635-86719657 AGAGAGAATGACCGCCAACAGGG + Intronic
1193981244 X:88184539-88184561 AAAGAGAAAGAGCAAAAGCAGGG - Intergenic
1194319603 X:92428304-92428326 AGAGAGAATAACACACAGCAAGG - Intronic
1194568260 X:95520877-95520899 AGAGAGAATGAGTGCAAGCAGGG + Intergenic
1194582712 X:95696594-95696616 AGAGAGAATGAGTGCAAGCAGGG - Intergenic
1194582972 X:95698476-95698498 AGAGAGAATGAGTGCAAGCAAGG - Intergenic
1194658064 X:96597790-96597812 ACCGAGCATGAGCCAAAGCAGGG + Intergenic
1194793531 X:98181334-98181356 AGAGACAGTGAGTCACAGCCAGG + Intergenic
1194961133 X:100236778-100236800 ACGGAGAATGAGCCGAAGCAGGG - Intergenic
1195089029 X:101440941-101440963 ACCGAGCATGAGCCAAAGCAGGG - Intronic
1195417590 X:104636810-104636832 ACTGAGCATGAGCCAAAGCAGGG - Intronic
1195512692 X:105735670-105735692 AGAAAGAATAAGGCAAAGCAGGG - Intronic
1195656310 X:107334492-107334514 TGAGAGAGTGAGCAAGAGCAGGG - Intergenic
1195849783 X:109270740-109270762 AGAAAAAATGAGACACAGAAAGG + Intergenic
1195871481 X:109491086-109491108 AGAGAGAATGAGTGCCAGCAGGG - Intergenic
1196098916 X:111828392-111828414 AGAGAGAATGAGTGCCAACAGGG - Intronic
1196176388 X:112643497-112643519 AGAGAGAATGAGTGCAAGCAGGG + Intronic
1196230237 X:113212510-113212532 ACAGAGGGTGAGCCAAAGCAGGG - Intergenic
1196571203 X:117268209-117268231 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
1196599820 X:117589423-117589445 ACAGAGAATGAGGAAAAGCAGGG + Intergenic
1196658185 X:118241860-118241882 ACTGAGAATCAGCCAAAGCAGGG + Intergenic
1196811122 X:119629669-119629691 AGAGAGAACGATCCAGAGCATGG - Intronic
1196901813 X:120391039-120391061 ACTGAGCATGAGCCAAAGCAGGG - Intergenic
1197099003 X:122629305-122629327 AGAAAGAATGAGTGTCAGCAGGG - Intergenic
1197109338 X:122755056-122755078 AGGGAGAATGAGTGCCAGCAGGG + Intergenic
1197164308 X:123359776-123359798 GGAGAACATGAGCCATAGCAGGG + Intronic
1197403667 X:126025428-126025450 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
1197432428 X:126383307-126383329 ACTGAGCATGAGCCAAAGCATGG + Intergenic
1197886509 X:131223659-131223681 AGAGAGCATGAGGCACAAGAAGG + Intergenic
1197909125 X:131461755-131461777 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
1197970336 X:132108838-132108860 AGAGAGAATGAGTGCAAGCAGGG - Intronic
1198247627 X:134846132-134846154 AGATAGAATGAGTGCCAGCAGGG + Intronic
1198629116 X:138615857-138615879 AGAGAGAATGAGTGCCAGCAGGG + Intergenic
1198780883 X:140234236-140234258 AGAGAGAATGAGTGCCAGCAAGG - Intergenic
1198992236 X:142528002-142528024 AGAGAGAATAAGTGCCAGCAGGG + Intergenic
1199070533 X:143470112-143470134 AGAGAGAATGAGTGACAGCAAGG + Intergenic
1199174080 X:144764236-144764258 AGAGAAAATGAGTGCCAGCAGGG + Intergenic
1199486423 X:148352867-148352889 ACCGAGCATGAGCCAAAGCAGGG - Intergenic
1199505564 X:148557573-148557595 AGAGAGAAAGAGAGAGAGCAAGG + Intronic
1199775978 X:151012459-151012481 AGAGAGAATGAGTACAAGCAGGG + Intergenic
1199911065 X:152287468-152287490 AGAGAGAATGAGTGCCAGCAGGG - Intronic
1200041231 X:153371381-153371403 TGAGAAAATGAGACAAAGCAAGG - Intergenic
1200627729 Y:5541385-5541407 AGAGAGAATAACACACAGCAAGG - Intronic
1200709508 Y:6470871-6470893 ATAGAGTATGAGCCACAATAAGG - Intergenic
1200737335 Y:6813998-6814020 ACAGAGGGTGAGCCAAAGCAGGG + Intergenic
1200792519 Y:7312412-7312434 GGAGAGAATGTGCCTTAGCATGG + Intergenic
1200808064 Y:7453094-7453116 ACAGAGAATGGGACACAGAAAGG + Intergenic
1200879075 Y:8193626-8193648 ACTGAGCATGAGCCAGAGCAGGG + Intergenic
1200893002 Y:8343500-8343522 ATAGAGACAGAGTCACAGCAGGG + Intergenic
1200939866 Y:8770059-8770081 AGAGACAATGATCCACAACCTGG + Intergenic
1201024604 Y:9693837-9693859 ATAGAGTATGAGCCACAATAAGG + Intergenic
1201281601 Y:12347437-12347459 AGGGGGAATGGGCCACAGCAGGG - Intergenic
1201494321 Y:14576557-14576579 ACCGAGCATGAGCCAAAGCAGGG - Intronic
1201684258 Y:16683364-16683386 ACTGAGAGTGAGCCAAAGCAGGG + Intergenic
1201765490 Y:17570322-17570344 AAAGAGAAAGAGACATAGCAAGG + Intergenic
1201836062 Y:18335667-18335689 AAAGAGAAAGAGACATAGCAAGG - Intergenic
1201969814 Y:19779823-19779845 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
1201975083 Y:19840062-19840084 AGTGAGCATGAGCCAAAGGAGGG - Intergenic
1202059729 Y:20873808-20873830 AGAGAGAATGAGTACAAGCAGGG + Intergenic
1202064985 Y:20929618-20929640 AGGGAGTGTGAGCCAAAGCAGGG + Intergenic
1202066301 Y:20943754-20943776 ACCGAGCATGAGCCAAAGCAGGG - Intergenic
1202085245 Y:21129485-21129507 ACTGAGTATGAGCCAAAGCACGG - Intergenic
1202166633 Y:21996093-21996115 AGTGAGCATGACCCAAAGCAGGG - Intergenic
1202170739 Y:22041082-22041104 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
1202220624 Y:22545291-22545313 ACTGAGCATGAGCCAAAGCAGGG - Intergenic
1202224725 Y:22590280-22590302 AGTGAGCATGACCCAAAGCAGGG + Intergenic
1202242143 Y:22781620-22781642 ACTGAGCATGAGCCAAAGCAGGG - Intergenic
1202255876 Y:22919960-22919982 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
1202318389 Y:23605380-23605402 AGTGAGCATGACCCAAAGCAGGG - Intergenic
1202322489 Y:23650372-23650394 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
1202331319 Y:23756441-23756463 AGTGAGTATAAGCCGCAGCAGGG + Intergenic
1202408867 Y:24553713-24553735 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
1202461916 Y:25116365-25116387 ACTGAGCATGAGCCAAAGCAGGG - Intergenic
1202475657 Y:25254728-25254750 ACTGAGCATGAGCCAAAGCAGGG + Intergenic
1202539451 Y:25913619-25913641 AGTGAGTATAAGCCGCAGCAGGG - Intergenic
1202548284 Y:26019684-26019706 ACTGAGCATGAGCCAAAGCAGGG - Intergenic
1202552378 Y:26064677-26064699 AGTGAGCATGACCCAAAGCAGGG + Intergenic