ID: 1013607593

View in Genome Browser
Species Human (GRCh38)
Location 6:111764876-111764898
Sequence AAGAGAGAATGAGCCACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 590}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013607593_1013607596 2 Left 1013607593 6:111764876-111764898 CCTGCTGTGGCTCATTCTCTCTT 0: 1
1: 0
2: 2
3: 54
4: 590
Right 1013607596 6:111764901-111764923 TCCCCTTTGCTGGCAGCTGGAGG 0: 1
1: 1
2: 2
3: 40
4: 288
1013607593_1013607604 30 Left 1013607593 6:111764876-111764898 CCTGCTGTGGCTCATTCTCTCTT 0: 1
1: 0
2: 2
3: 54
4: 590
Right 1013607604 6:111764929-111764951 GGGTGCTCTGATGGAACCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 82
1013607593_1013607600 6 Left 1013607593 6:111764876-111764898 CCTGCTGTGGCTCATTCTCTCTT 0: 1
1: 0
2: 2
3: 54
4: 590
Right 1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG No data
1013607593_1013607602 10 Left 1013607593 6:111764876-111764898 CCTGCTGTGGCTCATTCTCTCTT 0: 1
1: 0
2: 2
3: 54
4: 590
Right 1013607602 6:111764909-111764931 GCTGGCAGCTGGAGGCAGGAGGG No data
1013607593_1013607601 9 Left 1013607593 6:111764876-111764898 CCTGCTGTGGCTCATTCTCTCTT 0: 1
1: 0
2: 2
3: 54
4: 590
Right 1013607601 6:111764908-111764930 TGCTGGCAGCTGGAGGCAGGAGG 0: 1
1: 1
2: 9
3: 99
4: 898
1013607593_1013607603 21 Left 1013607593 6:111764876-111764898 CCTGCTGTGGCTCATTCTCTCTT 0: 1
1: 0
2: 2
3: 54
4: 590
Right 1013607603 6:111764920-111764942 GAGGCAGGAGGGTGCTCTGATGG 0: 1
1: 0
2: 6
3: 58
4: 577
1013607593_1013607594 -8 Left 1013607593 6:111764876-111764898 CCTGCTGTGGCTCATTCTCTCTT 0: 1
1: 0
2: 2
3: 54
4: 590
Right 1013607594 6:111764891-111764913 TCTCTCTTGTTCCCCTTTGCTGG 0: 1
1: 0
2: 2
3: 37
4: 303
1013607593_1013607595 -1 Left 1013607593 6:111764876-111764898 CCTGCTGTGGCTCATTCTCTCTT 0: 1
1: 0
2: 2
3: 54
4: 590
Right 1013607595 6:111764898-111764920 TGTTCCCCTTTGCTGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013607593 Original CRISPR AAGAGAGAATGAGCCACAGC AGG (reversed) Intronic
900963124 1:5938284-5938306 CAGAGAGACTGAGCCCCACCAGG + Intronic
901693245 1:10988003-10988025 AAGAGAGAAAGAGACAGAGAGGG + Intergenic
901871332 1:12140758-12140780 TAGGGAGAAGGAGCCACAGCTGG - Intronic
901923705 1:12553023-12553045 AAGGGAGAAGGTGCCAGAGCAGG - Intergenic
902096095 1:13947235-13947257 GAGAGATAATGAGCAAGAGCAGG + Intergenic
902122428 1:14178114-14178136 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
902209161 1:14892413-14892435 CAGAGAGAAAGAGAGACAGCAGG - Intronic
902243018 1:15101250-15101272 AAGAGAGAAAGAGACAGAGAAGG - Intronic
902596069 1:17510158-17510180 AAGAGAGAAAGAGGCAGAGTTGG - Intergenic
902602249 1:17547953-17547975 AACATAGAAAGAGCCCCAGCAGG - Intronic
903370727 1:22833853-22833875 AAGAGATAATGAGGCACAAAGGG + Intronic
903852465 1:26316419-26316441 AAGGGAGAGTGGGCCAGAGCTGG + Intronic
904139874 1:28344347-28344369 CAGAGTGAAAAAGCCACAGCTGG - Intergenic
904567957 1:31439290-31439312 AGGAGAGAGTGAGGCACAGCTGG + Intergenic
904794144 1:33046097-33046119 AAGAGAAATTGAGGCCCAGCAGG - Intronic
904804650 1:33122246-33122268 AAGAGGGAATCAGCTACACCTGG - Intergenic
904874972 1:33647234-33647256 AAGAGAGAATGAGCCAACTATGG + Intronic
905847908 1:41248579-41248601 AACAGAGAATGAGCAGGAGCTGG - Intergenic
905955966 1:41996401-41996423 AAGAGAGAGAGAGACAGAGCTGG + Intronic
906753599 1:48288518-48288540 CACAGAGCATGAGCCAAAGCAGG + Intergenic
907161128 1:52370142-52370164 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
907875102 1:58478201-58478223 AAGAGAGAGTGAGTAAGAGCAGG - Intronic
907887872 1:58610409-58610431 GAGAGAGAGTGAGCAAGAGCAGG + Intergenic
908058647 1:60322108-60322130 AAAAGAAAATGAGCCACTGAAGG + Intergenic
908328503 1:63047133-63047155 TAAAGAGAATGGGCCCCAGCTGG + Intergenic
909083580 1:71145891-71145913 GAGAGAGAATTAGCGAAAGCAGG - Intergenic
909528882 1:76659163-76659185 GAGAGAGAATGAGCAGCATCTGG + Intergenic
909638172 1:77841402-77841424 AAGACAGAATAAGCCACAATTGG - Intronic
909756921 1:79239018-79239040 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
910279743 1:85486071-85486093 AAGAGAGCAAGAGTGACAGCAGG - Intronic
911228335 1:95332463-95332485 GAGAGAGAATGAGTGCCAGCTGG - Intergenic
912544305 1:110440046-110440068 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
912567549 1:110599114-110599136 AAGGGAGAGTGAGACACAACGGG + Intronic
913607357 1:120478303-120478325 CATAGAGGATGAGCCAAAGCAGG + Intergenic
914583837 1:149043531-149043553 CATAGAGGATGAGCCAAAGCAGG - Intronic
914873286 1:151493235-151493257 GAGAGTGAATGAGCCACTGAAGG + Intergenic
915886750 1:159730592-159730614 CACAGAGCATGAGCCAAAGCAGG + Intergenic
916586300 1:166153216-166153238 AATATGGAAGGAGCCACAGCTGG - Intronic
917139985 1:171826322-171826344 AAGAGAGAATGAGTGCAAGCAGG + Intergenic
917839923 1:178969472-178969494 CAGAGTGAGTGAGCCACAGAGGG - Intergenic
917910590 1:179640829-179640851 AATATAGGATGAGCTACAGCGGG + Intronic
919478984 1:198063249-198063271 TAGGGAGCATGAGCCAAAGCAGG - Intergenic
919612483 1:199762136-199762158 AAGAGAGAAAGAGGGACAGAGGG - Intergenic
919660181 1:200236598-200236620 AAGAGAGGAAGGGTCACAGCTGG - Intergenic
920198035 1:204242615-204242637 GTGAGAGAATGAGCCAGAACAGG + Intronic
921288462 1:213631179-213631201 CACAGAGCATGAGCCAAAGCAGG - Intergenic
921400456 1:214716897-214716919 ATGAGTGAATTAGCCACAGTTGG + Intergenic
921649294 1:217657944-217657966 AAGAGAGAATGAGCAAAAGGAGG + Intronic
921718880 1:218448696-218448718 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
922020545 1:221700064-221700086 AAGAGGGAATGAGGCAAAGTGGG + Intergenic
922703149 1:227774046-227774068 TAGAGAGATGGATCCACAGCAGG - Intronic
922905314 1:229169481-229169503 AAGAAAGACACAGCCACAGCTGG + Intergenic
923311832 1:232742983-232743005 AAGAGAGAATGAGCTTGTGCAGG - Intergenic
923410201 1:233700572-233700594 AAGAGAAAATTAGAAACAGCAGG - Intergenic
923495340 1:234519720-234519742 AAGTAATAATGAGTCACAGCTGG + Intergenic
923932256 1:238714395-238714417 GAGAGAGAGAGAGCCACAGAGGG + Intergenic
1062832471 10:614957-614979 AAGAGACAATGACACCCAGCTGG + Intronic
1062910857 10:1211061-1211083 ATGGGAGGCTGAGCCACAGCAGG - Intronic
1063243743 10:4196828-4196850 AGGAGAGAATGAGACAAAGTTGG - Intergenic
1063529940 10:6821228-6821250 AAGAGAGTTTGAGTCTCAGCTGG + Intergenic
1063769546 10:9182303-9182325 GAGAGAGAGTGAGCAAGAGCAGG + Intergenic
1063967734 10:11359903-11359925 AAGACAGAATGAACCTCAGAGGG + Intergenic
1064119061 10:12603654-12603676 AGGGGAGAATGATCCCCAGCGGG - Intronic
1064854080 10:19745643-19745665 AAGAGAGAAAGAGACAGAGAGGG - Intronic
1065930608 10:30475597-30475619 AAGAGAGAAAGAGACAAAGAGGG + Intergenic
1067268764 10:44771736-44771758 CAGAATGAAAGAGCCACAGCAGG + Intergenic
1068282586 10:54894753-54894775 GAGAGAGAATTAGCCAAAGCAGG + Intronic
1068452518 10:57211059-57211081 AAGGGAGAACGAGCAACAGCAGG + Intergenic
1068549580 10:58391337-58391359 AGGAAAGACTAAGCCACAGCAGG - Intronic
1069418569 10:68224798-68224820 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1069551440 10:69367158-69367180 AACAGAGAAGGAGCCAGAGGTGG + Intronic
1069803069 10:71094260-71094282 AAGACAGAGTGAGCAAGAGCAGG - Intergenic
1070064644 10:73021657-73021679 CATAGAGAATGAGCCAAAGCAGG + Intronic
1070839275 10:79472061-79472083 AAGGGAGAAGGAGTGACAGCTGG + Intergenic
1071900834 10:90119030-90119052 CACAGAGCATGAGCCAAAGCAGG - Intergenic
1072363292 10:94682251-94682273 AAGTGAGAATATACCACAGCGGG + Intergenic
1073380116 10:103072001-103072023 AGGAAAGCATAAGCCACAGCAGG + Intronic
1073829257 10:107363006-107363028 AAGAGGGAATGAGTGCCAGCAGG - Intergenic
1074017095 10:109545479-109545501 CACAGAGGGTGAGCCACAGCAGG + Intergenic
1074045883 10:109838589-109838611 CAGAGAGAATGGGCAACATCAGG + Intergenic
1074521135 10:114225134-114225156 CTGAGAGAATGAACCACAGAGGG - Intronic
1075126535 10:119704797-119704819 AAGAGAAACTCAGCCACAGGTGG + Intergenic
1075989227 10:126819658-126819680 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1076531977 10:131150922-131150944 GAGAGAGAATGAGTGCCAGCAGG + Intronic
1076585045 10:131541349-131541371 AAGAGAGAGTGAGCAGGAGCAGG + Intergenic
1077193198 11:1264572-1264594 TAGAGAGAATGAGACCTAGCAGG + Intergenic
1077218864 11:1406478-1406500 AAGATAAACTGAGCCACACCTGG + Intronic
1077985368 11:7346325-7346347 AAGAGAGGATGAGCAGCAGAGGG + Intronic
1078193076 11:9109447-9109469 GAGAGAGAATGAGTACCAGCAGG - Intronic
1078452040 11:11447663-11447685 GAGAGAGAATGAGAGCCAGCAGG + Intronic
1079157866 11:17965237-17965259 CAGAGAGAATGAGAGCCAGCAGG - Intronic
1079322004 11:19458935-19458957 GAGACAGCATGAGCCACAGCAGG + Intronic
1079718945 11:23786785-23786807 GAGAGAGAATGAGTGTCAGCAGG + Intergenic
1079804454 11:24911535-24911557 AAGAGAGAGTGAGTGCCAGCAGG - Intronic
1079827357 11:25213944-25213966 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1079949701 11:26785607-26785629 AAGAGAGAATGAGCACCAGCTGG - Intergenic
1080245620 11:30176716-30176738 GAGAGAGAATGAGAACCAGCAGG + Intergenic
1080959159 11:37137699-37137721 GAGAGAGAATGAGGGCCAGCAGG + Intergenic
1081143867 11:39536782-39536804 CACAGAGAGTGAGCCAAAGCAGG - Intergenic
1081181082 11:39986432-39986454 AAGAGAGAAAGAGACAAAGAAGG + Intergenic
1081393687 11:42559985-42560007 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1081445005 11:43122693-43122715 AAGGGAGAATGAGTGCCAGCAGG - Intergenic
1083049125 11:59761458-59761480 AAGAGAGAATGAGACATATGTGG - Intronic
1084492849 11:69487866-69487888 AAGGGACAAAGAGGCACAGCCGG - Intergenic
1084719988 11:70899312-70899334 GAGAGAGAATGAGTGTCAGCAGG - Intronic
1085607768 11:77918133-77918155 AAGAAAGAATGAGCCTAGGCCGG + Intronic
1086424336 11:86669510-86669532 GAGAGAGAATGAGCGCTAGCAGG + Intronic
1086837005 11:91637427-91637449 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1087793781 11:102433845-102433867 GAGAGAGAATGAGTGCCAGCAGG - Intronic
1087877616 11:103376117-103376139 GAGAGAGAATGAGTGCCAGCAGG - Intronic
1087989347 11:104729176-104729198 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1089279721 11:117365325-117365347 ATGAGTGAATGAGCCACCTCGGG + Intronic
1089655078 11:119941279-119941301 AAGAAAGGAGGATCCACAGCAGG - Intergenic
1089807702 11:121106274-121106296 AAGATACAATGAACCACAGTAGG + Intronic
1091547978 12:1517205-1517227 AAGAGAGAATGATCCACTCCTGG - Intergenic
1091983149 12:4882805-4882827 AAGAGAAAATGAGAGACAGAAGG + Intergenic
1092041589 12:5389738-5389760 AAGAGAAATTGGGCCAAAGCAGG + Intergenic
1093092428 12:14936731-14936753 GAGAGAGAATGAGCACAAGCAGG - Intronic
1093128008 12:15353490-15353512 AAGTCAGAATGAGCCAAATCAGG + Intronic
1094236871 12:28177990-28178012 GAGAGAGAATGAGCAAGAGCAGG - Intronic
1094270586 12:28609950-28609972 AAGAGAGAATGAGGTATGGCAGG - Intergenic
1094480785 12:30879911-30879933 GAGAGAGATTGAGCCCCTGCAGG - Intergenic
1095612056 12:44140936-44140958 AAGACAGCATGACACACAGCTGG - Intronic
1096044946 12:48554170-48554192 CACAGAGCATGAGCCAAAGCAGG - Intergenic
1096516871 12:52161187-52161209 AAGAGAGAATGACTCAAAGATGG - Intergenic
1096684963 12:53282237-53282259 AGGAGAGAAGGAGCCAGAGGAGG - Intronic
1097917518 12:65036423-65036445 CACAGAGCATGAGCCAAAGCAGG - Intergenic
1098547213 12:71724970-71724992 AAGTAAGAAGGAGCCACATCAGG + Intergenic
1098730114 12:74025133-74025155 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1099062468 12:77929020-77929042 AACAGAGAATTCACCACAGCAGG - Intronic
1099593139 12:84621670-84621692 AAGAGAGAAGGATCAATAGCAGG + Intergenic
1099745674 12:86701531-86701553 AAGAGAGATTGGGAAACAGCTGG - Intronic
1099799967 12:87444336-87444358 AAGAAAGAATGAGCCCTAGCTGG + Intergenic
1099806851 12:87531124-87531146 CAGGGAGCATGAGCCAAAGCAGG + Intergenic
1099939762 12:89172119-89172141 AAGTCAGAAGGAGCCACATCAGG + Intergenic
1100327274 12:93551386-93551408 AAGAGAGAGCCAGCCACTGCAGG + Intergenic
1100399602 12:94217343-94217365 AAGAGAGGAAGAGCCAAAACTGG - Intronic
1101308222 12:103552892-103552914 AAGAGAGAACAAGCAAGAGCAGG + Intergenic
1101339609 12:103831254-103831276 GAGAGAGAATGAGTGCCAGCAGG - Intronic
1101581272 12:106043298-106043320 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
1103894070 12:124261763-124261785 AAGGGAGTATGAGCCATATCTGG + Intronic
1103939003 12:124491882-124491904 TGGAGAGAATGAGGCACAGAGGG + Intronic
1104130001 12:125884361-125884383 GAGAGAGAATGAGTGCCAGCTGG - Intergenic
1104746369 12:131213519-131213541 GAGAGAGAATGAGCACCAGCAGG + Intergenic
1104996519 12:132661219-132661241 CAGAGAGGATGAGGCACAGCTGG - Intronic
1105014420 12:132777446-132777468 AAGAGAGAAAGCGCCCCAGCAGG - Intronic
1105809845 13:23985417-23985439 AAGAGGAAAGAAGCCACAGCAGG - Intronic
1106838491 13:33661615-33661637 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
1107039813 13:35936845-35936867 GAGAGAGACTCAGCCAAAGCTGG + Intronic
1107179099 13:37436842-37436864 AAGTGAGAGTGAGCCAGAACGGG + Intergenic
1108106545 13:47016765-47016787 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1108587739 13:51885401-51885423 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
1108855661 13:54789734-54789756 CAGCCAGAATGAGCCACAACTGG - Intergenic
1109300532 13:60585759-60585781 AAAAGAAAATGTGCCACAACGGG - Intergenic
1110359544 13:74609827-74609849 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1110401209 13:75093888-75093910 GAGAGAGAATGAGAGCCAGCAGG - Intergenic
1111107936 13:83670190-83670212 AAGAGAGAAGGAGTGCCAGCAGG - Intergenic
1111363517 13:87208844-87208866 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1111457611 13:88505575-88505597 GAGAGAGAATGAGTATCAGCAGG - Intergenic
1112331294 13:98478849-98478871 GAGTGAGGATGAGCCACAGAGGG - Intronic
1113284816 13:108835305-108835327 GAGAGAGAATGAGTGCCAGCAGG - Intronic
1113341296 13:109428714-109428736 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1115892142 14:38042898-38042920 AATAGAGAAAGACCCAGAGCTGG - Intergenic
1115959870 14:38823506-38823528 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1116267495 14:42712497-42712519 AAGAGAGAATGAGGGCCAGCAGG + Intergenic
1116332983 14:43618308-43618330 AAGAGAGAATGAGTGCCAGCAGG - Intergenic
1117044776 14:51802305-51802327 CAGAGAGAAGGACCCAGAGCAGG + Intergenic
1117214491 14:53536531-53536553 CAGATGGAGTGAGCCACAGCAGG - Intergenic
1118149467 14:63173955-63173977 AAGGGAGAATGAGTGAGAGCTGG + Intergenic
1118347321 14:64949859-64949881 AGGAGACAAAGAGCCACAGCTGG - Intronic
1119586360 14:75839556-75839578 GAGAGAGAATGAGTGCCAGCAGG + Intronic
1120279683 14:82423062-82423084 TAGAGAGAATGAGTTCCAGCAGG + Intergenic
1120334959 14:83142963-83142985 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
1120607818 14:86601544-86601566 AAGACAAAAAGAGCCACAGAAGG + Intergenic
1121488295 14:94338399-94338421 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
1121893432 14:97621292-97621314 AAGAGAGAATGAAAGACAACAGG - Intergenic
1122477288 14:102019381-102019403 AAGAGCGAGGGAGACACAGCAGG - Intronic
1122638470 14:103142200-103142222 ATGACAGAATGAGCCCCAGATGG + Intergenic
1122839586 14:104450753-104450775 GAGAGAGAATGAGTGTCAGCAGG + Intergenic
1123628636 15:22245347-22245369 AAGAGAGAAAGAGTGCCAGCAGG - Intergenic
1124125613 15:26936104-26936126 AAGAGAGAATGAGTGCGAGCAGG - Intronic
1124841306 15:33244556-33244578 AAGAGAGAATGGGGCAGAGTGGG + Intergenic
1125738584 15:41945483-41945505 AAGAGAGGATGAGGAGCAGCAGG + Intronic
1125909314 15:43421816-43421838 CAGAGAGAGAGAGCCACAGCAGG - Intronic
1125971237 15:43913410-43913432 GAGAGAGAATGAGCTGCACCAGG + Intronic
1126064191 15:44812545-44812567 TAAAGAGGATGAGCCACTGCAGG - Intergenic
1126810193 15:52394599-52394621 AAGAGAGAAGGAGAAACAGGTGG + Intronic
1127092529 15:55481019-55481041 GAGAGAGAATGAGCACCAGCAGG - Intronic
1127325443 15:57890262-57890284 AAGAGAGAAGTAGCCAGAGAGGG - Intergenic
1127808370 15:62541639-62541661 GAAAGAGAATGAGCCATAGACGG + Intronic
1127890830 15:63249507-63249529 AAAGGAGAATGAGACACAGAGGG - Intronic
1130656040 15:85792827-85792849 AGGAGAGAAGGAGACACAGGTGG - Intronic
1131057944 15:89387190-89387212 AAGAGGGACTGTGCCACATCTGG + Intergenic
1131811613 15:96179426-96179448 AAAAGAGAATGAGCCAGAAGTGG - Intergenic
1131921569 15:97333768-97333790 AAGAGAGAATGAGTGTCAGCAGG - Intergenic
1132311884 15:100863197-100863219 GAGAGAGGCTGAGCCAGAGCTGG - Intergenic
1132421749 15:101676007-101676029 AAGTGAGACTGAGCTGCAGCAGG + Intronic
1133327917 16:4953348-4953370 AGGAGAGAATGGAACACAGCGGG - Intronic
1134404419 16:13943410-13943432 GAGAGAGAATGAGTGCCAGCAGG + Intronic
1134751911 16:16631861-16631883 CAGAGAGAATGAGCAGGAGCAGG - Intergenic
1134993559 16:18721842-18721864 CAGAGAGAATGAGCAGGAGCAGG + Intergenic
1135529093 16:23237303-23237325 AAGAGAGAAAGAGAGACAGAGGG - Intergenic
1136600605 16:31284694-31284716 CACAGAGTATGAGCCAAAGCAGG - Intronic
1137403799 16:48174697-48174719 CAGAGAGAATAAGCTACATCTGG + Intronic
1137883113 16:52073305-52073327 AAGACAGAATGAGACTCAGATGG + Intronic
1137982088 16:53078638-53078660 AAAATAAAATGAGCCACATCTGG + Intronic
1138358885 16:56409340-56409362 TAATGTGAATGAGCCACAGCAGG - Intronic
1139025913 16:62817520-62817542 AAGAGAGAGAGAGAAACAGCTGG - Intergenic
1139129983 16:64131765-64131787 AAGAGGGACCTAGCCACAGCAGG - Intergenic
1139922124 16:70467116-70467138 CAGACAGACTGAGGCACAGCAGG - Intronic
1139964328 16:70737185-70737207 AAGAGCAGATGAGCCAGAGCCGG - Intronic
1140179143 16:72696346-72696368 AACCGAGCATGAGCCAAAGCAGG - Intergenic
1140270783 16:73464795-73464817 AAGAGAGAAGGACCCAAAGGCGG - Intergenic
1140908770 16:79432202-79432224 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1141777907 16:86136526-86136548 AGGAGAGAACCAGCCACAGGAGG + Intergenic
1141945675 16:87307985-87308007 AAGACAGAAAGAGCCAAATCAGG + Intronic
1142489018 17:265992-266014 AAGAGGGTCTGAGCCACACCAGG + Intronic
1142681008 17:1548632-1548654 AAGGGGTGATGAGCCACAGCAGG - Intronic
1143238229 17:5421303-5421325 TGGAGAGAATGAGAAACAGCCGG + Exonic
1144433854 17:15221595-15221617 ATTAGAGAATTAGCAACAGCTGG + Intergenic
1144453634 17:15401355-15401377 AAGACAGAAGGAGCCAAATCAGG + Intergenic
1144575946 17:16429608-16429630 AAGAATGATTCAGCCACAGCAGG + Intronic
1145908306 17:28528335-28528357 GACAGAGATTGAGCCACAGAAGG + Intronic
1145915722 17:28572935-28572957 AAGAGAGCAAGAGCCTGAGCTGG + Intronic
1146460534 17:33042736-33042758 AAGAAAGAATATACCACAGCAGG + Intronic
1146645052 17:34571740-34571762 AAGAGAGCAAGAGCCAGAGACGG - Intergenic
1146645054 17:34571776-34571798 AAGAGAGCAAGAGCCAGAGACGG - Intergenic
1148443750 17:47725588-47725610 CAGAGGGAAGAAGCCACAGCCGG - Intergenic
1149242922 17:54671605-54671627 AAAAGAGAATCAGGTACAGCTGG + Intergenic
1149635769 17:58168125-58168147 AAGAGAGATTGAGACAGGGCAGG + Intergenic
1151189953 17:72391067-72391089 GAGAGAGAATGAGAGCCAGCAGG + Intergenic
1151291326 17:73152393-73152415 GAGAGAGAATGAGGTTCAGCAGG - Intergenic
1151387918 17:73766571-73766593 AAGAGAGAGTGAGCAAAGGCTGG + Intergenic
1152178399 17:78802444-78802466 AAGAAAGCAGGAGACACAGCGGG - Exonic
1152384882 17:79966495-79966517 AAGAGAGAGAGAGGCAGAGCAGG - Intronic
1152630310 17:81408042-81408064 AAGGGAGGCTGAGCCACAGAGGG - Intronic
1153164212 18:2243589-2243611 AAGACACAATGAACCACTGCTGG - Intergenic
1153345538 18:4021382-4021404 AAGAGAGAAAGAGAGACAGTGGG - Intronic
1153443339 18:5145616-5145638 AAGAGAGAATCAGTGACAACCGG - Exonic
1155059585 18:22216979-22217001 AAGAGAGAATGAAAAAGAGCGGG + Intergenic
1155566565 18:27141757-27141779 AAAAGAAAATGGGCCACAACTGG + Intronic
1156760114 18:40578599-40578621 AAGAATGACTCAGCCACAGCTGG - Intergenic
1157112930 18:44838001-44838023 AAGAGAAAACAAGCCACAGTGGG - Intronic
1157198019 18:45635683-45635705 CAGAGAAACGGAGCCACAGCTGG + Intronic
1157407162 18:47431551-47431573 AAGAGTGAAGGAGCCACACACGG - Intergenic
1157752175 18:50189050-50189072 GACAGAGAATGAGCCTCAGAAGG + Intronic
1158160918 18:54482702-54482724 AGGAGGGAAAGAGCCACAGAGGG - Intergenic
1158206741 18:55001424-55001446 AAGAGAGCTGGAGCCTCAGCAGG + Intergenic
1158728122 18:59993340-59993362 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1158773442 18:60549544-60549566 CACAGAGAATGAGCCATAGAGGG - Intergenic
1158799345 18:60888158-60888180 AAGAGAGAATGAATGCCAGCAGG + Intergenic
1159003787 18:62995171-62995193 AAGCGAGAATGAGCGCCAGCAGG - Intergenic
1159349891 18:67258865-67258887 AAGAGAGAATGAGCCTATTCAGG - Intergenic
1159436849 18:68429269-68429291 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
1159867624 18:73724976-73724998 AAGAGAAAAGGAGACACTGCTGG + Intergenic
1160302876 18:77702198-77702220 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
1161239655 19:3215129-3215151 AGGTGAGGATGAGCCCCAGCGGG + Intergenic
1161773057 19:6241770-6241792 AAGACAGACTGCGCCACAGCTGG + Intronic
1162423530 19:10579972-10579994 CAGAGAGAATGAGCAAAAACTGG + Intronic
1164564335 19:29315100-29315122 AAGGGAGACAGAGCCACATCGGG - Intergenic
1165386597 19:35513800-35513822 AACAGAGAGTGAGCCGCATCAGG + Intergenic
1166011578 19:39946625-39946647 AAGAAAGAAAAAGCCACAGTGGG - Intergenic
1167415609 19:49369940-49369962 GAGAGAGAATGTGCCACCGCAGG + Intronic
1167682522 19:50932838-50932860 AAGTGAGAATCAGCCACCGCTGG + Intergenic
1168236669 19:55068027-55068049 GAGAGAGAAGGAGACACAGGAGG - Intronic
1168648419 19:58076808-58076830 AAGACAGGCAGAGCCACAGCTGG + Intronic
1168696529 19:58407003-58407025 GAGAGAGAAAGGGACACAGCGGG + Intronic
925037130 2:696696-696718 AAGAGAGGCTGAGACACAGCTGG + Intergenic
925394699 2:3524887-3524909 AAGAGAGAAGGAGAGACAGAGGG - Intergenic
925525217 2:4792888-4792910 AAGAGAGAATGAGCTGCACAAGG - Intergenic
925717505 2:6797841-6797863 AACAGAGGTTGGGCCACAGCTGG + Intergenic
926059008 2:9793607-9793629 GAGAGAGAGTGAGCAAAAGCAGG - Intergenic
926446793 2:12952693-12952715 AAGACAGAATGAGTGAAAGCAGG - Intergenic
926620953 2:15047237-15047259 AAGGGAGAAGGAGGCACAGATGG + Intergenic
926956469 2:18306664-18306686 AAGAGAGAATGAGCTTGTGCAGG - Intronic
927343208 2:22006372-22006394 AAGTGAGAAGGAGCCACATCAGG + Intergenic
927526401 2:23745327-23745349 AAGAGAGAAAGAGACAGAGAGGG + Intergenic
927660909 2:24991915-24991937 AAGAGAGAATGAGTGCCAGCAGG - Intergenic
927683407 2:25154818-25154840 AAGAGAGTGAGAGACACAGCAGG - Exonic
928640804 2:33296924-33296946 TAGAGAGAATGAGTTAAAGCAGG + Intronic
928749031 2:34449671-34449693 AAGAGAGAATGAGTGCCAGCCGG - Intergenic
928836867 2:35558084-35558106 GATAGAGAATGAGCGTCAGCAGG - Intergenic
929390652 2:41465048-41465070 AAGAGGGAAATAGCCACAGGGGG - Intergenic
930480398 2:51941834-51941856 AAGAGATCAAGAGCCAGAGCAGG + Intergenic
930675163 2:54192822-54192844 GAGAGAGAATGAGTACCAGCAGG + Intronic
930856481 2:56024607-56024629 ATGAGAAAATGAGCCAGAGATGG - Intergenic
930877209 2:56232556-56232578 GAGAGAGAATGAGGGCCAGCAGG - Intronic
931437050 2:62256650-62256672 AAGAGAGACCGAGCAAGAGCAGG - Intergenic
931540752 2:63326516-63326538 AAGAGAGAAAGAGACAGAGAGGG + Intronic
932164614 2:69494599-69494621 AAAAGACAGTGAGCCCCAGCTGG + Intronic
932619469 2:73257289-73257311 GGGACAGAATGAGCCACAGGAGG + Exonic
933236538 2:79870732-79870754 AGGAGAGAGTGAGCAAGAGCAGG + Intronic
933493328 2:83016644-83016666 AAGAGAGAATGAGTGCCAGCAGG - Intergenic
934516501 2:94991376-94991398 AACAGGGAATGTGCCACAGCAGG + Intergenic
935262761 2:101369328-101369350 GAGGGAGAAGGAGCCACAGCTGG + Intronic
935556380 2:104513756-104513778 GAGAGAGAGTGAGCAAGAGCAGG - Intergenic
936739672 2:115490288-115490310 GAGAGAGAATGAGTGCCAGCAGG + Intronic
936915598 2:117636476-117636498 AAGAGAGAATGAGCATGTGCAGG - Intergenic
936915860 2:117638404-117638426 AAGAGAGAATGAGCTTGTGCAGG - Intergenic
937022652 2:118672431-118672453 AAGAGAAAAAGACCCACAGTTGG + Intergenic
937151251 2:119687495-119687517 GAGAGAGAATGAGTGTCAGCAGG + Intergenic
937209141 2:120256559-120256581 GAGAGAGAATGAGTGCCAGCAGG - Intronic
938339843 2:130528072-130528094 CAGCGAGAAGGAGCCAAAGCTGG + Intronic
938349993 2:130592678-130592700 CAGCGAGAAGGAGCCAAAGCTGG - Intronic
938579773 2:132635544-132635566 AAGAGAGAAGGAGGAAAAGCAGG + Intronic
939384519 2:141478532-141478554 AAGAGAGAATGAGAGAGAGAGGG - Intronic
940751878 2:157635189-157635211 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
941133817 2:161687807-161687829 GAGAGAGAATGAGTGCCAGCAGG - Intronic
941255050 2:163218734-163218756 AAGAGAGATAGAGCCACATTTGG + Intergenic
941488969 2:166119337-166119359 AAGTGAAAATGAGCCAGAGGTGG - Intronic
941600378 2:167536269-167536291 AAGAGAGAAAGAGCAAGAACAGG + Intergenic
943448704 2:188020940-188020962 AAGAGAGAATGAGTGCAAGCAGG - Intergenic
945842810 2:214908240-214908262 GAGAGAGAATGAGTGACAGCAGG + Intergenic
946561350 2:220917082-220917104 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
946798005 2:223376823-223376845 AAGAGTGACAGAGCCACAGTGGG - Intergenic
947369422 2:229429156-229429178 GAGAGACAATGGGACACAGCAGG + Intronic
947708178 2:232293217-232293239 GAGAGTGTCTGAGCCACAGCTGG + Intronic
947756588 2:232570383-232570405 AAGAGGGAAAGAGCCAGAGAAGG - Intronic
948410867 2:237759495-237759517 AAGGGAGAGAGAGCCACAGGCGG + Intronic
948706821 2:239799690-239799712 AAGAGAAAATGAGGCCAAGCAGG - Intronic
948891105 2:240907557-240907579 AAAAGAGAAATGGCCACAGCTGG + Intergenic
1168799351 20:634409-634431 CAGAGAGAATGAGACTCAGATGG + Intergenic
1168863571 20:1064225-1064247 AAGAGTGAATGAGACATAGTGGG + Intergenic
1169592660 20:7162733-7162755 AAGAGAGAATGAGTGCCAACAGG - Intergenic
1170582069 20:17706704-17706726 AAGGCAGAAGGAGCCACACCTGG - Intronic
1170696461 20:18663797-18663819 GAGAGAGAATGAGTGCCAGCGGG + Intronic
1170782353 20:19437350-19437372 GAGAGAGAATGAGTGACAGCAGG - Intronic
1170819372 20:19743335-19743357 AAGAGAGAATGAACCTCACAAGG - Intergenic
1171167225 20:22982557-22982579 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
1173318730 20:41968480-41968502 CACAGAGGATGAGCCAAAGCAGG - Intergenic
1174685745 20:52453210-52453232 GAGAGAGAGTGAGCAAGAGCAGG - Intergenic
1174715892 20:52758341-52758363 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1174891968 20:54404946-54404968 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1175104967 20:56608574-56608596 AACAGAAAATGAGACATAGCTGG + Intergenic
1175742358 20:61428834-61428856 GAGAGAGAGTGAGCGAGAGCAGG + Intronic
1177259473 21:18711654-18711676 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1177359432 21:20049173-20049195 GAGAGAGAATGAGTTCCAGCAGG - Intergenic
1178667773 21:34564102-34564124 AAGAGAGAATGAGTGCCAGCAGG + Intronic
1178850733 21:36210089-36210111 AAGAGACAAGAAGCCAGAGCAGG - Intronic
1179049032 21:37872900-37872922 GAGAGAGAATGAGTGACAGCAGG - Intronic
1180840963 22:18958650-18958672 AAGGGAAACTGAGGCACAGCTGG + Intergenic
1181060526 22:20280125-20280147 AAGGGAAACTGAGGCACAGCTGG - Intronic
1181646164 22:24232731-24232753 AAGAGGGACTGAGGCAGAGCTGG + Intronic
1182231158 22:28838439-28838461 AAGAGAGAAAGAAAGACAGCTGG + Intergenic
1182404733 22:30116397-30116419 AACAGAGAATGAGCATCAGATGG + Intronic
1182773482 22:32813022-32813044 AAAAGAGAATCAGCCAAAGAAGG - Intronic
1183720489 22:39559013-39559035 GAGAGAGAATGAGCGAGCGCTGG + Intergenic
1184088412 22:42279805-42279827 GAGAGTGAATGAGCCACTGGGGG + Intronic
1184157440 22:42677381-42677403 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1184157764 22:42679658-42679680 GAGAGAGAATGAGCACTAGCAGG - Intergenic
1184412295 22:44332165-44332187 GAGAGAGAAAGAGCCAGAGGGGG - Intergenic
1184442715 22:44528009-44528031 AAGAAACAAGGAGCCTCAGCCGG - Intergenic
949396755 3:3622668-3622690 AAGAGGCAATGAGCAACATCAGG + Intergenic
949448363 3:4160484-4160506 AAAAGAGAATGGACCAAAGCGGG - Intronic
950548443 3:13652770-13652792 AAGAAAGAGTGAGTCACAGAGGG - Intergenic
950660195 3:14462334-14462356 GAAAGAGACTGAGCCACAGTAGG + Intronic
951174033 3:19578356-19578378 AAGAGAGAAGGAGTGCCAGCAGG + Intergenic
951675073 3:25229884-25229906 AAGAGAGGATGAGCTTCAGTTGG - Intronic
951746180 3:25980215-25980237 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
952952041 3:38533142-38533164 GAAAGAGTATGAGCCTCAGCTGG - Intronic
953004648 3:38967046-38967068 TAGAGAGGCTGAGCCACAGTTGG - Intergenic
953211874 3:40883035-40883057 AAGAGAGATGGAGGAACAGCTGG + Intergenic
953586313 3:44204394-44204416 GAGATAGATGGAGCCACAGCTGG + Intergenic
954841539 3:53515911-53515933 AAGAGAGAGAGAGCCAGAGCAGG - Intronic
955039019 3:55296905-55296927 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
956534976 3:70265817-70265839 GAGAGAGAATGAGTGCCAGCCGG + Intergenic
956998151 3:74851634-74851656 CAGAGAAAATGAGACAGAGCAGG - Intergenic
957252275 3:77788275-77788297 ATAAGAGCACGAGCCACAGCAGG - Intergenic
957327589 3:78716379-78716401 GAGAGAGAATGAGTGCCAGCAGG + Intronic
957421397 3:79976438-79976460 AACAAAGATTGAGCCAAAGCAGG - Intergenic
957956717 3:87196927-87196949 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
958463592 3:94429560-94429582 AAGGGAGAAAGAACCATAGCAGG - Intergenic
958894433 3:99814244-99814266 CAGAGAGAATGAGACAAAGAAGG - Intergenic
959208028 3:103337939-103337961 ATGAGAGACTGAGACACAGTAGG - Intergenic
960225869 3:115167954-115167976 AAGAGAGAGCCAGCAACAGCAGG + Intergenic
960504252 3:118473497-118473519 CAATGAGCATGAGCCACAGCTGG - Intergenic
960538155 3:118835514-118835536 AAGAGAGAATAAGAGAGAGCAGG + Intergenic
960700323 3:120432999-120433021 CAGAGAGAAAGAGTAACAGCAGG + Intronic
960963770 3:123090597-123090619 CAGAGAAAATGAGAGACAGCGGG - Intronic
961938491 3:130611599-130611621 ATGAGTGAATGAGACACAGTTGG + Intronic
962851063 3:139308767-139308789 AAGAGAGAATGAGGGACTGAGGG - Intronic
962851835 3:139313942-139313964 AAGACAGAGTCAGCCACGGCTGG + Intronic
963231789 3:142915613-142915635 GAGAGAAAATGAGCGCCAGCAGG + Intergenic
963359290 3:144249873-144249895 AAGAGAGAATTAGGCCTAGCTGG + Intergenic
965100315 3:164289646-164289668 GAGAGAGAATGAGTGGCAGCAGG + Intergenic
965338279 3:167455114-167455136 AAGGGAAAATGAACCACAACTGG - Intronic
965638453 3:170808330-170808352 GAGAGAGAATGAGTGCCAGCAGG - Intronic
965964774 3:174473968-174473990 GAGAGAGAATGAGTGCCAGCAGG + Intronic
966350370 3:179027706-179027728 TAGTGAGCCTGAGCCACAGCTGG + Exonic
967607766 3:191467892-191467914 GAGAGAGAATGAGTGCCAGCGGG + Intergenic
967808746 3:193737402-193737424 AGGAGAGAATGAGGAACGGCAGG - Intergenic
967983051 3:195077138-195077160 GAGACAGAATGACCCACAGTGGG + Intronic
968980327 4:3845172-3845194 GAGAGAGAATGAGTGTCAGCAGG + Intergenic
969090707 4:4692032-4692054 AAGTGAGAATGAGGCACATTTGG + Intergenic
970145005 4:13026753-13026775 AAGAGAGACTGAGCCAGCCCTGG - Intergenic
970151034 4:13090381-13090403 AAGAAAGACTGAGCCATATCAGG - Intergenic
971302926 4:25456645-25456667 CAGAGACATAGAGCCACAGCTGG - Intergenic
971756923 4:30718617-30718639 AAGAGAGAAAGGGCCGCTGCTGG - Intergenic
971936965 4:33162908-33162930 GAGAGAGCATGAGCAGCAGCAGG - Intergenic
972407629 4:38761894-38761916 AAGAGAAAAAGAACCCCAGCGGG - Intergenic
972569622 4:40298751-40298773 AAGAGAGAGTGAGCAAGAGCAGG + Intergenic
972922274 4:43959053-43959075 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
973712223 4:53641338-53641360 AAGTGAGAGGGTGCCACAGCAGG + Intronic
974033447 4:56796445-56796467 AAGAGAGTGGGAGCTACAGCTGG - Intergenic
974319805 4:60333023-60333045 AAGAGAGAATGAGTGCAAGCAGG - Intergenic
974320038 4:60334981-60335003 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
974525176 4:63042297-63042319 GAGAGAGAATGAGTGCCAGCCGG + Intergenic
974525444 4:63044268-63044290 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
975518040 4:75268281-75268303 AAGAGAAAATGGGGCAGAGCTGG + Intergenic
975686549 4:76921526-76921548 AAGAGAGATGGAGGAACAGCTGG + Intergenic
976040330 4:80876406-80876428 GAGAGAGAATGAGTGCCAGCAGG - Intronic
976207970 4:82640071-82640093 CAGAGAGCAGGAGCCAGAGCGGG - Intronic
976269296 4:83214788-83214810 ATGAGAGAAGGAGCTACAGTGGG + Intergenic
976473947 4:85461291-85461313 AAGAGAGAATGAGAAACAAAGGG - Intergenic
976805804 4:89045725-89045747 AAGAAAGTATGAGCCAAGGCAGG + Intronic
977005916 4:91569578-91569600 GAGAGAGAATGAGTGCCAGCAGG + Intronic
977104848 4:92869088-92869110 AAGAGAGAAAGAGGCAGAGATGG - Intronic
977425119 4:96859101-96859123 AGGAGAGAGTGAGCAAGAGCAGG + Intergenic
978010864 4:103682432-103682454 AAGAGAGACTGAGCAAGAGTGGG + Intronic
978769692 4:112442072-112442094 GAGAGAGAATGAGTGCCAGCAGG + Exonic
979045592 4:115858603-115858625 AAGAGAGAATGAGTGCCAGCAGG + Intergenic
979204725 4:118024522-118024544 GAGAGAGAATGAGCGCCAGTAGG - Intergenic
979588939 4:122455249-122455271 AAGAGAGAATGAACAAAATCTGG - Intronic
980218817 4:129887127-129887149 AAGTCAGAATGAGCCAGATCAGG - Intergenic
980579749 4:134733520-134733542 GAGAGAGAATGAGAGCCAGCAGG - Intergenic
980742608 4:136972516-136972538 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
980814893 4:137932381-137932403 GAGAGAGAATGAGTGACAGCAGG + Intergenic
981273085 4:142867558-142867580 CACAGAGAGTGAGCCAAAGCAGG + Intergenic
981359500 4:143830567-143830589 GAGAGAGAATGAGAGCCAGCAGG - Intergenic
981359768 4:143832521-143832543 GAGAGAGAATGAGAGTCAGCAGG - Intergenic
981370529 4:143953596-143953618 GAGAGAGAATGAGAGTCAGCAGG - Intergenic
981380024 4:144061586-144061608 GAGAGAGAATGAGAGCCAGCAGG - Intergenic
981380290 4:144063520-144063542 GAGAGAGAATGAGAGTCAGCAGG - Intergenic
981668183 4:147255182-147255204 CACAGAGCATGAGCCAAAGCAGG + Intergenic
982045377 4:151440106-151440128 GAGAGAGAATGAGTGCCAGCAGG + Intronic
982656727 4:158159258-158159280 AAGACAGACTGAGTCACAGATGG + Intronic
983158051 4:164376583-164376605 AAGTGAGAAGGAGCCTCAACCGG - Intronic
983233253 4:165150717-165150739 AACAGAGCATCAGCCAAAGCAGG - Intronic
984122794 4:175767233-175767255 AAAAGATCATGAGCCACAGATGG + Intronic
984296446 4:177860978-177861000 AGCAGAGAATGAGCCATATCTGG - Intronic
984818448 4:183859190-183859212 GAGAGAGAATGGGCCAGAGCAGG - Intronic
987630442 5:20463518-20463540 GAGAGAGAATGAGTGCCAGCAGG + Intronic
987916293 5:24218889-24218911 GAGAGAGAATGAGAGCCAGCAGG - Intergenic
989347540 5:40446710-40446732 GAGAGAGAATGAGCACAAGCAGG + Intergenic
990659053 5:57992260-57992282 AAGTTAGAATGAGCCAAATCAGG + Intergenic
990706053 5:58531057-58531079 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
990787409 5:59437967-59437989 GAGAGAGAATGAGTGCCAGCAGG + Intronic
990903448 5:60778508-60778530 GAGAGAGAATGAGTGCCAGCAGG + Intronic
990903760 5:60780693-60780715 GAGAGAGAATGAGTGCCAGCAGG + Intronic
992075890 5:73192326-73192348 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
992367184 5:76104804-76104826 AAAAGAGAATGAGAAAGAGCAGG - Intronic
992885693 5:81157724-81157746 AAGAGAGAATGAGTGCCAGCAGG + Intronic
993103380 5:83569380-83569402 TAGAGACAATGAACCACAGAGGG - Intronic
994294094 5:98068146-98068168 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
994590973 5:101771173-101771195 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
994703365 5:103166408-103166430 AAGTCAGAAGGAGCCACATCAGG - Intronic
994749630 5:103721739-103721761 GAGAGAGAATGAGTGACAGTAGG + Intergenic
994749747 5:103722729-103722751 GAGAGAGAAGGAGTGACAGCAGG + Intergenic
994752524 5:103756131-103756153 AAGTGAGAATTAGACACAGATGG - Intergenic
994873349 5:105381485-105381507 AAGAGAGAATGAATGACAGCAGG + Intergenic
995443665 5:112219329-112219351 GAGAGAGAATGAGTGCCAGCAGG - Intronic
995665462 5:114536618-114536640 CAGTGAGCATGAGCCAAAGCAGG - Intergenic
995695650 5:114876035-114876057 CAGAGAAAGTGAGCCAAAGCAGG + Intergenic
995709036 5:115016046-115016068 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
995981301 5:118107516-118107538 GAGAGAGAATGAGAACCAGCAGG - Intergenic
995981698 5:118112232-118112254 GAGAGAGAATGAGACCCAGCAGG - Intergenic
996033252 5:118730293-118730315 GAGAGAGAATGAGTGAAAGCAGG + Intergenic
997021902 5:130012576-130012598 GAGAGAGAATGAGTGCCAGCTGG + Intronic
997030329 5:130120220-130120242 AAGAGATAATGAGGCACTGGAGG - Intronic
997086619 5:130807071-130807093 AAGAGAGAATGAGAGCCAACAGG - Intergenic
997341792 5:133150897-133150919 AAAATAGATTGAGCCAAAGCAGG + Intergenic
997613908 5:135233276-135233298 GGGAGAGAGTGAGCCACAGGAGG + Intronic
998687697 5:144548592-144548614 GAGAGAGAATGAGCACAAGCAGG - Intergenic
999008555 5:148009040-148009062 GAAAGAGAGTGAGCAACAGCAGG + Intergenic
999197890 5:149795085-149795107 AAGGGAGCCTTAGCCACAGCTGG - Intronic
999374100 5:151074758-151074780 AAAAAAGAATGAGCCACAGCTGG + Intronic
999730752 5:154475419-154475441 AAGAGAGAAAGAGCCAGATAGGG + Exonic
999764287 5:154726857-154726879 GAGAGAGAATGAGAACCAGCAGG + Intronic
999817260 5:155189676-155189698 AAGAGAGAGTGAGCAGCAGGAGG + Intergenic
999925147 5:156367742-156367764 CAGCGAGGCTGAGCCACAGCTGG - Intronic
1000601146 5:163276179-163276201 AACAGAGAATGAGACCCAGAAGG + Intergenic
1001013506 5:168119674-168119696 TAGAGAAAAGGAGCCTCAGCTGG - Intronic
1001254458 5:170172688-170172710 AACAGAGAACAAGCCACTGCTGG + Intergenic
1001926535 5:175640952-175640974 GAGAGAGAATGAGAGAGAGCAGG - Intergenic
1002290606 5:178198228-178198250 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
1002462474 5:179381580-179381602 AAGAGAAAAGCAGCCACAGATGG - Intergenic
1002550692 5:179989126-179989148 GAGAGAGAATGAGTGCCAGCAGG + Intronic
1002662936 5:180803317-180803339 AAAAGGGAAGAAGCCACAGCTGG - Intronic
1003462431 6:6342341-6342363 GAGAGAGAATGAGAGACAGCAGG - Intergenic
1004287536 6:14336268-14336290 AGGAGAGAAAAAGCCACAGAAGG + Intergenic
1005001962 6:21250410-21250432 AAGTCAGAAGGAGCCACATCAGG + Intergenic
1007021675 6:38527520-38527542 GAGAGAGAGTGAGCAAGAGCAGG - Intronic
1007288127 6:40762752-40762774 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1007448267 6:41923729-41923751 TAGAGAGTATGAGACACGGCAGG - Intronic
1008233505 6:49014372-49014394 GAGAGAGAATGAGTGTCAGCAGG + Intergenic
1008326646 6:50189985-50190007 AAGTGAGAATTAGCCAGAGAGGG + Intergenic
1009339386 6:62534356-62534378 AAAGGAGAAGGAGCCACAGAAGG - Intergenic
1012120394 6:95359238-95359260 AAGAGAGAGAGAGACACAGAAGG + Intergenic
1012771977 6:103449730-103449752 TAGAGAGAATGAGTGCCAGCAGG + Intergenic
1013150999 6:107446693-107446715 AAGAGAGAATGAGTGCCAGTAGG + Intronic
1013151299 6:107448855-107448877 GAGAGAGAATGAGTGCCAGCAGG + Intronic
1013607593 6:111764876-111764898 AAGAGAGAATGAGCCACAGCAGG - Intronic
1014049295 6:116933526-116933548 GAGAGAAAATGACCCAGAGCAGG + Intergenic
1014485601 6:121995268-121995290 AAGAAAGAATGGGTCACATCAGG + Intergenic
1014512565 6:122342150-122342172 AAGAGGGAATCAGTCACAGAGGG + Intergenic
1014740208 6:125140496-125140518 GAGAGAGAATGAGTGCCAGCAGG - Intronic
1015173375 6:130279377-130279399 GAGAGAGAATGAGTGCCAGCAGG - Intronic
1015355294 6:132270845-132270867 AAGAGGAAATGATCTACAGCTGG + Intergenic
1015844314 6:137503643-137503665 GAGAGAGAATGAGCGCAAGCGGG + Intergenic
1016032152 6:139348939-139348961 AATAGAGAATGATCAACAGATGG - Intergenic
1016301988 6:142642934-142642956 AAGGCAGAAGGAGCCACATCAGG - Intergenic
1016583239 6:145653313-145653335 GAGAGAGAGTGAGCAAGAGCAGG - Intronic
1018491610 6:164299451-164299473 GAGAGAGAATGAGGACCAGCAGG - Intergenic
1019039234 6:169089822-169089844 GAGAGAGAATGAGCATAAGCAGG - Intergenic
1019466729 7:1193759-1193781 AAGAGAGATTGAGATACAGGTGG + Intergenic
1019818601 7:3220803-3220825 AAGTCAGAATGAGCCAAATCAGG - Intergenic
1019903491 7:4042838-4042860 AAGCGAGAAAGAGTTACAGCCGG - Intronic
1020067742 7:5202170-5202192 CAGAAAGAATGGGCCAGAGCTGG + Intronic
1020400840 7:7775440-7775462 GAAAGAGAATGAGAGACAGCAGG - Intronic
1020407810 7:7856375-7856397 GAGAGAGAATGAGTGCCAGCAGG + Intronic
1020429513 7:8104849-8104871 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
1021143178 7:17053101-17053123 CACAGAGCATGAGCCAAAGCAGG + Intergenic
1021401082 7:20209939-20209961 GAGAGAGAATGAGTGCCAGCAGG - Intronic
1022289154 7:28984736-28984758 GAGAGAGAATTAGGAACAGCTGG + Intergenic
1022528964 7:31055104-31055126 GAGAGGGAATGACACACAGCTGG + Intronic
1022776465 7:33532509-33532531 GAGAGAGAATGAGTGCCAGCAGG + Intronic
1022819609 7:33946142-33946164 GAGAGAGAATGAGAGCCAGCAGG + Intronic
1022866307 7:34425198-34425220 AAGTGAGAATGAGGCACAGAGGG - Intergenic
1023201639 7:37704435-37704457 GAGAGAGAATGAGACCCAGTAGG + Intronic
1023218173 7:37887804-37887826 GAGAGAGAATGAGTGCCAGCAGG + Intronic
1024239489 7:47423353-47423375 CAGTGAGAAGGACCCACAGCTGG - Intronic
1024318955 7:48046267-48046289 AAGAGAGAAAGAGAGAGAGCAGG + Intronic
1024721052 7:52138153-52138175 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
1024859557 7:53823192-53823214 AAGAGAGAGTGAGGAAAAGCAGG + Intergenic
1024937816 7:54729431-54729453 GAGAAAGAATGAGTCCCAGCAGG - Intergenic
1025020168 7:55474453-55474475 AAGAGAGAATGAGGCACTGAGGG + Intronic
1025721718 7:64021913-64021935 AGGAGAAAATGATACACAGCAGG - Intergenic
1025845189 7:65189822-65189844 AAGAAAGAATGAGCCTAGGCCGG - Intergenic
1025895466 7:65695852-65695874 AAGAAAGAATGAGCCTAGGCCGG - Intergenic
1026323206 7:69285476-69285498 GAGAGAGAATGAGTGAAAGCAGG - Intergenic
1026514410 7:71055960-71055982 AACAGAGAATGAGGCCCAGTGGG - Intergenic
1027557855 7:79687915-79687937 GAGAGAGAAAGAGCTACAGAGGG + Intergenic
1027620929 7:80483919-80483941 GAGAGAGAATGAGCCATTCCAGG - Intronic
1028293000 7:89091687-89091709 GAGGGAGAATGAGCCACACAAGG - Intronic
1028695195 7:93701638-93701660 AAGAGAGAGAGAGCAAGAGCTGG - Intronic
1029914134 7:104189299-104189321 GAGAGAGAATGAGTGCCAGCAGG + Intronic
1030934502 7:115568480-115568502 AGGAGAGAAGAAGCCACTGCTGG - Intergenic
1031323246 7:120359875-120359897 GAGAGAGAGTGAGCAAGAGCAGG - Intronic
1031445553 7:121849300-121849322 GAGAGAGAATGAGCTCCAGCAGG + Intergenic
1031645718 7:124222517-124222539 GAGAGAGAATGAGTTTCAGCAGG - Intergenic
1031648846 7:124260527-124260549 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1031720684 7:125171931-125171953 AAGAAAGAATGGGAGACAGCTGG - Intergenic
1031899751 7:127395483-127395505 GAGAGAGAATGAGTGCCAGCAGG - Intronic
1032480935 7:132246540-132246562 AGGAGAGCTTGAGCAACAGCAGG - Intronic
1032672976 7:134102061-134102083 AAGAGAGAAGCAGCCCCATCTGG + Intergenic
1033505394 7:141994772-141994794 CAGAGAGAGTGAGCAAGAGCAGG - Intronic
1033789821 7:144778053-144778075 GAGAGAGAATGAGTGCCAGCAGG + Intronic
1033789823 7:144778075-144778097 GAGAGAGAATGAGTGCCAGCAGG + Intronic
1033789825 7:144778097-144778119 GAGAGAGAATGAGTGCCAGCAGG + Intronic
1034090723 7:148361855-148361877 GAGAGAGAATGAGTGCCAGCAGG + Intronic
1034864033 7:154625331-154625353 AAGATAGAAGGAGAAACAGCAGG + Intronic
1034973225 7:155432120-155432142 AAGAAAGAAGGAAGCACAGCAGG + Intergenic
1035141320 7:156765362-156765384 GAGAGAGAATGAGTGCCAGCGGG - Intronic
1035296454 7:157869651-157869673 AAGTGAGAAGGAGCCAAACCAGG + Intronic
1035893268 8:3369587-3369609 AACACAGAATAAGGCACAGCAGG + Intronic
1036499181 8:9297654-9297676 AAGAGAAAATGAGAGACAGAAGG + Intergenic
1037621462 8:20567041-20567063 CAGAGAGACAGACCCACAGCAGG + Intergenic
1037985871 8:23290220-23290242 GTGTGAGAATGAGCCACTGCTGG + Exonic
1038482358 8:27910410-27910432 CAGAGATAGTAAGCCACAGCGGG + Intronic
1038534993 8:28347411-28347433 AAGACAGAGTGAGCCACGCCCGG - Exonic
1039118088 8:34114691-34114713 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1039874232 8:41572003-41572025 AAGAGAGAATGAGCTCCTGGGGG + Intergenic
1040449862 8:47534100-47534122 GAGAGAGAATGAGTGCCAGCAGG - Intronic
1040571720 8:48617234-48617256 AAGAGACAACCAGCCACTGCGGG - Intergenic
1041849989 8:62379615-62379637 AAGAGAGAATGAGTACAAGCAGG - Intronic
1042069567 8:64915994-64916016 AAGATAGAATGAGCTATACCTGG + Intergenic
1042365649 8:67933487-67933509 AAGAGAGAAAGAACCTAAGCTGG - Intergenic
1042695255 8:71548016-71548038 AAGAAAGAAAAAGCCACCGCTGG - Intronic
1043646642 8:82529730-82529752 GAGAGAGAAAGAGAAACAGCGGG - Intergenic
1043704258 8:83329475-83329497 GAGAGAGAATGAGCGCAAGCAGG + Intergenic
1044269935 8:90230201-90230223 AAGAAAGAATGAGACCCAGAAGG - Intergenic
1044697892 8:94941499-94941521 AAGAGAAAATGAGCCAGAGGAGG - Intronic
1045603900 8:103750728-103750750 GAGAGAGAATGAGTGCCAGCAGG - Intronic
1045838400 8:106550656-106550678 GAGAGAGAATGATCAAGAGCAGG - Intronic
1048069670 8:131008438-131008460 AAGAGAGAATGAGTGCCAGCAGG - Intronic
1048069808 8:131009477-131009499 AAGATAGAATGAGTGCCAGCAGG - Intronic
1048107759 8:131429856-131429878 AAGAGTGAATTAGTCACAGGTGG + Intergenic
1048552792 8:135449240-135449262 AAGAAAGAAAGGGCCACAACAGG + Intergenic
1048572487 8:135667302-135667324 GAGAGAGACTGAGCACCAGCAGG - Intergenic
1048681789 8:136850805-136850827 AAGAGAGAGTGAGCAAGAGCAGG + Intergenic
1050385623 9:5087273-5087295 GAGAGAGAATGAGTGCCAGCAGG + Intronic
1051199353 9:14599288-14599310 CACAGAGGATGAGCCAAAGCAGG + Intergenic
1051407369 9:16753290-16753312 CAGTGAAAATGTGCCACAGCTGG + Intronic
1051414488 9:16824721-16824743 AAAAAAGTATGAGCCACAGAGGG + Intronic
1051551388 9:18333365-18333387 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1051614795 9:18997111-18997133 CACAGAGGATGAGCCAAAGCAGG + Intronic
1052125221 9:24765705-24765727 AACAGAGGGTGAGCCAAAGCAGG - Intergenic
1052270266 9:26621085-26621107 AATAGAGAAAGAGGCACAGCAGG - Intergenic
1052273414 9:26651665-26651687 GAGAGAGAATGAGGGCCAGCAGG + Intergenic
1052559454 9:30066048-30066070 AGGAGAGAAGCAGCCACAGGAGG + Intergenic
1052559459 9:30066087-30066109 AGGAGAGAAGCAGCCACAGGAGG + Intergenic
1052559464 9:30066126-30066148 AGGAGAGAAGCAGCCACAGGAGG + Intergenic
1052901667 9:33798890-33798912 AACAGAGAATGGGCCACCGTGGG + Intronic
1055608645 9:77997904-77997926 GAAAGAGGATGAGCCACATCAGG + Intronic
1056083459 9:83121664-83121686 AATGGAGCATGAGCCAGAGCAGG - Intergenic
1056507440 9:87270611-87270633 CAGAGATAATGGGGCACAGCAGG - Intergenic
1056692915 9:88823478-88823500 AAGAGAGAAGGAGAGACAGGGGG + Intergenic
1056742839 9:89275129-89275151 GAGAGAGAATGAGTAACAGCAGG + Intergenic
1057194236 9:93107892-93107914 ATGAGAGAATGACCCAGGGCTGG - Intronic
1057820890 9:98329625-98329647 AAGAGAGAATGAGCCCCGAAGGG - Intronic
1058061728 9:100504297-100504319 AACTGAGAATGACCAACAGCAGG + Intronic
1058254991 9:102750602-102750624 AAAAGAAACTGAGCCACAGGTGG - Intergenic
1059414999 9:114156801-114156823 AAGAGAGAGTGAGCCTGTGCTGG + Intronic
1059474651 9:114535425-114535447 GACAGAGAATGAGCGCCAGCAGG + Intergenic
1059547941 9:115197730-115197752 AAGAGAGACTGAGGCACAAGAGG + Intronic
1059822240 9:117986051-117986073 AAGAGAGAATGAGTGCCAGCAGG - Intergenic
1060487073 9:124054517-124054539 CAGAGAGCCTGAGGCACAGCTGG - Intergenic
1060954778 9:127630699-127630721 GAGAGAGAATGAGTGCCAGCAGG - Intronic
1186385514 X:9106617-9106639 TAGAGAGAATGAGTGCCAGCAGG - Intronic
1186516971 X:10173559-10173581 GACAGAGAAAGAGCCACAGAGGG - Intronic
1186791025 X:12998875-12998897 ATGAGAAATTGAGCCACATCTGG - Intergenic
1187472668 X:19582733-19582755 CAGAGAGCATGTGCTACAGCGGG + Intronic
1187711817 X:22061996-22062018 GAGAGAGAGTGAGCAAGAGCAGG + Intronic
1187941116 X:24382604-24382626 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1188445067 X:30247133-30247155 AAGTCAGGATGAGCCACATCCGG - Intronic
1188445112 X:30247356-30247378 AAATGAGGATGAGCCACATCCGG - Intronic
1188974016 X:36651985-36652007 GAGAGAGAATGAGTGAAAGCAGG + Intergenic
1189277405 X:39797103-39797125 AAGAGAGAATGATTCACCACAGG - Intergenic
1189550347 X:42086179-42086201 AAGAGAGATGGAGCAGCAGCAGG - Intergenic
1190398762 X:50010864-50010886 ACAAGAGAATGAGCCATATCTGG + Intronic
1191109966 X:56796606-56796628 AAGAGATAATCAGCCACAAATGG - Intergenic
1191593760 X:62919111-62919133 GAGAGAGAATGAGTGACAGGAGG - Intergenic
1191786520 X:64922312-64922334 AAGAAAGAATTAGCCACACATGG + Intronic
1192154338 X:68732686-68732708 GAGAGAGAACGAGCAAGAGCAGG + Intergenic
1192781432 X:74297272-74297294 AAAAGAAAAAGAGACACAGCTGG + Intergenic
1193055212 X:77142998-77143020 AAGAGAGAATGAGTGCCAGCAGG + Intergenic
1193454534 X:81713985-81714007 AAGAGAGAATGAGTGCAAGCTGG + Intergenic
1193592471 X:83407290-83407312 CAGTGAGAGTGAGCCAAAGCAGG + Intergenic
1193981245 X:88184540-88184562 AAAAGAGAAAGAGCAAAAGCAGG - Intergenic
1194759807 X:97782513-97782535 AAGAGAGAAAGAGAAACAGCTGG - Intergenic
1195871482 X:109491087-109491109 GAGAGAGAATGAGTGCCAGCAGG - Intergenic
1197210305 X:123822689-123822711 AAGAAAGAATGAGCCCTGGCTGG - Intergenic
1197294987 X:124707749-124707771 AAGAGAGAATCACCCACAAGGGG - Intronic
1198629115 X:138615856-138615878 GAGAGAGAATGAGTGCCAGCAGG + Intergenic
1199550615 X:149057247-149057269 CAGTTAAAATGAGCCACAGCAGG + Intergenic
1199911066 X:152287469-152287491 GAGAGAGAATGAGTGCCAGCAGG - Intronic
1201281602 Y:12347438-12347460 GAGGGGGAATGGGCCACAGCAGG - Intergenic