ID: 1013607600

View in Genome Browser
Species Human (GRCh38)
Location 6:111764905-111764927
Sequence CTTTGCTGGCAGCTGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013607592_1013607600 7 Left 1013607592 6:111764875-111764897 CCCTGCTGTGGCTCATTCTCTCT 0: 1
1: 0
2: 18
3: 246
4: 1045
Right 1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG No data
1013607590_1013607600 12 Left 1013607590 6:111764870-111764892 CCCTTCCCTGCTGTGGCTCATTC 0: 1
1: 0
2: 15
3: 119
4: 825
Right 1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG No data
1013607591_1013607600 11 Left 1013607591 6:111764871-111764893 CCTTCCCTGCTGTGGCTCATTCT 0: 1
1: 0
2: 8
3: 106
4: 643
Right 1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG No data
1013607589_1013607600 16 Left 1013607589 6:111764866-111764888 CCTTCCCTTCCCTGCTGTGGCTC 0: 1
1: 0
2: 6
3: 92
4: 771
Right 1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG No data
1013607593_1013607600 6 Left 1013607593 6:111764876-111764898 CCTGCTGTGGCTCATTCTCTCTT 0: 1
1: 0
2: 2
3: 54
4: 590
Right 1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG No data
1013607587_1013607600 24 Left 1013607587 6:111764858-111764880 CCTGAATTCCTTCCCTTCCCTGC 0: 1
1: 0
2: 4
3: 71
4: 786
Right 1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013607600 Original CRISPR CTTTGCTGGCAGCTGGAGGC AGG Intronic
No off target data available for this crispr