ID: 1013609745

View in Genome Browser
Species Human (GRCh38)
Location 6:111783330-111783352
Sequence CTCATCAGTCATGGTTATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013609745_1013609752 9 Left 1013609745 6:111783330-111783352 CCCCAATAACCATGACTGATGAG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1013609752 6:111783362-111783384 CACAGAACAAAGGCTGGATTTGG No data
1013609745_1013609750 3 Left 1013609745 6:111783330-111783352 CCCCAATAACCATGACTGATGAG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1013609750 6:111783356-111783378 TCCACTCACAGAACAAAGGCTGG 0: 1
1: 0
2: 2
3: 19
4: 212
1013609745_1013609749 -1 Left 1013609745 6:111783330-111783352 CCCCAATAACCATGACTGATGAG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1013609749 6:111783352-111783374 GATTTCCACTCACAGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013609745 Original CRISPR CTCATCAGTCATGGTTATTG GGG (reversed) Intronic
901671923 1:10861093-10861115 CTGATCAGTCGTGGTGATGGTGG + Intergenic
909824041 1:80103281-80103303 CTCAGCAGTCATCAATATTGAGG - Intergenic
909830146 1:80178438-80178460 CTCATCAATCTTAGTTTTTGTGG - Intergenic
909885044 1:80930545-80930567 CTGCTCAGTCATGGTTCTGGAGG + Intergenic
916207622 1:162330885-162330907 CTCCTGAGTGATGGCTATTGGGG + Intronic
916241715 1:162646922-162646944 TTCAAAAGTCATGGTTCTTGAGG - Intronic
1064520130 10:16192320-16192342 CCCGTAAGTCATGTTTATTGTGG - Intergenic
1068941747 10:62687530-62687552 CTCATGATTCATGGTGATTTGGG + Intergenic
1073207783 10:101777676-101777698 CTCATAAGACATGGTCCTTGTGG - Intronic
1082118433 11:48352553-48352575 CTCTTTAGTCCTGGTTTTTGGGG + Intergenic
1082255893 11:50032743-50032765 CTCTTTAGTCCTGGTTTTTGGGG - Intergenic
1085869308 11:80330516-80330538 CTTATGAGTCAGGCTTATTGGGG + Intergenic
1088291915 11:108247985-108248007 CTAATCAATCTTGGTTTTTGTGG + Intronic
1088861009 11:113799807-113799829 CTCATCAGCTATTGTTAGTGAGG - Intronic
1092901501 12:13064063-13064085 CCCATCAGTCATGAGTTTTGAGG + Intronic
1094739460 12:33272270-33272292 CTCATCATTCCTTGTTATCGTGG - Intergenic
1097147021 12:56948785-56948807 CCCATCAGTGCTGGTTATTTGGG + Intergenic
1099276951 12:80588876-80588898 CAGATCAATCAGGGTTATTGTGG - Intronic
1102775678 12:115516465-115516487 GTCATTAGTCATGGTGAGTGAGG + Intergenic
1103592580 12:122002822-122002844 CTCCTCAGTCTTGGTGATGGTGG - Intronic
1108013054 13:46041173-46041195 CTCATCAGTGATGGATATTTGGG - Intronic
1110166665 13:72450273-72450295 CTCGCCAGTCTTGGTGATTGCGG - Intergenic
1112271525 13:97974624-97974646 ATCATCAGCCAAGGTTATTAAGG - Intronic
1114553828 14:23550319-23550341 CTTATCAGTCATGATTGTGGTGG - Intronic
1118784528 14:69035041-69035063 CTCAAAAGGCATGGTTCTTGAGG - Intergenic
1122024922 14:98868867-98868889 CTCAGGAGTCCTGGTTCTTGAGG + Intergenic
1142582976 17:953075-953097 ATCATCAGTCATGGCTTCTGTGG - Intronic
1145005134 17:19333284-19333306 CACACCAGTCATGGTTCCTGGGG + Intronic
1146043448 17:29481068-29481090 TTATTCAGTCTTGGTTATTGTGG + Intronic
1148031719 17:44626419-44626441 CTCATCTGTCAGGTTTATAGGGG + Intergenic
1149511541 17:57245734-57245756 CTCAGAAGTCATGATTTTTGAGG + Intergenic
1150163517 17:62919542-62919564 CTGATAAGTCATGGTTTCTGTGG + Intergenic
1150301837 17:64053711-64053733 CTCTTCAGTCATGGCTGGTGTGG - Intronic
1150988481 17:70227305-70227327 ATAAACAGTCATGGTTATTTAGG + Intergenic
1151996342 17:77611684-77611706 CTCAGCAGTCAGGGCTCTTGAGG + Intergenic
1155812560 18:30255971-30255993 CTCCTCAATCACGGTTTTTGAGG + Intergenic
1160326516 18:77954443-77954465 CTCACCAGTCATGGTGATGCTGG + Intergenic
931097130 2:58953798-58953820 CTCCTCAGTGATGGTTATCTGGG + Intergenic
931224172 2:60315380-60315402 ATCATAAGTGATGATTATTGAGG - Intergenic
931636953 2:64349462-64349484 CTCCTCAGTCATGGGCATTAAGG + Intergenic
940528425 2:154846368-154846390 ATTATCAGTCATGATTATTAAGG - Intronic
945310771 2:208309762-208309784 TCCACCTGTCATGGTTATTGAGG + Intronic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
1170947235 20:20902098-20902120 CTCATCTGTCCTGTTCATTGTGG + Intergenic
1171227865 20:23456410-23456432 CTCACCAGCCATGGTTTTTAGGG + Intergenic
1173427455 20:42955508-42955530 CCCCTCAGTCATGGCAATTGAGG - Intronic
1174803635 20:53586669-53586691 CTCATCAGTAATCGTTAAAGTGG + Intronic
1175574273 20:60048985-60049007 CACATCAGTCCTGGGTAGTGTGG + Intergenic
1177706702 21:24715166-24715188 CACATCAGGGATGGCTATTGAGG - Intergenic
1178982259 21:37274378-37274400 CTCAGCAGAAATGGTTACTGGGG + Intergenic
1183452639 22:37905521-37905543 CCCCTCAGCCATGGTTAGTGTGG - Intergenic
1183534616 22:38391047-38391069 CTCATCAGTAATCGTTAAAGTGG + Intronic
1183725148 22:39584452-39584474 CTCAGCAGTCAGGGTTCCTGGGG + Intronic
950248798 3:11446828-11446850 GCCATGAGTGATGGTTATTGGGG + Intronic
951542316 3:23793653-23793675 CTCATCTCTCATGGTTATTGTGG + Intergenic
955752684 3:62198481-62198503 CTCAACAGTCATGGAAAATGGGG + Intronic
956464405 3:69504702-69504724 TTCATCAGTAATGGATATTTGGG + Intronic
957103592 3:75858532-75858554 CTCATCTGTAATGGTTGATGGGG - Intergenic
958197619 3:90262062-90262084 CTCATATGTCATGGTTATTATGG - Intergenic
958421066 3:93932165-93932187 CTCATATGTCATGGTTATTATGG - Intronic
965204734 3:165707106-165707128 GTCATCATCCCTGGTTATTGTGG + Intergenic
966901980 3:184493118-184493140 TTCATTCGCCATGGTTATTGAGG - Intronic
970107594 4:12602517-12602539 CTCATGACACATGGATATTGTGG + Intergenic
972813191 4:42613343-42613365 CTAATCCCTCATGGATATTGAGG - Intronic
973267305 4:48223754-48223776 CTCATCAGTGTTGGTAATAGTGG - Intronic
976907172 4:90253546-90253568 CTCAGCTGTTATTGTTATTGGGG + Intronic
978128604 4:105165651-105165673 ATCATCAGTAAGTGTTATTGAGG - Intronic
986183966 5:5419327-5419349 CTCAACACTCAGGGTTATAGTGG - Intergenic
988121273 5:26966086-26966108 CTCTTCAGTCATTGCTATTGAGG + Intronic
988573603 5:32396991-32397013 CTCATCAGTTTTAGTAATTGTGG - Intronic
988927692 5:36006098-36006120 CTCCACAGTCAAGTTTATTGGGG - Intergenic
990639366 5:57764561-57764583 CTCCTCCGTCATGGTTTTTCTGG + Intergenic
991201024 5:63992842-63992864 TTGCTCTGTCATGGTTATTGGGG - Intergenic
997842920 5:137258303-137258325 TTCATCAGGCATGGTTTCTGGGG + Intronic
998148028 5:139741295-139741317 CTCATCAGATATGGCTAGTGGGG + Intergenic
1003003960 6:2363439-2363461 CTTATCTGTCATGGCTATCGTGG + Intergenic
1006904471 6:37523735-37523757 CTCATCTGTCATGGTTTTCAGGG + Intergenic
1009039620 6:58160473-58160495 CTCATCATTCCTGGTTAAGGGGG - Intergenic
1013609745 6:111783330-111783352 CTCATCAGTCATGGTTATTGGGG - Intronic
1013624480 6:111923261-111923283 CACATAAGTCATGTTGATTGTGG + Intergenic
1015014786 6:128398844-128398866 TGCATCAGTCATGGTTTTTCTGG + Intronic
1018482845 6:164209153-164209175 CTCAGCAGTCAGGAATATTGAGG - Intergenic
1019885193 7:3898035-3898057 CACCTCAGTCATGTTGATTGGGG - Intronic
1020453646 7:8347445-8347467 CTCATCATACATGGGAATTGTGG - Intergenic
1022130188 7:27397722-27397744 CTCATCAGTAAAGGTTTCTGTGG + Intergenic
1027441405 7:78222993-78223015 CTCATGAAACATGGTTATGGGGG + Intronic
1035303566 7:157915561-157915583 CCCTGCAGTCATGGTTCTTGGGG + Intronic
1040754382 8:50754090-50754112 CTCACAAGTCATGGTTATAGAGG - Intronic
1044704307 8:94993838-94993860 CACAACAGTCATTGATATTGGGG + Intronic
1046833913 8:118778498-118778520 CTCATCAGTCAAGGCTGTTTTGG + Intergenic
1048664043 8:136641218-136641240 CTCACCAATGATGGTAATTGAGG + Intergenic
1059202125 9:112427865-112427887 CGCAGCAGACATGGGTATTGGGG + Intronic
1191172730 X:57465475-57465497 CTCATCCATCACTGTTATTGTGG - Intronic
1198894391 X:141436348-141436370 ATCATCAATCATCGTTATTTAGG - Intergenic