ID: 1013613398

View in Genome Browser
Species Human (GRCh38)
Location 6:111817884-111817906
Sequence ACCAGACAGTGCCCCAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 3, 2: 22, 3: 72, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013613398_1013613404 30 Left 1013613398 6:111817884-111817906 CCTCCACTGGGGCACTGTCTGGT 0: 1
1: 3
2: 22
3: 72
4: 237
Right 1013613404 6:111817937-111817959 GCCTCTGAAAGCAAGAGTCAGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1013613398_1013613403 29 Left 1013613398 6:111817884-111817906 CCTCCACTGGGGCACTGTCTGGT 0: 1
1: 3
2: 22
3: 72
4: 237
Right 1013613403 6:111817936-111817958 AGCCTCTGAAAGCAAGAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 225
1013613398_1013613401 4 Left 1013613398 6:111817884-111817906 CCTCCACTGGGGCACTGTCTGGT 0: 1
1: 3
2: 22
3: 72
4: 237
Right 1013613401 6:111817911-111817933 ACAGTGCCTGGCTGTGATTCTGG No data
1013613398_1013613400 -8 Left 1013613398 6:111817884-111817906 CCTCCACTGGGGCACTGTCTGGT 0: 1
1: 3
2: 22
3: 72
4: 237
Right 1013613400 6:111817899-111817921 TGTCTGGTTACAACAGTGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013613398 Original CRISPR ACCAGACAGTGCCCCAGTGG AGG (reversed) Intronic
900341047 1:2189465-2189487 ACCAGACACAGCCCCAGGCGGGG - Intronic
900523321 1:3116542-3116564 ACCAGGCACTGCCCCAGCCGGGG - Intronic
901068317 1:6505121-6505143 CCCAGACAGTTCCACAGTGCTGG + Intronic
901494847 1:9615028-9615050 ACCAGACAGTGTCCCTGGAGGGG + Intergenic
902916988 1:19645098-19645120 TCCAGACAATCCCCCAGTGTCGG + Intronic
903320689 1:22541470-22541492 ACCAGACTGTGGGCCTGTGGAGG - Intergenic
903545512 1:24121267-24121289 ACTAGAAAGTGTCCCAGTGGGGG + Exonic
905964541 1:42081151-42081173 CCCAGAAGGTGGCCCAGTGGTGG + Intergenic
907305287 1:53509759-53509781 AGGAGACAGTGACCTAGTGGGGG - Intronic
909099377 1:71331982-71332004 ACTAGGCATTGCCCTAGTGGAGG + Intergenic
909405305 1:75281954-75281976 ACTAGGCAATGCCCCAGTGGAGG - Intronic
909747582 1:79117178-79117200 TCCAGAAAGTGCCCCAGTGATGG + Intergenic
912068687 1:105779801-105779823 ACCAGGCAGTGCCCCAGTGAGGG - Intergenic
912084054 1:105977084-105977106 ACCAAGCAGTGCCCCAGTGTGGG - Intergenic
912778761 1:112524627-112524649 AGCAGGCAGTTCCCAAGTGGAGG - Exonic
913116940 1:115705871-115705893 AGCAGTCATTGCCCCAGGGGTGG + Intronic
913667874 1:121066642-121066664 ACCTGACAGTTTCACAGTGGGGG - Intergenic
914019564 1:143853772-143853794 ACCTGACAGTTTCACAGTGGGGG - Intergenic
914417877 1:147501178-147501200 ACTAGTCTGTGCACCAGTGGAGG + Intergenic
914658115 1:149761989-149762011 ACCTGACAGTTTCACAGTGGGGG - Intergenic
915786993 1:158624222-158624244 ACTAGGCAGTACCCCAGTGAGGG - Intronic
915954268 1:160209669-160209691 AGAAGACCCTGCCCCAGTGGAGG - Intronic
916681624 1:167109984-167110006 ACCAGTAACTGCTCCAGTGGAGG - Intronic
917152102 1:171956644-171956666 ACTAGGCAGTGCCCCAGTAAGGG + Intronic
917408745 1:174736560-174736582 ACTAGGCAGTGCCCTGGTGGAGG + Intronic
919148433 1:193664216-193664238 TAGAGAGAGTGCCCCAGTGGGGG + Intergenic
919536715 1:198796832-198796854 ATTAGACAGTGCCCCAGTGGGGG + Intergenic
920519808 1:206614823-206614845 CCCAGACTGTTCCCCACTGGTGG + Intergenic
921996554 1:221425839-221425861 ACTAGGCAGCACCCCAGTGGGGG + Intergenic
922473633 1:225891138-225891160 CCCAGACAGAGCCCCAGGGAAGG - Intronic
922709109 1:227813826-227813848 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
923179143 1:231499236-231499258 ACTAGGTAGTGCCCCAGTGGGGG + Intergenic
1062770465 10:96340-96362 ACTAGGCAGTGCCCCTGTGGGGG + Intergenic
1065915965 10:30355292-30355314 AGCTGACAGTGACCTAGTGGTGG + Intronic
1066684248 10:37965279-37965301 ATTAGGCAGTACCCCAGTGGGGG - Intronic
1068399419 10:56509055-56509077 ACTAGACAGTGCCCCAGTGGTGG - Intergenic
1068604512 10:58990424-58990446 ACTAGACAGTGCCTCAGTGGGGG - Intergenic
1069106120 10:64385136-64385158 ACTAGGCAGTGCTCCAGTGGGGG + Intergenic
1069773489 10:70913791-70913813 AAATGCCAGTGCCCCAGTGGAGG + Intergenic
1069801481 10:71084526-71084548 ACCAGCCAGTGGTCCAGTGCTGG + Intergenic
1070371914 10:75790723-75790745 ACCAGTCTATTCCCCAGTGGAGG + Intronic
1070581639 10:77724909-77724931 ACTAGGCAGTGGCCCAGTGGGGG - Intergenic
1070637659 10:78142170-78142192 ACTAGGCACTGCCCCGGTGGGGG - Intergenic
1070808671 10:79286300-79286322 ACCAGGCATTCCCCCGGTGGTGG + Intronic
1072782089 10:98258077-98258099 CACAGACCGTGCCCCACTGGCGG + Exonic
1074657991 10:115616951-115616973 ACTAGGCAGTGCCCCAGTGAGGG - Intronic
1074803945 10:117028897-117028919 ATCAGGCAGTGCCTCAGTGGGGG - Intronic
1075746349 10:124730588-124730610 ACGAGACTGTGTCCCAGTGTGGG - Intronic
1077076670 11:705426-705448 ACCAGACAGTCCCACTGTGGTGG + Intronic
1082959065 11:58901805-58901827 ACCAAGCACTGCCCCACTGGAGG + Intronic
1083940774 11:65894271-65894293 AGCAGACAGCGCCTCAGTGCAGG - Intronic
1084651016 11:70489558-70489580 ACAGGACAGTGCCCCTGGGGTGG + Intronic
1085047549 11:73362373-73362395 GCCAGACGGGGCCCCGGTGGTGG - Intronic
1086056600 11:82654217-82654239 ACTAGGCAGTGCCCCAGTAAAGG - Intergenic
1087336621 11:96852038-96852060 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1087675656 11:101158410-101158432 ACCAGGCTGTGCTCCAGTGGGGG - Intergenic
1087917985 11:103832000-103832022 CCCTGACTGTGCCCCAGTGCTGG + Intergenic
1088708854 11:112488073-112488095 ACAAGACAGTGCCCCATTAGAGG + Intergenic
1089100202 11:115956717-115956739 GTCAGACAGTGCCTCATTGGAGG + Intergenic
1089343998 11:117778447-117778469 ATCACACAGTGGGCCAGTGGAGG - Intronic
1090252583 11:125262190-125262212 GCCAGACAGTGAGACAGTGGAGG + Intronic
1090666653 11:128918921-128918943 AGCAGACAGTGCCCCAGCAGGGG + Exonic
1091314002 11:134597917-134597939 AACATGCAGTGCCCCACTGGAGG - Intergenic
1091541797 12:1469227-1469249 ACCAGACAGTGCTCAAGAGCTGG - Intronic
1091804558 12:3346657-3346679 CCCAGCCTGTGCCTCAGTGGTGG - Intergenic
1094815417 12:34178908-34178930 ACTAGGCCATGCCCCAGTGGGGG + Intergenic
1095216714 12:39557941-39557963 ACTAGGCAATGCCCCAGTGGGGG - Intronic
1096304669 12:50463798-50463820 ACTATGCAGTGCCCTAGTGGAGG + Intronic
1097501520 12:60409819-60409841 CCTAGGCAATGCCCCAGTGGGGG + Intergenic
1099089892 12:78293035-78293057 ACTAGACAGTCCCAAAGTGGGGG - Intergenic
1099658711 12:85527835-85527857 ACTAGACAATGCTCCAGTGAGGG - Intergenic
1099760320 12:86912548-86912570 ACTAGGCAGTGTCTCAGTGGGGG - Intergenic
1099984701 12:89649149-89649171 ACTAAGCAGTGCCCTAGTGGGGG - Intronic
1100006335 12:89899887-89899909 AGCACACAGGGCCCCTGTGGAGG - Intergenic
1100473058 12:94910902-94910924 TAAAGACAGTGCCCCAGTGGAGG + Intronic
1101052110 12:100874246-100874268 ACAAGGCAGTGCCCCAGTGAAGG - Intronic
1102305281 12:111800043-111800065 ACCACACAGTGCCCGCCTGGAGG - Exonic
1104742031 12:131184718-131184740 ACTAGGCAGTGCCCCAATGTGGG + Intergenic
1105870417 13:24500338-24500360 CCCGGACAGTGCCACAGAGGAGG - Exonic
1110062663 13:71062337-71062359 ACTTAGCAGTGCCCCAGTGGGGG + Intergenic
1111239690 13:85457871-85457893 ACTAGCCAGTGTCCCAGTGGGGG - Intergenic
1112808654 13:103191296-103191318 ACCAGCCAGTGCTCCAAAGGTGG - Intergenic
1113269314 13:108655534-108655556 ACTAGGCAGTGCCCCAGTGGAGG - Intronic
1114007987 14:18333899-18333921 ACCAGACAGTGCCTGAGCCGGGG + Intergenic
1114646187 14:24257618-24257640 ACCACTCTGTGCCCCAGAGGAGG + Intronic
1116098875 14:40408260-40408282 ACTAGGCAGTGCCCCAGTGAGGG + Intergenic
1116287177 14:42988122-42988144 ACTAGGCAGTGTCCCAGTAGGGG - Intergenic
1116485543 14:45444197-45444219 ATTAGGCAGTGCCCCAGTGTGGG - Intergenic
1118333407 14:64831745-64831767 ACCTGTCCCTGCCCCAGTGGTGG - Intronic
1119562821 14:75604691-75604713 ACCGGACATTGCCCCAGTGTGGG + Intronic
1121501457 14:94441670-94441692 CCCAGAAAGTGCTACAGTGGTGG - Intergenic
1121640246 14:95480505-95480527 ACCAGCCAGTCCCCCAGAGGTGG + Intergenic
1122940214 14:104977820-104977842 ACCAGACAGCGTCCCAGGAGCGG + Intronic
1123104171 14:105830269-105830291 ACCAGCAACTGTCCCAGTGGAGG + Intergenic
1124464038 15:29920099-29920121 ACCTGGCAGTGCCCCAGTTTCGG - Intronic
1125723909 15:41858530-41858552 ACAGGACAGTGCCCCAGAGCTGG - Intronic
1127576225 15:60295098-60295120 ACTAGGCAGTGCCCCAGCAGGGG + Intergenic
1129203894 15:74023860-74023882 ACCATACAGTGGCTCAGTGGAGG + Intronic
1130805269 15:87314193-87314215 ACCACAAAGCGCCCCAGAGGTGG - Intergenic
1131405099 15:92157917-92157939 ATCACACAGTTCCCAAGTGGCGG + Intronic
1131987566 15:98060503-98060525 ACTAGGCAGTGCCCCAGTAGAGG + Intergenic
1132261812 15:100432402-100432424 ACCAGACAATTCCCCAGTGGAGG + Intronic
1132628122 16:902024-902046 AACAGACAGGGCCCCAGTGCTGG - Intronic
1132800498 16:1749893-1749915 GTCAGAAAGTGCCCCAGTAGAGG + Intronic
1133325236 16:4937955-4937977 CCCAGACTGTGTGCCAGTGGAGG + Intronic
1134798958 16:17066985-17067007 ACCAGACAGTGCCGTAACGGTGG + Intergenic
1135484444 16:22851789-22851811 AGCATACCTTGCCCCAGTGGAGG - Intronic
1136411079 16:30077568-30077590 ATCACACAGTTCCCCAGAGGAGG - Intronic
1137015095 16:35366424-35366446 TGCAGACAGTGTCCCAGTAGGGG + Intergenic
1138436121 16:57001001-57001023 AGCAGAAAGAGCCCCAGTGATGG - Intronic
1138620287 16:58205815-58205837 ACCAGAGAATGCCCCTGAGGGGG + Intergenic
1139245149 16:65434345-65434367 GCAGGACAGTGCCACAGTGGAGG + Intergenic
1139882494 16:70187069-70187091 ACCAGACTCTGCCTCAGTGAGGG + Exonic
1139893485 16:70269647-70269669 ATCAGCCAGTGCCACAGTGATGG + Exonic
1139956570 16:70696082-70696104 ACCAGGAGGTGCCTCAGTGGAGG - Intronic
1140219372 16:73032914-73032936 ACAAATCAGAGCCCCAGTGGAGG + Intronic
1140370015 16:74408435-74408457 ACCAGACTCTGCCTCAGTGAGGG - Intronic
1142225335 16:88874340-88874362 ACAAGATGGAGCCCCAGTGGGGG + Intergenic
1143103823 17:4518721-4518743 ACCAGACAGTGCCTCTGTTTTGG + Intronic
1143278225 17:5730582-5730604 ACCAGGCACTGCACCTGTGGAGG + Intergenic
1143518022 17:7429762-7429784 CCCAGACTGTGCCCCAGCCGAGG + Intergenic
1145140964 17:20448608-20448630 CCTAGACACTGGCCCAGTGGGGG + Intergenic
1145957006 17:28861603-28861625 CCCAGCCAGGGCCCCACTGGGGG + Intergenic
1148019174 17:44542222-44542244 GCCAGGCAGTGTACCAGTGGGGG - Intergenic
1148390502 17:47268800-47268822 ACTAGGCAGTGCCCGAGTGGGGG + Intronic
1149052675 17:52325479-52325501 ACTAGGCAGTGCCCCAGTAAGGG + Intergenic
1149135573 17:53359676-53359698 ACTAGGCAGTGCCCCTGTGGGGG - Intergenic
1150727983 17:67666951-67666973 ACCAGACTGTGTCTCAGGGGTGG - Intronic
1151422837 17:74009752-74009774 ACCAGGCAGTCCCACAGTGGGGG - Intergenic
1151427328 17:74039494-74039516 AGGAGAGAGTGACCCAGTGGGGG + Intergenic
1153094343 18:1383588-1383610 ACCTGCCAGTGCCCCACTGCTGG + Intergenic
1156154680 18:34287693-34287715 GCTAGGCAGTACCCCAGTGGGGG + Intergenic
1157202290 18:45669232-45669254 ACTAGACTGTGCTGCAGTGGGGG - Intronic
1157815080 18:50724329-50724351 ATGAGCCACTGCCCCAGTGGTGG + Intronic
1159697316 18:71575851-71575873 ACTAGGCAGTACCCCAGTGGGGG + Intergenic
1159713890 18:71797675-71797697 ACTAGGTATTGCCCCAGTGGGGG - Intergenic
1161172503 19:2820031-2820053 GCCAGACAGGGCCCCCGAGGCGG - Exonic
1163110925 19:15160761-15160783 GGCAGGCAGTGCCCCAGTGGTGG + Exonic
1163633468 19:18428251-18428273 ACCCCCCAGTGCCCCAATGGGGG - Intronic
1164607266 19:29608972-29608994 ACCAGGCTGTGCCCACGTGGTGG + Intronic
1166834566 19:45659337-45659359 ACCAGGCAGTGCCCCTGTCCAGG - Intergenic
1167806446 19:51789572-51789594 ACTGGACATTGCCCTAGTGGAGG + Intronic
926370915 2:12177927-12177949 AGCAAACAGTGACCCAGTTGAGG - Intergenic
929130696 2:38566920-38566942 ACCAGACTGTTCATCAGTGGGGG + Intronic
930687560 2:54325696-54325718 ACTAGGCAATGCTCCAGTGGGGG - Intergenic
931776935 2:65548989-65549011 AGCAGAATATGCCCCAGTGGGGG + Intergenic
932583756 2:73009353-73009375 ACGAGGCAGTGGCCCAGGGGTGG + Intronic
933773052 2:85755698-85755720 ACCAGACAGTGCCCCTGCGCAGG + Intronic
934144192 2:89075469-89075491 ACTAAGCAGTGCCCCAGTAGGGG - Intergenic
934225051 2:90125079-90125101 ACTAAGCAGTGCCCCAGTAGGGG + Intergenic
936112720 2:109677996-109678018 ATCAGGCAGTGCACCCGTGGTGG + Intergenic
936788756 2:116125418-116125440 ATTAGGCAGTGGCCCAGTGGTGG + Intergenic
936792346 2:116164747-116164769 ACTAAGCAGTGCCCCAGTAGGGG - Intergenic
937277546 2:120695020-120695042 TCCAGACAGTGCTCCACTGCTGG + Intergenic
937941699 2:127291205-127291227 ACCAGGCAGAGCCACAGTGTTGG + Intronic
938123800 2:128655867-128655889 GCCTGACAGTACCCCAGAGGAGG + Intergenic
940288948 2:152059195-152059217 ACTATGCAGTGCCCCAGTGGGGG - Intronic
940425930 2:153532069-153532091 ACTAAGCAGTGCCCCAGTGGGGG + Intergenic
940764619 2:157776602-157776624 ACCAAAAAGTGGCCCAGTGATGG + Intronic
940790747 2:158027641-158027663 ACTAGACGGTACCCCAGTAGGGG + Intronic
941527001 2:166618487-166618509 ACTAGACAGTGCCCCAGTGGGGG - Intergenic
942185745 2:173423235-173423257 ACCAGACAGTGCCTTAGAGCAGG + Intergenic
942469657 2:176246497-176246519 GCCACACTGTGCTCCAGTGGAGG + Intergenic
943092966 2:183395897-183395919 ACTAGGCAGTGCCCCAGTACAGG - Intergenic
943876200 2:193071142-193071164 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
944477750 2:200124810-200124832 ACTAAGCAGTGCCCCAGTGGGGG + Intergenic
944479734 2:200144401-200144423 ACTAGGCAGTACCGCAGTGGGGG + Intergenic
945360151 2:208886882-208886904 ACTAGGCAATGCCCCAGTAGGGG - Intergenic
947460569 2:230300414-230300436 ACCAGCACGTGCTCCAGTGGAGG - Intronic
948861332 2:240754145-240754167 CCCAGACTGTGCCCCAAAGGTGG + Intronic
1171354964 20:24536856-24536878 ACCCAACAGAGCCCCAGTGATGG - Intronic
1175416376 20:58804028-58804050 CCCAGAAAGTTCCCCAGTGGGGG - Intergenic
1175552674 20:59827318-59827340 ACCAGGAACAGCCCCAGTGGTGG - Intronic
1175736513 20:61391015-61391037 AGGAGGCAGTGCCGCAGTGGGGG + Intronic
1176025686 20:62984381-62984403 ACCAGAATCTGCCCCAGTCGGGG - Intergenic
1177522115 21:22239322-22239344 ACTAGGCAATGGCCCAGTGGGGG - Intergenic
1180432494 22:15264709-15264731 ACCAGACAGTGCCTGAGCCGGGG + Intergenic
1180515066 22:16132689-16132711 ACCAGACAGTGCCTGAGCCGGGG + Intergenic
1182073189 22:27477461-27477483 AGCAGACAGTGCCCCTCCGGGGG + Intergenic
1182940268 22:34270090-34270112 ACTAGGCATTGCCCCAGTAGGGG + Intergenic
1183109958 22:35641707-35641729 ACCAGACTCAGCCACAGTGGAGG + Intergenic
1183488316 22:38102244-38102266 TCCAGACAGGGCCCATGTGGAGG + Intronic
1183722717 22:39571823-39571845 ATCTGACAGTACCCCAGGGGAGG - Intronic
949833625 3:8244227-8244249 AGCAGACTGTGCCACAGAGGAGG - Intergenic
951180652 3:19654760-19654782 ACCAGGCAGTGCCCCAGCTGGGG + Intergenic
951449347 3:22819058-22819080 ACTAGGCAGTGCCCCAGTTGGGG + Intergenic
952023499 3:29051601-29051623 AGATGACAGTGCCCCATTGGAGG - Intergenic
952589382 3:34932464-34932486 ACCAGGCAGTGCCCCAGTGGGGG - Intergenic
953377954 3:42444701-42444723 ACTGGGCAGTGCCCCAGTGAGGG - Intergenic
953408546 3:42673445-42673467 ACTGGCCAGTGCCCTAGTGGGGG - Intergenic
954591603 3:51788083-51788105 ACCAGGCAGTGCCCCAGTAGGGG - Intergenic
955610793 3:60754823-60754845 ACCTGACAGTGTCCCATTGCTGG + Intronic
956572516 3:70712546-70712568 ACTAGTCAGTGCTCCAGTGGGGG + Intergenic
960064420 3:113354947-113354969 ACCAGAACCTGCTCCAGTGGAGG - Intronic
960121388 3:113951250-113951272 ACTGGGCAGTGCCCTAGTGGGGG + Intronic
960581483 3:119282854-119282876 ATGAGGCAGTGCCCCAGTGGGGG - Intergenic
962461039 3:135612881-135612903 AATAGGCAGTGTCCCAGTGGGGG - Intergenic
962636655 3:137338662-137338684 ACTAACCAGTGCCCCAGTTGGGG - Intergenic
963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
964686864 3:159404862-159404884 ACCAAACACAGTCCCAGTGGTGG + Intronic
964719342 3:159756110-159756132 ACTAGACAGTACCTCAGTAGGGG + Intronic
967582773 3:191179363-191179385 AGTAGGCAGTGCCCCAGTTGAGG - Intergenic
967633918 3:191778611-191778633 ACCAGGTAGTGCCCCAGTGTGGG - Intergenic
969829333 4:9782129-9782151 ACCTGTGAGGGCCCCAGTGGCGG - Exonic
969831502 4:9801308-9801330 ACCAGGCAGTGGCCCAGGAGGGG - Intronic
969997096 4:11324307-11324329 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
971510482 4:27417524-27417546 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
971962556 4:33507763-33507785 ACTAGGCAGTGCCCTAGTTGGGG - Intergenic
973627591 4:52788815-52788837 AACAGAAAGTGCCACACTGGAGG + Intergenic
974215594 4:58842298-58842320 ACCCTACAGAGCCACAGTGGTGG + Intergenic
974239108 4:59221648-59221670 ACCAGAGAGTTCACCAGTGTTGG + Intergenic
974485124 4:62494500-62494522 ATTAGGCAATGCCCCAGTGGGGG - Intergenic
974716897 4:65679181-65679203 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
975230264 4:71924361-71924383 ACAAGACAGTGCCCTAATGGGGG - Intergenic
975301685 4:72797795-72797817 ACTAGGCAGTTTCCCAGTGGGGG + Intergenic
976715669 4:88120308-88120330 ACTAAGCAGTGCCTCAGTGGGGG - Intronic
979087235 4:116428498-116428520 AATAGGCAGTGCCCCAGTGGGGG - Intergenic
980489011 4:133500684-133500706 AGCAGACAATGGCCCACTGGTGG + Intergenic
981398850 4:144288107-144288129 ACCAGTCAATGCCCAAGTGAGGG + Intergenic
981799318 4:148637300-148637322 ACTAGGCAGTGCCCCAGTTAGGG + Intergenic
981959786 4:150522886-150522908 ACTAGGCATTGCCCTAGTGGGGG - Intronic
982184545 4:152782002-152782024 ACAAGACACTGCCTAAGTGGTGG - Intronic
982184555 4:152782177-152782199 ACAAGACACTGCCTAAGTGGTGG - Intronic
982763714 4:159319166-159319188 ACCAGTCTGTGGCCCAGGGGTGG - Intronic
982987744 4:162232199-162232221 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
983419214 4:167496290-167496312 ACTAGGCAGTGCCCCAGTTGGGG + Intergenic
983469288 4:168136784-168136806 ACTAGGCAGTGTCCCAGTGTGGG + Intronic
983534119 4:168839320-168839342 ACCAGATGGTGCCCCTGTTGGGG + Intronic
983713972 4:170754685-170754707 ACTAAACAGTTCCCCAGTAGGGG - Intergenic
985175259 4:187193597-187193619 ACCAAACAATGGCCCAGTGAGGG - Intergenic
985278412 4:188261837-188261859 ACCACACAGTCCCACAGTGCTGG + Intergenic
986010738 5:3712720-3712742 ACCAAACTGTGCCCCAGGGGAGG - Intergenic
986014706 5:3747781-3747803 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
986494322 5:8327269-8327291 ACCTGAAAGAGCCACAGTGGGGG + Intergenic
986533424 5:8761979-8762001 ACTAGGCAGTGCCCTAGTGAGGG - Intergenic
987881296 5:23749510-23749532 ACTAGGCAGTGACCCAGTGGGGG + Intergenic
987983876 5:25121578-25121600 ACTGGGCAGTGCCCCAGTGGGGG + Intergenic
988854894 5:35219001-35219023 ACCAGCCAGTGCCCTGTTGGCGG + Intronic
990093384 5:52083078-52083100 ACTAGGCAGTGCCCCAGTAGGGG + Intergenic
990705423 5:58523615-58523637 ACCCATGAGTGCCCCAGTGGTGG - Intergenic
991295171 5:65072957-65072979 AACGGACAGAGCCCCAGTTGTGG - Intergenic
991321950 5:65383761-65383783 ACTAGGCATTGCCCTAGTGGGGG + Intronic
993117545 5:83735638-83735660 ACTAGGCAGTGCACCAGTGGCGG - Intergenic
993967149 5:94372293-94372315 GCTAGGCAGTGCCCCAGTGGGGG + Intronic
994101838 5:95902142-95902164 ACCAAACAGTGCCCAAATGTTGG + Intronic
995049743 5:107688577-107688599 ACCAGGCACGGTCCCAGTGGTGG + Intergenic
996049147 5:118912069-118912091 ACCAAACAGTGCCCCTCTGATGG - Intronic
996098142 5:119420749-119420771 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
997814235 5:137000545-137000567 AACAGAAGGTGCCCCAGTGCTGG + Intronic
998450087 5:142227503-142227525 AACAGACAGTTCCCCAGCTGGGG - Intergenic
1000674618 5:164105600-164105622 ACTATGCAGTGTCCCAGTGGGGG - Intergenic
1000751074 5:165097449-165097471 ACTAGGCAGTGCCCCAGTAAGGG + Intergenic
1001181632 5:169526058-169526080 ACTAGACAGTGCCCCAGTAGGGG + Intergenic
1002157707 5:177295826-177295848 ACCAGACAGAGCCCCATTGAGGG + Exonic
1002757155 6:172799-172821 ACTAGGCAGTGCCCCAGGTGGGG - Intergenic
1006510024 6:34516563-34516585 ACCAGCCCCTGCTCCAGTGGAGG - Intronic
1009392027 6:63155901-63155923 ACAAGCATGTGCCCCAGTGGAGG - Intergenic
1010479856 6:76338055-76338077 ACCAGCAACTGCTCCAGTGGAGG + Intergenic
1010898241 6:81392604-81392626 ATTAGGCAGTGTCCCAGTGGAGG - Intergenic
1011345832 6:86368889-86368911 ACCAGGCAGTGCCCTAGTAGAGG - Intergenic
1012041701 6:94213595-94213617 ACCAGAAAGTTCATCAGTGGAGG - Intergenic
1012649579 6:101736296-101736318 ACTAGGCAGTGCCCCAGTAGGGG + Intronic
1012940576 6:105410388-105410410 ACCCAGCAGTGTCCCAGTGGTGG + Intergenic
1013613398 6:111817884-111817906 ACCAGACAGTGCCCCAGTGGAGG - Intronic
1014068112 6:117150571-117150593 ACTAGGCAGTGCCCCAGTAGGGG + Intergenic
1014563053 6:122914089-122914111 ACTAGGCAGTGCCCCAGTTGGGG - Intergenic
1016912251 6:149210696-149210718 TCCAGACTGTGGCCCAGTGAGGG + Intergenic
1017309257 6:152957192-152957214 ACTAGCCATTGCCCTAGTGGGGG - Intergenic
1018527493 6:164729086-164729108 ACTAGGCAGTGCCTCAGTGAAGG - Intergenic
1018573767 6:165236853-165236875 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
1019923638 7:4178615-4178637 GCCAGAGAGGGCCACAGTGGTGG + Intronic
1022369371 7:29756580-29756602 TACAGACAGTGCTGCAGTGGGGG - Intergenic
1022520886 7:31006264-31006286 ACCAGACACTGCCTCTCTGGTGG + Intergenic
1023931430 7:44708726-44708748 AGCAGCCAGTGCCCCGGTGGTGG - Exonic
1024840080 7:53575231-53575253 ACCAGCCCCTGCTCCAGTGGAGG - Intergenic
1027584781 7:80044629-80044651 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1028646007 7:93097474-93097496 ACTAAACATTGCCACAGTGGGGG - Intergenic
1028987923 7:97022405-97022427 ACCAGACAATGCCCCTTTTGCGG + Intronic
1030486209 7:110171474-110171496 ACCAGACAGGGCCCTAGATGAGG - Intergenic
1033574112 7:142663342-142663364 ACCAGACAGTGACCACGTGTAGG - Intergenic
1033885064 7:145934277-145934299 ACTAGTCAGTGCCCCAGTGCGGG - Intergenic
1033910732 7:146260319-146260341 ACTAGGCAGTGCCCCAGGTGGGG - Intronic
1034451611 7:151139974-151139996 ACCAGCCAGTGGCCCAGCTGAGG + Exonic
1035832170 8:2708291-2708313 ACCAAACTGTTCCTCAGTGGCGG - Intergenic
1035971612 8:4255801-4255823 GCCAGCCAGTGCCCCAGAGGAGG - Intronic
1037823337 8:22146449-22146471 GACAGACATTTCCCCAGTGGAGG + Intergenic
1037895068 8:22646497-22646519 CCCAAACAGTGATCCAGTGGAGG + Intronic
1039609285 8:38906202-38906224 ACCAGAGAGGGCACCAGTGCAGG - Intronic
1042294414 8:67203890-67203912 CCCAGACAGTTCCCATGTGGCGG - Intronic
1043993157 8:86780825-86780847 ACTAGGCAGTGCCCCAGTTTGGG - Intergenic
1044718600 8:95124036-95124058 ACTAGGCAGAGCCCCAGTGGGGG - Intergenic
1044845236 8:96373790-96373812 ATCAGCCACTGCCCTAGTGGTGG - Intergenic
1044947828 8:97407739-97407761 ACCAGCACCTGCCCCAGTGGAGG + Intergenic
1045422127 8:102026719-102026741 ACTAGGCAGTGCCCCAGTGGAGG + Intronic
1046146848 8:110171977-110171999 ACTAGGCAGTGCACCAGTGGGGG - Intergenic
1046284150 8:112073711-112073733 ACAGCACAATGCCCCAGTGGTGG + Intergenic
1047955698 8:129973634-129973656 ACCAGACAGTGACTCAGGGAAGG + Intronic
1048975836 8:139672659-139672681 TCCAGACACAGCCCCCGTGGGGG + Intronic
1049372304 8:142273685-142273707 ACCACACACTCCCACAGTGGGGG + Intronic
1049594550 8:143477414-143477436 CCCAGACAGTGCCCGGCTGGGGG - Intronic
1051713439 9:19956939-19956961 ACCAGACACTGCATCTGTGGAGG + Intergenic
1052420345 9:28235096-28235118 ACCTGGCAGAGTCCCAGTGGTGG + Intronic
1052577752 9:30311996-30312018 ATTAGGCAGTGCCCCAGTGTGGG + Intergenic
1055175549 9:73313800-73313822 ACTAGGCAGTGTCCCAGTAGGGG + Intergenic
1057132816 9:92666522-92666544 TCCAGACACTGACCCTGTGGGGG - Intronic
1057331669 9:94120878-94120900 ACTAGGCACTGCCCTAGTGGGGG - Intergenic
1058230369 9:102417427-102417449 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
1058499024 9:105591708-105591730 AGTAGGCAGTGCCCCAGTGGGGG + Intronic
1061255172 9:129451124-129451146 CACAGACCCTGCCCCAGTGGAGG - Intergenic
1061877141 9:133549895-133549917 AACACACAGTCCCCAAGTGGTGG + Intronic
1062221317 9:135417505-135417527 CCCAGAACGTGCCCCAGTGCTGG + Intergenic
1062287859 9:135781089-135781111 GCAACACAGAGCCCCAGTGGAGG - Intronic
1062639444 9:137510792-137510814 ACCAGGCAGTGCCCCCGTGTGGG + Intronic
1187133569 X:16525877-16525899 ACTAAGCAGTGCCCCAGTTGGGG + Intergenic
1188134918 X:26483648-26483670 ACTAGGCAGTGTCCCAGTGGGGG - Intergenic
1188150975 X:26674836-26674858 CCCAGACAATGAGCCAGTGGTGG + Intergenic
1188743165 X:33810718-33810740 GCCAGAGACTGCACCAGTGGCGG + Intergenic
1189170067 X:38900690-38900712 ACTAGGCATTGCCCTAGTGGGGG - Intergenic
1189435712 X:40990949-40990971 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1190772554 X:53527294-53527316 ACCAGGCAGTGTCCCAGTGGGGG - Intergenic
1191970897 X:66815273-66815295 ACCAGCACCTGCCCCAGTGGAGG + Intergenic
1191987711 X:67000549-67000571 ACTAGGCAGTGCCCCAGTGGAGG + Intergenic
1192713556 X:73616474-73616496 ACTAGGCAGTGCCCCAGTGAGGG + Intronic
1193370754 X:80694395-80694417 ACTAGGCAGTACCCCAGTGGGGG - Intronic
1193865040 X:86720734-86720756 TCTAGGCAGTGCCCCAGTGGGGG + Intronic
1194178838 X:90688387-90688409 ACTATTCAGTGCCCCAGTGGTGG + Intergenic
1194850258 X:98860188-98860210 ACTAGGCAGTGCCCCACTGGGGG - Intergenic
1195536337 X:106012984-106013006 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1196723388 X:118875475-118875497 ACTAGGCATTGCCCTAGTGGGGG - Intergenic
1197088651 X:122510134-122510156 ACTAGGCAGTGCCCCAGTGTGGG + Intergenic
1197439954 X:126475890-126475912 ACTAGGCAGTGCCCTAGTGGGGG + Intergenic
1198230587 X:134685364-134685386 AACAGACTGTGACCCAGTGTGGG - Intronic
1198941696 X:141963835-141963857 ACTAGGCAGTGCCCTAGTGAGGG + Intergenic
1200162332 X:154015960-154015982 AGCAGGCACAGCCCCAGTGGCGG - Intronic
1200525502 Y:4270557-4270579 ACTATTCAGTGCCCCAGTGGTGG + Intergenic