ID: 1013617864

View in Genome Browser
Species Human (GRCh38)
Location 6:111861406-111861428
Sequence CACAACTACCACCTTAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013617864_1013617872 26 Left 1013617864 6:111861406-111861428 CCACATTTAAGGTGGTAGTTGTG 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1013617872 6:111861455-111861477 CTTAAATAATAGACGGCGTATGG No data
1013617864_1013617870 -8 Left 1013617864 6:111861406-111861428 CCACATTTAAGGTGGTAGTTGTG 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1013617870 6:111861421-111861443 TAGTTGTGGTAGCGGGGAGGTGG No data
1013617864_1013617871 19 Left 1013617864 6:111861406-111861428 CCACATTTAAGGTGGTAGTTGTG 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1013617871 6:111861448-111861470 AAAAGCACTTAAATAATAGACGG 0: 1
1: 0
2: 2
3: 57
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013617864 Original CRISPR CACAACTACCACCTTAAATG TGG (reversed) Intronic
900614557 1:3559257-3559279 CAAAACTACTACCTTCCATGGGG + Intronic
902555121 1:17242348-17242370 CTCAGCTACCACCTGAAATGTGG + Intronic
907758922 1:57338420-57338442 CACAGCTACCATCTAAAATGAGG - Intronic
910605415 1:89078269-89078291 CTCAACTTCCACCCTCAATGTGG - Intergenic
910927342 1:92410631-92410653 CACAACATCCACCTTTTATGGGG + Intergenic
911783353 1:101911896-101911918 CACAATTACCTACTTAAATAAGG - Intronic
915664384 1:157431382-157431404 CACAACTGCAAACTTGAATGCGG + Intergenic
917080942 1:171256431-171256453 CACAACTGCCTCTCTAAATGTGG + Intronic
919067490 1:192711862-192711884 CCCAACTAACACCTTGATTGTGG + Intergenic
919092346 1:192991057-192991079 CACAACTCCCATCTTGAAGGGGG + Intergenic
921768124 1:218997931-218997953 CAAAACTACAACATTTAATGAGG + Intergenic
923784677 1:237055479-237055501 CACAACTACCACCCAAATTTAGG - Intronic
924214986 1:241811699-241811721 CACATCCACCACCTGTAATGAGG + Intergenic
1064801119 10:19073222-19073244 CACAACTACCATATTAAAAATGG - Intronic
1068708329 10:60102539-60102561 CCCAACCACCACATTACATGGGG + Intronic
1069092486 10:64217979-64218001 GACAGCTAACACCTCAAATGAGG + Intergenic
1084077511 11:66792157-66792179 CACAACTAACCCCTTAAAAGGGG - Intronic
1088191100 11:107228916-107228938 CACTACTACCACATTGAATATGG + Intergenic
1092088185 12:5782953-5782975 CCAATCTACCACTTTAAATGGGG + Intronic
1094165010 12:27434936-27434958 CACAACCACCACCTTCCAAGGGG + Intergenic
1098708692 12:73725688-73725710 GACAAAAACCACCTTAAAAGAGG - Intergenic
1099036728 12:77597153-77597175 CAGGACTCCCACCTCAAATGAGG - Intergenic
1106739207 13:32620977-32620999 CACAATTAGCACTTGAAATGTGG - Intronic
1111763437 13:92496116-92496138 CAGCACTACCACCTGCAATGTGG - Intronic
1112925184 13:104665406-104665428 CCCAACTACCTTGTTAAATGGGG + Intergenic
1113100609 13:106713544-106713566 AACAACCACCAGCTTAACTGTGG - Intergenic
1119928563 14:78521359-78521381 GACATCTACCACATTTAATGCGG + Intronic
1120071885 14:80112864-80112886 CACAACAACCCCCTCCAATGAGG - Intergenic
1125167420 15:36724279-36724301 CACTACTACCACTATAATTGGGG - Intronic
1126527754 15:49676503-49676525 CACAACTACATCCTTACATCAGG - Intergenic
1127667964 15:61167706-61167728 TAAAAGTAACACCTTAAATGTGG - Intronic
1128478701 15:68019233-68019255 CACAGCCCCCACCTTCAATGAGG + Intergenic
1131080206 15:89528323-89528345 GATAACTACCACCCTAAATTTGG - Intergenic
1132161496 15:99547263-99547285 CACAACTGCCACCTTGGAAGTGG + Intergenic
1144042422 17:11424612-11424634 AATAACTACCATCTTAAGTGTGG - Intronic
1150747813 17:67830550-67830572 CACATCAATCCCCTTAAATGGGG - Intronic
1151136535 17:71951330-71951352 CACAATTACCATTTTAGATGAGG - Intergenic
1151236455 17:72723497-72723519 CACAACCATCACCCTACATGTGG + Intronic
1158771009 18:60516970-60516992 AACAAGTTCCATCTTAAATGGGG - Intergenic
1163947624 19:20554442-20554464 GACAACTGCCAGATTAAATGTGG + Intronic
929616378 2:43312328-43312350 CACAACTCTCACATTATATGAGG + Intronic
930717027 2:54603002-54603024 CAGAACTCCTACATTAAATGTGG + Intronic
931619722 2:64197915-64197937 CACAAATTCAACCTTAAAGGAGG + Intergenic
935452626 2:103227618-103227640 CACAACTACCTGATTAGATGAGG + Intergenic
935478876 2:103560509-103560531 CAGAACTCCCACCATACATGGGG - Intergenic
936584564 2:113743876-113743898 CACAAATACCATCTAAAACGTGG + Intronic
943481417 2:188423977-188423999 CACAGCTTCCTCCTGAAATGAGG - Intronic
943592644 2:189817411-189817433 CACCACTACCACATAAAATTAGG - Intronic
945229219 2:207567146-207567168 CAAAACTACCAACTAAAATAAGG - Intronic
945550013 2:211209821-211209843 CACAACTTACAGCTCAAATGTGG - Intergenic
1170581450 20:17702498-17702520 CCCAACTGGCAACTTAAATGAGG + Intronic
1170873175 20:20226894-20226916 TACAACTCCCACCTTTAATTTGG - Intronic
1172323730 20:34018184-34018206 TACTACTACAACCTTAAATCTGG - Intronic
1174730983 20:52917377-52917399 CACACCTACCTCCTTCTATGAGG - Intergenic
1175180833 20:57146009-57146031 CACAACTACCACATCCAAAGAGG + Intergenic
956930757 3:74040255-74040277 CCCAACCACCTCCTTAATTGGGG - Intergenic
960224208 3:115149831-115149853 CATAACTACTACCTTAAATAGGG - Intergenic
961162963 3:124745184-124745206 CTCAAACACCACCTTGAATGTGG - Exonic
964373558 3:156027404-156027426 CACAACTGACACCTTAGGTGTGG + Intergenic
965005663 3:163019347-163019369 CAAGACTACCACCTTCAAAGAGG + Intergenic
968417583 4:453498-453520 CACAACTGCAAACTTGAATGTGG + Intronic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
975567742 4:75776948-75776970 CAGAACTACTACCTTGAATATGG + Intronic
976250956 4:83051448-83051470 CACAACATCCACCTTATCTGTGG - Intronic
977058194 4:92219790-92219812 CATAACTGAAACCTTAAATGGGG - Intergenic
977322901 4:95541791-95541813 CAGAAGAACCACCTTATATGTGG - Intronic
983748639 4:171234427-171234449 CATAACTTCCACTGTAAATGGGG + Intergenic
987246516 5:16054527-16054549 TCCAGCTACCACCTTCAATGAGG + Intergenic
989205069 5:38802045-38802067 CCCAACTAACACCTTGATTGCGG - Intergenic
991263185 5:64688699-64688721 TACAGCTACCACGTAAAATGAGG - Intergenic
992232683 5:74679162-74679184 CATAACGAACACCTTAAATATGG + Intronic
994796686 5:104309930-104309952 CAAAACTACAAACTTGAATGTGG + Intergenic
1000009718 5:157219797-157219819 CACACCTCCCATCTTAAGTGAGG + Intronic
1000573959 5:162952532-162952554 CACAACTACAACTTTAACTCTGG + Intergenic
1012200574 6:96401378-96401400 CACAATTTCCATTTTAAATGAGG - Intergenic
1013150528 6:107441632-107441654 AAGAATTCCCACCTTAAATGAGG - Intronic
1013617864 6:111861406-111861428 CACAACTACCACCTTAAATGTGG - Intronic
1016862447 6:148734437-148734459 CCCAATTACCACATTAAATCTGG + Intergenic
1020573990 7:9902398-9902420 CACAGCTACAACATTAAATAGGG - Intergenic
1020700360 7:11474413-11474435 CACAACTACGACTTGGAATGGGG - Exonic
1022772666 7:33491294-33491316 CAAAGCTACCACATTAAATGTGG + Intronic
1023257516 7:38326758-38326780 CACAACTTCAACTTTACATGTGG - Intergenic
1024441109 7:49418932-49418954 AACACCTGCCACATTAAATGAGG - Intergenic
1024653365 7:51427911-51427933 GACAATTACCACCTGGAATGGGG + Intergenic
1024863831 7:53880313-53880335 CACCACCACCACCTTCACTGTGG + Intergenic
1027694146 7:81387796-81387818 CACAATAAACACCTGAAATGTGG - Intergenic
1028781100 7:94737308-94737330 CACAAATAAGACTTTAAATGTGG - Intergenic
1031314716 7:120241604-120241626 AACAATTACCACTTTAAAGGAGG + Intergenic
1032694461 7:134322288-134322310 CAGCACTACCCCCTTCAATGAGG - Intergenic
1039545687 8:38409548-38409570 CACATTTAACACCTGAAATGTGG - Intergenic
1043017783 8:74962559-74962581 TGCAACTACCACATAAAATGAGG + Intergenic
1045750493 8:105478119-105478141 GACATCTTCCATCTTAAATGCGG + Intronic
1046846150 8:118919000-118919022 CACACCTAGCACCTTGATTGTGG + Intergenic
1050817169 9:9829647-9829669 CAAAACCACTACATTAAATGAGG + Intronic
1052041347 9:23742321-23742343 AATAACTACCACAGTAAATGGGG + Intronic
1055702528 9:78961245-78961267 CACATCTACCCACTTGAATGGGG - Intergenic
1058312615 9:103523770-103523792 AACACCTACCACCTTACAGGGGG + Intergenic
1062511293 9:136907609-136907631 CACACCTCCCACCTGCAATGAGG + Intronic
1187102547 X:16209729-16209751 CACTAATAACACCTGAAATGGGG + Intergenic
1188575752 X:31647871-31647893 CACAACTACTGCTTTGAATGGGG + Intronic
1189287891 X:39865128-39865150 CAAAAATACCTTCTTAAATGTGG - Intergenic
1192739336 X:73877484-73877506 CACATCAAGCACCTGAAATGTGG + Intergenic
1194523100 X:94942727-94942749 CACAACCAGCACTTTAACTGTGG + Intergenic
1197472883 X:126884021-126884043 CACAAGTACCAGCACAAATGGGG - Intergenic
1197705170 X:129629801-129629823 CACAACTTCAACCTTAATTTGGG - Intergenic
1201972991 Y:19816521-19816543 CACAACTACTAACTAACATGTGG - Intergenic