ID: 1013623950

View in Genome Browser
Species Human (GRCh38)
Location 6:111918912-111918934
Sequence ACTCCTGGACTCACACATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013623950_1013623957 15 Left 1013623950 6:111918912-111918934 CCCAGATGTGTGAGTCCAGGAGT No data
Right 1013623957 6:111918950-111918972 CTGTTAGTCACAGCCCACAGTGG No data
1013623950_1013623954 -8 Left 1013623950 6:111918912-111918934 CCCAGATGTGTGAGTCCAGGAGT No data
Right 1013623954 6:111918927-111918949 CCAGGAGTCCCAGGCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013623950 Original CRISPR ACTCCTGGACTCACACATCT GGG (reversed) Intergenic
No off target data available for this crispr