ID: 1013628154

View in Genome Browser
Species Human (GRCh38)
Location 6:111958022-111958044
Sequence GGCTGAGCTCCCTGTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013628152_1013628154 -9 Left 1013628152 6:111958008-111958030 CCGAGGTGGCAGGAGGCTGAGCT No data
Right 1013628154 6:111958022-111958044 GGCTGAGCTCCCTGTGGTGCTGG No data
1013628148_1013628154 5 Left 1013628148 6:111957994-111958016 CCTGGGGATAAGGGCCGAGGTGG No data
Right 1013628154 6:111958022-111958044 GGCTGAGCTCCCTGTGGTGCTGG No data
1013628147_1013628154 6 Left 1013628147 6:111957993-111958015 CCCTGGGGATAAGGGCCGAGGTG No data
Right 1013628154 6:111958022-111958044 GGCTGAGCTCCCTGTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013628154 Original CRISPR GGCTGAGCTCCCTGTGGTGC TGG Intergenic
No off target data available for this crispr