ID: 1013630670

View in Genome Browser
Species Human (GRCh38)
Location 6:111983136-111983158
Sequence ATGCACAGTAAATGCAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013630668_1013630670 -10 Left 1013630668 6:111983123-111983145 CCTGTTCAATGAGATGCACAGTA No data
Right 1013630670 6:111983136-111983158 ATGCACAGTAAATGCAAGGATGG No data
1013630667_1013630670 17 Left 1013630667 6:111983096-111983118 CCTGGCAAAAAAAAAAAAAAAAA 0: 115
1: 1596
2: 8027
3: 56389
4: 160126
Right 1013630670 6:111983136-111983158 ATGCACAGTAAATGCAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013630670 Original CRISPR ATGCACAGTAAATGCAAGGA TGG Intergenic
No off target data available for this crispr