ID: 1013632163

View in Genome Browser
Species Human (GRCh38)
Location 6:111996174-111996196
Sequence ACGAGAGGCAGCCTACACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013632163_1013632165 -10 Left 1013632163 6:111996174-111996196 CCCAAGTGTAGGCTGCCTCTCGT No data
Right 1013632165 6:111996187-111996209 TGCCTCTCGTAATAAGTTCTCGG No data
1013632163_1013632167 28 Left 1013632163 6:111996174-111996196 CCCAAGTGTAGGCTGCCTCTCGT No data
Right 1013632167 6:111996225-111996247 AAGCCTCCTCACAGAAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013632163 Original CRISPR ACGAGAGGCAGCCTACACTT GGG (reversed) Intergenic
No off target data available for this crispr