ID: 1013632164

View in Genome Browser
Species Human (GRCh38)
Location 6:111996175-111996197
Sequence TACGAGAGGCAGCCTACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013632164_1013632167 27 Left 1013632164 6:111996175-111996197 CCAAGTGTAGGCTGCCTCTCGTA No data
Right 1013632167 6:111996225-111996247 AAGCCTCCTCACAGAAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013632164 Original CRISPR TACGAGAGGCAGCCTACACT TGG (reversed) Intergenic
No off target data available for this crispr