ID: 1013632166

View in Genome Browser
Species Human (GRCh38)
Location 6:111996189-111996211
Sequence AGCCGAGAACTTATTACGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013632166_1013632172 30 Left 1013632166 6:111996189-111996211 CCTCTCGTAATAAGTTCTCGGCT No data
Right 1013632172 6:111996242-111996264 CCACGGTCGTGGCTGCATCCTGG No data
1013632166_1013632170 19 Left 1013632166 6:111996189-111996211 CCTCTCGTAATAAGTTCTCGGCT No data
Right 1013632170 6:111996231-111996253 CCTCACAGAAGCCACGGTCGTGG No data
1013632166_1013632167 13 Left 1013632166 6:111996189-111996211 CCTCTCGTAATAAGTTCTCGGCT No data
Right 1013632167 6:111996225-111996247 AAGCCTCCTCACAGAAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013632166 Original CRISPR AGCCGAGAACTTATTACGAG AGG (reversed) Intergenic
No off target data available for this crispr