ID: 1013632167

View in Genome Browser
Species Human (GRCh38)
Location 6:111996225-111996247
Sequence AAGCCTCCTCACAGAAGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013632166_1013632167 13 Left 1013632166 6:111996189-111996211 CCTCTCGTAATAAGTTCTCGGCT No data
Right 1013632167 6:111996225-111996247 AAGCCTCCTCACAGAAGCCACGG No data
1013632163_1013632167 28 Left 1013632163 6:111996174-111996196 CCCAAGTGTAGGCTGCCTCTCGT No data
Right 1013632167 6:111996225-111996247 AAGCCTCCTCACAGAAGCCACGG No data
1013632164_1013632167 27 Left 1013632164 6:111996175-111996197 CCAAGTGTAGGCTGCCTCTCGTA No data
Right 1013632167 6:111996225-111996247 AAGCCTCCTCACAGAAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013632167 Original CRISPR AAGCCTCCTCACAGAAGCCA CGG Intergenic
No off target data available for this crispr