ID: 1013633191

View in Genome Browser
Species Human (GRCh38)
Location 6:112005064-112005086
Sequence GACTGGAGGAGGGTGGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013633191_1013633202 22 Left 1013633191 6:112005064-112005086 CCTGACACCACCCTCCTCCAGTC No data
Right 1013633202 6:112005109-112005131 GGCTTCCAGCCATGAGTGAACGG No data
1013633191_1013633199 1 Left 1013633191 6:112005064-112005086 CCTGACACCACCCTCCTCCAGTC No data
Right 1013633199 6:112005088-112005110 CACTTCCATGCTCATTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013633191 Original CRISPR GACTGGAGGAGGGTGGTGTC AGG (reversed) Intergenic
No off target data available for this crispr