ID: 1013634913

View in Genome Browser
Species Human (GRCh38)
Location 6:112020099-112020121
Sequence TGCACAAAGCCCCATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013634909_1013634913 25 Left 1013634909 6:112020051-112020073 CCAAGTATTGTGCTGAGGGTTTC No data
Right 1013634913 6:112020099-112020121 TGCACAAAGCCCCATGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013634913 Original CRISPR TGCACAAAGCCCCATGGGGT AGG Intergenic
No off target data available for this crispr