ID: 1013641509

View in Genome Browser
Species Human (GRCh38)
Location 6:112087410-112087432
Sequence GACCCAGTCGGTGGTCGTAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 18}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013641509_1013641514 -5 Left 1013641509 6:112087410-112087432 CCTGTACGACCACCGACTGGGTC 0: 1
1: 0
2: 1
3: 2
4: 18
Right 1013641514 6:112087428-112087450 GGGTCATGGTGGTGCGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 75
1013641509_1013641519 19 Left 1013641509 6:112087410-112087432 CCTGTACGACCACCGACTGGGTC 0: 1
1: 0
2: 1
3: 2
4: 18
Right 1013641519 6:112087452-112087474 TCCGGGAGCTTGCTAGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 35
1013641509_1013641515 1 Left 1013641509 6:112087410-112087432 CCTGTACGACCACCGACTGGGTC 0: 1
1: 0
2: 1
3: 2
4: 18
Right 1013641515 6:112087434-112087456 TGGTGGTGCGCCGCCGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 51
1013641509_1013641516 2 Left 1013641509 6:112087410-112087432 CCTGTACGACCACCGACTGGGTC 0: 1
1: 0
2: 1
3: 2
4: 18
Right 1013641516 6:112087435-112087457 GGTGGTGCGCCGCCGGCTCCGGG 0: 1
1: 0
2: 1
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013641509 Original CRISPR GACCCAGTCGGTGGTCGTAC AGG (reversed) Exonic
903386073 1:22927680-22927702 GACCTAGTTGGTGGTTGCACAGG + Intergenic
904808398 1:33147503-33147525 GACCCAGTGGGTGATCGGGCTGG - Exonic
923015580 1:230124369-230124391 GACCTGATCTGTGGTCGTACTGG + Intronic
1075232933 10:120699539-120699561 GAGCCAGTGGGTGGTCTCACTGG - Intergenic
1083672225 11:64305873-64305895 GACCCAGTCGAGGGTCGGACTGG + Intronic
1084180089 11:67441802-67441824 GACAGAGCCGGTGGTGGTACTGG - Exonic
1100717547 12:97321897-97321919 GATCCAGTGGGAGGACGTACAGG + Intergenic
1102473449 12:113173569-113173591 GACCCAGGCGGGGGTCACACAGG + Intronic
1132396614 15:101479548-101479570 GACCCAGAGGCTGGTCGGACAGG + Intronic
1132834343 16:1945229-1945251 TACCCAGTCGTTGGTACTACAGG - Intronic
1142809354 17:2387926-2387948 GAGCCAGTGGATGGACGTACTGG - Exonic
1172439949 20:34958284-34958306 GACCCAGTTTGTGGTAGGACTGG + Intergenic
1184511162 22:44934126-44934148 GACCCAGTGGGTGGTCCTGGTGG + Intronic
954289537 3:49642439-49642461 GACCCAGGCTGTGGTCCTCCTGG - Exonic
966305590 3:178530375-178530397 GACCCAAATCGTGGTCGTACTGG + Intronic
983196717 4:164814799-164814821 GGCTCAGGCGGTGGTGGTACAGG - Intergenic
985847633 5:2364168-2364190 GACCCAGTCAGTGGTCTCACAGG - Intergenic
996788955 5:127271600-127271622 GACCCAGTGGGTGGTCATGGGGG + Intergenic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1013641509 6:112087410-112087432 GACCCAGTCGGTGGTCGTACAGG - Exonic
1036599097 8:10242491-10242513 GACCCAGGTGGTGGTTGTAAGGG + Intronic
1046227984 8:111311210-111311232 GAGCAAGTTGGTGGTGGTACAGG - Intergenic