ID: 1013641813

View in Genome Browser
Species Human (GRCh38)
Location 6:112090957-112090979
Sequence GGATACAATAAGTTTCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013641813 Original CRISPR GGATACAATAAGTTTCAGTT AGG (reversed) Intronic
905698164 1:39991298-39991320 GGATTAAATAAGTTTCATTAGGG - Intergenic
905857454 1:41323318-41323340 GGAGAAACTAAGGTTCAGTTGGG + Intergenic
913114432 1:115683598-115683620 TGTTACATAAAGTTTCAGTTTGG - Intronic
914450032 1:147783119-147783141 GGATGCAACTATTTTCAGTTTGG - Intergenic
916387481 1:164291371-164291393 GGATTCTATTAGTATCAGTTAGG - Intergenic
918500769 1:185193383-185193405 GTATTCTATAAATTTCAGTTAGG + Intronic
921417014 1:214900198-214900220 GGATACATAAACTTACAGTTTGG - Intergenic
922298818 1:224277420-224277442 GGAGACATAAAGTTTCAGATAGG + Intronic
924934659 1:248757817-248757839 GGAAACAATATGGTTCTGTTAGG - Intergenic
1065466788 10:26033020-26033042 GAATACCATAAGTTTAATTTTGG - Intronic
1066071634 10:31820742-31820764 GGGTAAAAAAAATTTCAGTTTGG - Intronic
1066747719 10:38617899-38617921 GGATACAAAAAGTTCCATTGAGG + Intergenic
1068061207 10:52069716-52069738 GCATACAATAAGCTTCAGAATGG - Intronic
1068151461 10:53137770-53137792 GGATACATTAAGTTTGGGCTGGG + Intergenic
1074836019 10:117294886-117294908 GGCTATAAAAAGTTACAGTTAGG + Intronic
1074876290 10:117615981-117616003 TGCTGCAATAAGTTTCTGTTGGG + Intergenic
1076413913 10:130271436-130271458 GGAGACAAAGAGTTTCACTTGGG - Intergenic
1076931241 10:133533287-133533309 GGATACAAGAAGTTTCACCAAGG - Intronic
1077945554 11:6893876-6893898 GGAAACATCAACTTTCAGTTAGG + Intergenic
1078839132 11:15061644-15061666 GGACACAATATGTCTCAGCTAGG + Intronic
1079764026 11:24367388-24367410 GGAAACAATAAATTTCTGTAGGG + Intergenic
1080338458 11:31227548-31227570 GGATAAAATAAGTTTCTTTGTGG - Intronic
1080498044 11:32840682-32840704 GAATACAAGAAGTTTCACATAGG + Intronic
1082255785 11:50030961-50030983 GAAAACAAGATGTTTCAGTTAGG - Intergenic
1088046031 11:105452597-105452619 AGAAACAATAAGTCTGAGTTGGG - Intergenic
1093947073 12:25121131-25121153 GGATTCAGTAAGTTTGAGGTGGG + Intronic
1094760612 12:33528299-33528321 GAAGACAATAAGTTACAGTTGGG - Intergenic
1095857001 12:46871156-46871178 AGACACAATAAGTTAAAGTTTGG - Intergenic
1098769848 12:74538910-74538932 GGATACTAACAGTTTCAGTTTGG + Exonic
1098987342 12:77026620-77026642 GGAAATAAAAATTTTCAGTTAGG - Intronic
1099768787 12:87025436-87025458 TGATAGTATAATTTTCAGTTAGG - Intergenic
1100396747 12:94192425-94192447 GGATATAATGTGTATCAGTTAGG + Intronic
1105714621 13:23050323-23050345 GGATTCAATAAGTTTTATTGTGG + Intergenic
1107283211 13:38759955-38759977 AGTTACAATAAGTTACAGCTTGG + Intronic
1108082824 13:46754864-46754886 GCATAAAATCAGTTTCAGCTGGG + Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1109336824 13:61004861-61004883 TGAGAAAATAAGGTTCAGTTAGG + Intergenic
1109399158 13:61802199-61802221 GGGAACATAAAGTTTCAGTTAGG + Intergenic
1110356083 13:74569240-74569262 GTATACAAATATTTTCAGTTTGG - Intergenic
1114256715 14:21009325-21009347 GGTTTCAATGATTTTCAGTTAGG - Intergenic
1114998731 14:28393953-28393975 GGAGACAATAAATGTCTGTTGGG - Intergenic
1115603488 14:34977970-34977992 GTATACTAAGAGTTTCAGTTTGG + Intergenic
1116546702 14:46176743-46176765 GGGCACATTATGTTTCAGTTTGG + Intergenic
1121400368 14:93670840-93670862 GCATACAAAAAGAATCAGTTTGG + Intronic
1125788696 15:42345925-42345947 CGAGAAAATAAGTTTCTGTTGGG - Intronic
1126924255 15:53565133-53565155 GGGTACAATAAGTGTAAGATTGG + Intronic
1135010074 16:18868085-18868107 GGATAAAATAAGTTAAAGCTTGG - Intronic
1135316913 16:21455238-21455260 GGATAAAATAAGTTAAAGCTTGG - Intergenic
1135369836 16:21887479-21887501 GGATAAAATAAGTTAAAGCTTGG - Intergenic
1135441978 16:22483643-22483665 GGATAAAATAAGTTAAAGCTTGG + Intronic
1136313737 16:29435408-29435430 GGATAAAATAAGTTAAAGCTTGG - Intergenic
1136327179 16:29537174-29537196 GGATAAAATAAGTTAAAGCTTGG - Intergenic
1136441866 16:30277159-30277181 GGATAAAATAAGTTAAAGCTTGG - Intergenic
1136735037 16:32459395-32459417 GGATACAAAAAGTTCCATTGAGG - Intergenic
1136870732 16:33805137-33805159 GGGTAGAATAAGTTTAAGGTTGG - Intergenic
1138872955 16:60914807-60914829 GCATACATTAAGCTCCAGTTGGG + Intergenic
1139142003 16:64276750-64276772 AGATACAATGAGTTTCTTTTGGG - Intergenic
1139305716 16:65984410-65984432 GGGGACAATTAGTTTCTGTTTGG - Intergenic
1139816000 16:69672724-69672746 GAATAAATTAAGTTTCAGTTAGG - Intronic
1139888668 16:70230889-70230911 GGATAAAATAAGTTAAAGCTTGG - Intergenic
1140715176 16:77718598-77718620 GGATACTATAAGTATCAGAGCGG + Intergenic
1203018042 16_KI270728v1_random:370193-370215 GGATACAAAAAGTTCCATTGAGG + Intergenic
1203036377 16_KI270728v1_random:643351-643373 GGATACAAAAAGTTCCATTGAGG + Intergenic
1203101440 16_KI270728v1_random:1310921-1310943 GGGTAGAATAAGTTTAAGGTTGG + Intergenic
1145962481 17:28895655-28895677 GAAAACACTAAATTTCAGTTAGG + Intronic
1150927566 17:69549581-69549603 GGAAACAATAGGGTTCATTTAGG - Intergenic
1153390481 18:4552177-4552199 GGATAACAGAAGTTTCACTTTGG + Intergenic
1153486173 18:5600844-5600866 GCAAACATTAAATTTCAGTTGGG + Intronic
1155358413 18:24976908-24976930 TGATACAATGAGTTACAATTTGG + Intergenic
1166038283 19:40185753-40185775 GGAGACAATAGATTTCTGTTGGG - Intergenic
930796029 2:55392015-55392037 GCATAGAATGATTTTCAGTTGGG + Intronic
931743149 2:65266948-65266970 TGATAGAATGAGTTTCAGTGGGG + Intronic
932267730 2:70382816-70382838 GGATCCATTCAGTTTCAGGTAGG - Intergenic
933945948 2:87286316-87286338 GGTCACAATAAGGTTCAATTGGG + Intergenic
934310684 2:91860037-91860059 GGATACAAAAAGTTCCATTGAGG + Intergenic
934861571 2:97767844-97767866 GGATACAGTACATTTCAGCTAGG + Intronic
935503066 2:103865963-103865985 GGATTCATTAAGTTTCCATTTGG - Intergenic
936334264 2:111575270-111575292 GGTCACAATAAGGTTCAATTGGG - Intergenic
936672294 2:114671139-114671161 GATTAAAATAACTTTCAGTTGGG + Intronic
938210292 2:129461059-129461081 GGAAACAATAAGGGTCAGTCTGG + Intergenic
941632325 2:167898181-167898203 GGATACATTATGTTTCTGCTGGG + Intergenic
941919442 2:170834729-170834751 GGATACAATAATATTATGTTGGG - Intronic
943690734 2:190867155-190867177 GGATACAATAAATTGTACTTGGG + Intergenic
945003275 2:205375194-205375216 AAATACAAAAAGTTTCATTTTGG - Intronic
945492555 2:210473669-210473691 GGATACGTTAAGATTCACTTCGG + Intronic
947329228 2:229011361-229011383 TGGTAAAATAAGTTACAGTTGGG - Intronic
948190452 2:236054182-236054204 GGATCCAATTATTTTCAGTTTGG - Intronic
1176014224 20:62920743-62920765 GGAGACACTAAGTTTGAATTCGG + Intronic
1177457401 21:21358347-21358369 TGATACACTAACTTTCAGTGGGG + Intronic
1177911320 21:27036392-27036414 GGTTACAATATTTTTCAGTCAGG - Intergenic
1180537435 22:16405970-16405992 GGATACAAAAAGTTCCATTGAGG + Intergenic
1181979194 22:26753877-26753899 TTATTCAATAAATTTCAGTTGGG - Intergenic
952175040 3:30852909-30852931 GGTTACAATCAGTTACAGTGAGG - Intronic
952607045 3:35160720-35160742 GGATCCTATAAATGTCAGTTAGG - Intergenic
956658870 3:71581085-71581107 GGAAGAAATAAGTTTCATTTTGG + Intronic
957646133 3:82931132-82931154 GGATATAATAAGTTTTCATTTGG - Intergenic
958908794 3:99970545-99970567 GGATATGCTAGGTTTCAGTTAGG - Intronic
959363286 3:105422792-105422814 GGATACAAAATGTTTGAGTGAGG + Intronic
959791410 3:110366776-110366798 TGATACAATAAGTTTCAGAGGGG - Intergenic
961177900 3:124851033-124851055 GGATAAAATAAGTTGTAGGTGGG - Intronic
963333845 3:143948692-143948714 AGAAGCAATAAGTTTTAGTTTGG + Intergenic
964605308 3:158554478-158554500 GGATACATTCAGTTTCAGAGAGG - Intergenic
964904215 3:161698389-161698411 GGTTACAAAAAGTTACAGTGAGG - Intergenic
965225532 3:165984018-165984040 GTATACAGTAAATTTCAGTAGGG - Intergenic
970982499 4:22117034-22117056 TGATACAGTAAGTTTGATTTGGG - Intergenic
972883527 4:43456068-43456090 GGATACAATCAGTTTAAGAAAGG - Intergenic
975555064 4:75654565-75654587 AGATAAAAGAAGTTTCAGGTAGG + Intronic
975637702 4:76466839-76466861 GGAAGCAATAAGTTTAGGTTTGG + Intronic
977943844 4:102887980-102888002 GGATACAAAAAGTTCCATTGAGG + Exonic
979409680 4:120361472-120361494 GGATACAATATGTGTTATTTGGG - Intergenic
979949244 4:126872164-126872186 GGATAACATAATTTTCAGGTTGG + Intergenic
979951180 4:126896215-126896237 TAATACAGTAGGTTTCAGTTTGG - Intergenic
980155635 4:129101394-129101416 AGATAAAAGAAGTTACAGTTTGG + Intronic
982906476 4:161080988-161081010 TTATACAATATGTTTCAATTAGG + Intergenic
983548645 4:168991341-168991363 GAATACATTAATTTTCACTTAGG + Intronic
985361032 4:189175869-189175891 ATATACAATAAGTTTCTATTAGG + Intergenic
987276919 5:16372503-16372525 GGATAGTTTAAGTTTCAGATAGG - Intergenic
990408525 5:55516702-55516724 GGATACATAAAGTTTGAGTATGG - Intronic
990804665 5:59645496-59645518 AGATTCATTTAGTTTCAGTTTGG + Intronic
993825365 5:92678434-92678456 GGAAACTATAAGTTTCTATTGGG - Intergenic
995573359 5:113504300-113504322 GGAAACAATGAGTATCAGTTGGG - Intergenic
996078018 5:119220309-119220331 TGAAATAATAAGCTTCAGTTTGG - Intronic
996300160 5:121972327-121972349 GGAGAAAATAATTATCAGTTGGG - Intronic
1010873494 6:81070909-81070931 GAATAAGAAAAGTTTCAGTTTGG - Intergenic
1013641813 6:112090957-112090979 GGATACAATAAGTTTCAGTTAGG - Intronic
1018279964 6:162174806-162174828 GGACACAATGACTTTCTGTTGGG - Intronic
1023068072 7:36399428-36399450 TGTTCCAATAAGATTCAGTTTGG + Intronic
1029887384 7:103887699-103887721 GGATACAAGAAATGTCAGATGGG + Intronic
1041948302 8:63471923-63471945 GTATAGAATAATTTTTAGTTAGG + Intergenic
1041964564 8:63660118-63660140 GGATACAATAATTGTAATTTGGG + Intergenic
1043389791 8:79781389-79781411 GGATATAATTAGTTTGGGTTGGG + Intergenic
1043910490 8:85858275-85858297 CGACAAAATAAGTTTCAGTGTGG + Intergenic
1045136865 8:99230473-99230495 GAATAAAATAACTTTCAATTAGG - Intronic
1046710967 8:117511034-117511056 AAATACAATAATTTTGAGTTTGG + Intergenic
1046942149 8:119941657-119941679 GTATACAATAAGCATCAGTAAGG - Intronic
1047576023 8:126156253-126156275 GGAGAAAAAAAGTTTCAATTAGG - Intergenic
1056079294 9:83073977-83073999 GTATACATTATTTTTCAGTTCGG - Intergenic
1060845342 9:126832429-126832451 GGATAAAATAAGTTTATCTTTGG + Intronic
1061603485 9:131688918-131688940 GGAAACAATAAGCTTCACCTTGG + Intronic
1187859885 X:23671060-23671082 GGAAACACTAAATTTCAGATGGG - Intronic
1188660870 X:32757283-32757305 GGTTACACAAAATTTCAGTTAGG - Intronic
1196830789 X:119773927-119773949 GGATACATTAAGTTTGAGATTGG + Intergenic
1199673034 X:150162394-150162416 GGAGACAATGAGTTTGATTTTGG + Intergenic
1199879360 X:151960949-151960971 GGAGACAATGAATTTCATTTTGG + Intronic