ID: 1013643639

View in Genome Browser
Species Human (GRCh38)
Location 6:112113327-112113349
Sequence CAGCTTTTGCAGCTGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 278}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013643639_1013643647 22 Left 1013643639 6:112113327-112113349 CCAAGTTCCAGCTGCAAAAGCTG 0: 1
1: 0
2: 2
3: 23
4: 278
Right 1013643647 6:112113372-112113394 ACTCCCCAGCCATAGCATTCAGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013643639 Original CRISPR CAGCTTTTGCAGCTGGAACT TGG (reversed) Intronic
900524851 1:3123591-3123613 CAGCAGGTGCTGCTGGAACTGGG + Intronic
901320993 1:8339764-8339786 CAGATTGTGCAGCTGGTCCTGGG - Intronic
901878935 1:12182673-12182695 CAGCTTTTTAGGGTGGAACTAGG + Intronic
903271345 1:22190334-22190356 CAGCCTTGGCAGCTGGCCCTGGG + Intergenic
906082305 1:43101382-43101404 CAGCTTCCTCAGCTGGCACTGGG + Intergenic
906717835 1:47983585-47983607 CAGCTCTTCCAGCTGCAACTCGG + Intronic
907808906 1:57849074-57849096 CCTCTCTTGCAGCTGAAACTTGG + Intronic
913690358 1:121273945-121273967 CAGCCATTGCAACAGGAACTGGG + Intronic
914700911 1:150132810-150132832 CAGCTTTTTCAGCTGTAAAATGG + Intronic
915278213 1:154804184-154804206 GGGCATTTGCAGCAGGAACTGGG + Intronic
915565364 1:156709977-156709999 AAGCGTTGGCAGCTGGAGCTGGG - Intergenic
916332594 1:163634170-163634192 CAGCTGCTGGTGCTGGAACTAGG - Intergenic
916683776 1:167126724-167126746 CAACTTCTGCAGCAGGAACAAGG + Exonic
916953710 1:169809460-169809482 CAGAGTTTGCAGCTAGTACTTGG + Intronic
918963131 1:191306173-191306195 CAGCTTCTGCAGCTGGCACCAGG + Intergenic
919422817 1:197391936-197391958 CAGAATTTGTAGCTGAAACTTGG + Intronic
920421988 1:205841132-205841154 CAGATTTTACAACTGGACCTGGG - Intronic
920477677 1:206292433-206292455 CAGCCATTGCAACAGGAACTGGG + Intronic
920856069 1:209663051-209663073 CAACTTTTTCAGCTGGACCCTGG - Intergenic
921508745 1:216006590-216006612 CAGGTTTTCCAGTTTGAACTGGG + Intronic
1062802747 10:392223-392245 CAGCTTCTGCAGCAGGAAGGCGG + Intronic
1065783697 10:29193616-29193638 CTGCTTTTGATGCTGGAGCTGGG - Intergenic
1066101443 10:32121961-32121983 CAGCTTCCTCAGCTGGCACTGGG + Intergenic
1070519345 10:77238297-77238319 CTGCTGTTGCACCAGGAACTAGG - Intronic
1071568919 10:86685926-86685948 CAGCTGCTGCAGCAGGAAATTGG - Intronic
1072395350 10:95033673-95033695 CAGCTTTATGACCTGGAACTGGG - Intergenic
1072748506 10:97959068-97959090 CAGCCTTTGCAGTTAGACCTGGG + Intronic
1073992574 10:109279638-109279660 CACCTTGTGCAGCTGAAACCAGG - Intergenic
1074998563 10:118778599-118778621 CAGCTTTGACACCTGCAACTGGG + Intergenic
1075347044 10:121690447-121690469 CTGCTTTTACAGCTCCAACTTGG + Intergenic
1075360931 10:121833075-121833097 CAGTTTTTGCAACTGTAAATGGG - Intronic
1076186086 10:128450492-128450514 CAGCTTTAGCACCTGGAGCACGG + Intergenic
1077036943 11:499831-499853 CAGCTTTTCCAGGCGGCACTGGG + Exonic
1077108317 11:851336-851358 CAGCTCCTGCAGCTGGGAGTCGG + Intronic
1078024559 11:7682401-7682423 CAGCTTTACCAGCTGAAAATGGG - Intergenic
1078406686 11:11075977-11075999 CAGGCTCTGGAGCTGGAACTTGG + Intergenic
1082092526 11:48101557-48101579 CAGTTTGTGAACCTGGAACTTGG + Intronic
1085100709 11:73797536-73797558 CAGCTTTCACAGCTGGCACTGGG - Intronic
1085784220 11:79437449-79437471 CGGCGCTTGCGGCTGGAACTTGG + Intronic
1086092876 11:83021435-83021457 CAGCTTTCCCAGCTGGCACTGGG - Intronic
1087604099 11:100354109-100354131 CTCCTCTTGCAGGTGGAACTGGG - Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089402174 11:118170675-118170697 CAGCTTCTGATGCTGGAGCTGGG - Intronic
1089697196 11:120223181-120223203 CAGCTAAAGAAGCTGGAACTCGG - Intronic
1089773582 11:120820391-120820413 CAGGTTTTGCTGATGGAACAAGG + Intronic
1090124787 11:124074831-124074853 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1090943282 11:131407747-131407769 CTGGCTTTGCAGCTGGAACCAGG + Intronic
1091450965 12:571579-571601 CAGCCTTAGGAGCTGGGACTTGG - Intronic
1091630520 12:2156898-2156920 CAGCTTTCCCAGCTGCCACTGGG - Intronic
1092071835 12:5637557-5637579 CAGCTGATGCAGCTGGTCCTTGG - Intronic
1093764870 12:22951954-22951976 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1094447401 12:30546447-30546469 TAGCTTTTGCAGCTGGGAAGTGG - Intergenic
1097536077 12:60872512-60872534 CAGCTTTCACAGCTGGCACCAGG + Intergenic
1097649615 12:62280784-62280806 AGGCTCTTGCAGCTGGATCTGGG + Intronic
1098080250 12:66776860-66776882 CAGCTTTTTCAGAGGCAACTTGG + Intronic
1100138024 12:91579055-91579077 CAGATTTTTCAGCTGAAATTTGG - Intergenic
1100694651 12:97078826-97078848 CAGTTTTTGTATCTGGAACATGG + Intergenic
1102420794 12:112801280-112801302 CAGCATTTGGAGCAGGAGCTGGG + Intronic
1102760288 12:115379296-115379318 CAGTTTTTCCAGCTGGAAAATGG - Intergenic
1103607603 12:122098702-122098724 CAGGTTTTTCAGCTGGCTCTTGG + Intronic
1105041975 12:132967778-132967800 CAGCTTCAACAGCTGGCACTGGG - Intergenic
1106895138 13:34291802-34291824 CAGTCTTTGCAGCAGGAGCTGGG + Intergenic
1109622118 13:64924761-64924783 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1109927140 13:69158519-69158541 TTTCTTTTGCAGTTGGAACTTGG - Intergenic
1109982371 13:69924848-69924870 CAGCTTCCACAGCTGGCACTGGG - Intronic
1110245895 13:73324149-73324171 CAGCTTTTTGAGCTGCAACAAGG + Intergenic
1110810766 13:79808554-79808576 CAGCTTCCCCAGCTGGCACTGGG - Intergenic
1111958857 13:94787211-94787233 CAGAGTTTGCAGCTGAAATTGGG + Intergenic
1116231999 14:42229375-42229397 GAGCTATGGCAGCTGGAGCTGGG + Intergenic
1116864166 14:50017913-50017935 TAGCTCATGTAGCTGGAACTTGG - Intergenic
1117980834 14:61340530-61340552 CAACTATTGCTTCTGGAACTGGG + Intronic
1118946922 14:70397589-70397611 CAGCTTCTACAGCTGGCACTGGG + Intronic
1120038434 14:79725079-79725101 CAACTTCTGCACCTGGCACTTGG - Intronic
1121219723 14:92276494-92276516 CAGATTTGGGAGGTGGAACTAGG + Intergenic
1122491355 14:102117920-102117942 CAGCTTCCCCAGCTGGCACTGGG - Intronic
1122878320 14:104678876-104678898 CAGTTTCTGCAGCTGTACCTAGG - Intergenic
1123762245 15:23441976-23441998 CACCTGTGGCAGCAGGAACTTGG + Exonic
1124515084 15:30361066-30361088 CAGCTTTTGGGGCTGCAGCTGGG + Intergenic
1124703305 15:31936490-31936512 CAGATTATGCATCTGGAACAGGG + Intergenic
1124727838 15:32169661-32169683 CAGCTTTTGGGGCTGCAGCTGGG - Intronic
1126215312 15:46147025-46147047 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1126751265 15:51878986-51879008 CATTTGTTGCAGCTGTAACTTGG + Intronic
1126792687 15:52235366-52235388 GAGCTTTTGCATCAGGAAATGGG - Intronic
1128153352 15:65377189-65377211 CTGCATTTGGAGCTGGTACTGGG - Intronic
1130429306 15:83830785-83830807 CAGCTTCTGGTGCTGGAATTTGG + Intronic
1131305135 15:91236054-91236076 CAGGTTTTGCAGTTGGATCAGGG - Intronic
1131399900 15:92116112-92116134 CAGCTTTTTCATCTGTAAATGGG + Intronic
1131592496 15:93764890-93764912 CAGCTTTTTCAGCTGTAAAATGG + Intergenic
1132487066 16:199188-199210 CAGCTTTTGCTGCTGAAAACTGG + Exonic
1132895133 16:2225291-2225313 GAGCTTTTGGAGATGGAGCTTGG + Intronic
1133048567 16:3103221-3103243 CAGTCTTTGCAGCTGGAACATGG - Intergenic
1133253865 16:4504097-4504119 CAGCATTTGCAGCAGGCAATGGG + Intronic
1133502830 16:6381751-6381773 CATCTGCTGCTGCTGGAACTGGG + Intronic
1133733478 16:8595956-8595978 CAGCTTTTGCATCTGTAAAATGG - Intergenic
1134339615 16:13333119-13333141 CAGCTTTTGCACCTTGAATGGGG + Intergenic
1135117903 16:19739133-19739155 TAGCCCTTGCAGGTGGAACTGGG + Intronic
1135143737 16:19943610-19943632 CAGCTTTAGAAGTTTGAACTGGG - Intergenic
1135207409 16:20494731-20494753 CATCTTTTGCAGTAGGAATTGGG + Intergenic
1135211476 16:20528901-20528923 CATCTTTTGCAGTAGGAATTGGG - Intergenic
1135787860 16:25366586-25366608 CAGCTTTTCAACCTGTAACTGGG + Intergenic
1135857905 16:26029147-26029169 GAGTTTTTGTAACTGGAACTTGG + Intronic
1136026912 16:27474404-27474426 CAGCTTTTGCCGTTGGGGCTGGG + Intronic
1136545042 16:30949849-30949871 CTGCCTTTGAAGCTGGCACTGGG - Intronic
1137334211 16:47532653-47532675 CAGCTTCCACAGCTGGCACTGGG + Intronic
1138104183 16:54278532-54278554 CAGCTTTTGGCCCTGGAACGGGG - Intergenic
1139515399 16:67449704-67449726 CAGCTTTAGCAAATGGAACTGGG - Intronic
1139557923 16:67724407-67724429 AGGCTTTTGCAGCTGGAATGGGG - Exonic
1142717005 17:1752722-1752744 CAGCTTAGGCAGCCGGACCTTGG - Exonic
1142967467 17:3590480-3590502 CAGCTGCTGCAGGAGGAACTGGG + Intronic
1143464899 17:7130101-7130123 CAGTTTCTTCAGCTGGAAATGGG + Intergenic
1145796531 17:27658759-27658781 CAGCTTTTGGAGCAGCAGCTGGG + Intergenic
1145810966 17:27764035-27764057 CAGCTTTTGGAGCAGCAGCTGGG + Exonic
1145974957 17:28978560-28978582 CAGCATGTGCAGCTGGGACTTGG + Intronic
1148326829 17:46788165-46788187 CAGCTTTTCCTCCTGGAGCTTGG + Intronic
1149329958 17:55570430-55570452 CAGCTTCTCCAGCTGGCACCAGG - Intergenic
1149661685 17:58337477-58337499 CACCTTTTCCAGCTGGTCCTGGG - Intergenic
1149866254 17:60152585-60152607 CACCCTTTGCAGCTGGCTCTTGG + Intronic
1150139040 17:62713201-62713223 CAGCTTTTGCAGGAGGAAGCCGG - Intronic
1150470194 17:65430784-65430806 CAGCTGCTTCTGCTGGAACTCGG - Intergenic
1150634757 17:66905126-66905148 CAGCTCTTGCCCCTGGATCTGGG + Intergenic
1150809833 17:68347633-68347655 CAGCTTTGGTAGCTTGATCTTGG - Intronic
1151815260 17:76468576-76468598 CCTCTTTTGTAGCAGGAACTGGG - Intronic
1152642429 17:81454766-81454788 CAGCCTTGGCACCTGGAACAAGG - Intronic
1153405278 18:4731717-4731739 CAGCTTTTAAAGCTAAAACTTGG - Intergenic
1156508761 18:37617166-37617188 CAGCTTTCTCAGCTGGAAAGTGG + Intergenic
1157753685 18:50199495-50199517 AAGCTTTAGAAGCTGGAACGGGG - Intergenic
1158363157 18:56699834-56699856 CAGATGCTGCAGCTGGAAGTTGG + Intronic
1158649286 18:59272451-59272473 CAGCTCATGCAGCTGGTACGTGG + Exonic
1159818859 18:73114191-73114213 CAGCATTTGCAGCTCTATCTAGG - Intergenic
1160470898 18:79132416-79132438 CAGCTTTCTCATCTAGAACTCGG - Intronic
1160495896 18:79374955-79374977 CAGCTTTTGCATCTGCAAACTGG + Intronic
1160511114 18:79454077-79454099 CTGCTCTTGCAGATGGAACCAGG + Intronic
1163108834 19:15144669-15144691 CAGCCTTTGCAGGTGGAATTTGG - Intergenic
1163117400 19:15196770-15196792 CAGTTTTTGCATCTGGAAAATGG - Intronic
1163517437 19:17773652-17773674 CAGCATTTGTGGCTGGAACTTGG - Intronic
1163755807 19:19105608-19105630 CAGCTTGTGGCGCGGGAACTCGG + Exonic
925487526 2:4352337-4352359 CAGCCTTGGCAGCTGTCACTGGG - Intergenic
926625552 2:15086644-15086666 CAGCTTCCTCAGCTGGCACTGGG - Intergenic
929592725 2:43157691-43157713 CAGCTTCTGTAGCTGGAACTGGG + Intergenic
929888802 2:45902614-45902636 AAGTTCTTGGAGCTGGAACTTGG + Intronic
936117473 2:109713504-109713526 CAGCTTCTTCAGCTAGAAATTGG + Intergenic
937631311 2:124104832-124104854 CAGCTTTGGTAGCTGGTACTCGG + Intronic
939046073 2:137251749-137251771 CTGATTTTGAAGTTGGAACTGGG + Intronic
939628239 2:144504751-144504773 CAGCTTTCGCATCTGCAATTAGG - Intronic
941039271 2:160602144-160602166 CAGCTTTAGCAGGTGGAATAAGG - Intergenic
943570258 2:189565402-189565424 CAGCTTTCACAGCTAGAGCTGGG + Exonic
943737665 2:191374611-191374633 CAGCACTTCCAGCTGGTACTGGG - Intronic
943808631 2:192155692-192155714 CAGCTGTTGCAGTTGCTACTTGG - Intronic
946178877 2:217938174-217938196 TGCCTTTTGCAGCTGCAACTGGG + Intronic
946315247 2:218907036-218907058 CTGTTTTTGCAGCTGCCACTGGG - Intergenic
946938961 2:224751271-224751293 CAGGTTTACCAGCTGGCACTAGG + Intergenic
946949574 2:224858741-224858763 CAACTGTAGCAGTTGGAACTAGG - Intronic
948663010 2:239518300-239518322 CAGCTCTTACCACTGGAACTGGG + Intergenic
1168850829 20:975824-975846 CAGTTTTTCCAGCTGTAAATGGG + Intronic
1168983321 20:2026306-2026328 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1169305990 20:4490843-4490865 CAGTTTCTGCAGCTGGAGCAGGG - Intergenic
1170092438 20:12605268-12605290 CCAATTTTGCATCTGGAACTGGG + Intergenic
1171306163 20:24108462-24108484 CAATTTTTGCACCTGGAAATTGG - Intergenic
1173383651 20:42568646-42568668 CAGTTGTTGAAGCTGGGACTTGG + Intronic
1173516734 20:43669603-43669625 CTGCTTTTTCAGCTGGGATTAGG + Intronic
1173884449 20:46445308-46445330 CAGCTTCCACAGCTGGTACTGGG + Intergenic
1174416375 20:50369838-50369860 CAGCTGTTGAGGCTGGAACTTGG - Intergenic
1176214847 20:63943133-63943155 CAGCTCTGCCAGCAGGAACTGGG - Intronic
1176408524 21:6434985-6435007 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1176936198 21:14870049-14870071 CTGCTATTGCAGATGGAACTGGG - Intergenic
1176997578 21:15574633-15574655 CAGATTTTGCAGATGGAAGTGGG - Intergenic
1177262698 21:18750665-18750687 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1179684017 21:43043311-43043333 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1182351362 22:29701860-29701882 CGGGCTTTGCAGCTGGCACTGGG - Intergenic
1182704516 22:32268484-32268506 CATCTTTCCCAGCTGGAAATCGG - Intergenic
1183024872 22:35057570-35057592 CAGCTTTCACAGCTGGCACTGGG + Intergenic
1184266886 22:43352394-43352416 CAGCATTTGCAGGGGAAACTGGG - Intergenic
1184560812 22:45261991-45262013 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1184701093 22:46173094-46173116 CAGCTCTTGCAGAAGGTACTTGG + Intronic
1184865726 22:47200970-47200992 CAGCTTCCACAGCTGGCACTGGG + Intergenic
951346398 3:21551373-21551395 CAGCTTTTGCAGGTGAAATTAGG + Intronic
951562321 3:23981445-23981467 CAGCTTTCCCAGCTGGCACCTGG + Intergenic
952419401 3:33117820-33117842 CAGGCTCTGCAGCTGGAACATGG - Intronic
952789782 3:37190589-37190611 CAGTATTGGTAGCTGGAACTTGG + Intergenic
953930180 3:47002078-47002100 CAGCTGCTGCAGCTGCAAGTGGG - Exonic
954859215 3:53673636-53673658 GAGGTTTGGCAGCTGCAACTGGG + Intronic
956610660 3:71119350-71119372 CAGCCTTTCAAGCTGGAAATGGG - Intronic
956955059 3:74328745-74328767 CCCCTTTTCCAGCTGGAATTGGG + Intronic
958898854 3:99861826-99861848 CAGTTTTTGCAGCTGAATCCCGG + Intronic
959675442 3:109029863-109029885 CAGGTTTTGCATCAGAAACTTGG + Intronic
959692936 3:109219058-109219080 CAGCTGGTGAAGCTTGAACTGGG + Intergenic
961942873 3:130656002-130656024 CAGCTTCCACAGCTGGCACTGGG + Intronic
962785822 3:138767769-138767791 CAGCTTCCACAGCTGGCACTGGG + Intronic
963855232 3:150246695-150246717 CAGCTTTTGAAGTGGGAAATGGG + Intergenic
964380838 3:156097645-156097667 CAGCTTTGGCAGCTGAAGGTGGG + Intronic
964905786 3:161718932-161718954 CAGCTTTTGAAGCTGACACAGGG + Intergenic
966325261 3:178746259-178746281 AAGCCTTTGCAGCTGCCACTTGG - Intronic
968538529 4:1150375-1150397 CAGCTTCCACAGCTGGCACTGGG + Intergenic
969148484 4:5145039-5145061 CAGCTTTTGAAGTTTGAATTAGG - Intronic
969218596 4:5744244-5744266 CAGCTTTCTCACCTGGAAATGGG + Intronic
969490393 4:7496301-7496323 CAGCTTGAGCAGCCGGACCTTGG - Intronic
970959761 4:21857951-21857973 CAGCTTCCACAGCTGGCACTGGG - Intronic
974679329 4:65140783-65140805 CACTTTTTCCATCTGGAACTTGG - Intergenic
975541186 4:75514062-75514084 TACCTTTTCCACCTGGAACTGGG - Intronic
976647443 4:87400516-87400538 CAGCTTCCACAGCTGGCACTGGG - Intergenic
976734429 4:88295986-88296008 CAGCTTCCACAGCTGGCACTGGG + Intergenic
978229801 4:106385183-106385205 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
978985269 4:115004431-115004453 CTGCTTTTGCAGCTGGCTCATGG + Intronic
980253528 4:130348788-130348810 CAGCTTCCACAGCTGGCACTGGG + Intergenic
980375577 4:131942743-131942765 CAGCTTTTTTTGCTGGACCTGGG + Intergenic
980450317 4:132960456-132960478 CAGCTTCTACAGCTGACACTGGG - Intergenic
980493424 4:133560324-133560346 CAGCTTCCACAGCTGGGACTAGG + Intergenic
981660718 4:147163502-147163524 GAGCTTATCCAGCAGGAACTTGG + Intergenic
984102029 4:175498790-175498812 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
985891689 5:2720573-2720595 CTGCTTTTGCTGCTGGTGCTGGG - Intergenic
986032348 5:3906004-3906026 CAGCCTTTGCTGCTGGCACTGGG - Intergenic
986253048 5:6078720-6078742 CAGCTATGGCTGCTGGAACAGGG - Intergenic
987979934 5:25069831-25069853 CAGCCTGTGAAGCTTGAACTTGG - Intergenic
988649396 5:33131723-33131745 CAGCTGTAGCAGCTGGGACGTGG - Intergenic
988710523 5:33769828-33769850 CAGGTTTTGCAGCTGAAAAATGG + Intronic
989472480 5:41836515-41836537 CAGCTTTTTTGGCTGGTACTAGG + Intronic
989520778 5:42397296-42397318 CAGCTTCCACAGCTGGCACTGGG - Intergenic
991125160 5:63061425-63061447 CAGCTTATGCAGCTGTAGGTTGG - Intergenic
991359171 5:65802383-65802405 CAGCTTTCACAGCTGGCACTGGG + Intronic
992131964 5:73702381-73702403 CATCTTCTCCAGCTGAAACTCGG + Intronic
992474535 5:77088727-77088749 CATCTTTTGCTGCTGGAGCCTGG + Intergenic
993236044 5:85311651-85311673 CAGCTTTGACAGCTGGCACTGGG - Intergenic
993363392 5:87005036-87005058 CAGCTTTTATAGCTGGCATTAGG - Intergenic
993364624 5:87020363-87020385 CAGCCATTGCAGCTGGAACTGGG - Intergenic
996611782 5:125391135-125391157 CAGCTAGTTGAGCTGGAACTTGG - Intergenic
996665505 5:126055306-126055328 CAGTTTTTGCAGATGGTATTTGG + Intergenic
998419411 5:141969628-141969650 CAGCTTGTGAAGCTGTCACTTGG - Intronic
998510523 5:142710319-142710341 CTGCATTTGCAGGTGGACCTTGG - Intergenic
999691608 5:154150913-154150935 GAGCATTTGCAGCTGACACTAGG + Intronic
1000209256 5:159095911-159095933 CAAGTTCTGCAGCTGGGACTGGG + Intronic
1001535619 5:172495923-172495945 CAGCTTTTCCAGCTGTAAAATGG - Intergenic
1005103403 6:22198181-22198203 AAGCTCTTGCACCAGGAACTGGG + Intergenic
1005687850 6:28272298-28272320 GAGGATTTGCAGCTGGATCTTGG + Exonic
1006609618 6:35286345-35286367 CAGCCTGTGCAGCTGGAAGATGG + Exonic
1007717345 6:43864963-43864985 CAGCTTTTACAGCTGGAAAAGGG - Intergenic
1008956462 6:57221767-57221789 CACCTTCTCTAGCTGGAACTTGG + Exonic
1009195062 6:60674421-60674443 CAGCATTTTCAACTGGAACATGG + Intergenic
1009846805 6:69145347-69145369 CAGCTTCCACAGCTGGCACTGGG + Intronic
1012132807 6:95518746-95518768 CAGCTTCTGCTGCTGGCACAGGG + Intergenic
1012231079 6:96762070-96762092 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
1013122249 6:107151230-107151252 CAGCTTCTGCATCTGTAAATAGG + Intergenic
1013643639 6:112113327-112113349 CAGCTTTTGCAGCTGGAACTTGG - Intronic
1014011142 6:116477196-116477218 CATCTCTTGCATCTGGTACTGGG - Intergenic
1014874221 6:126636716-126636738 CAGTATTTGCAACTGGAATTTGG + Intergenic
1015663834 6:135604536-135604558 CAGCTTCCGCAGCTGGCACCAGG - Intergenic
1016758760 6:147715413-147715435 CAGCTTCCACAGCTGGCACTGGG + Intronic
1018358522 6:163042165-163042187 CACATATTGCAGCTGGAACGTGG + Intronic
1018363192 6:163093546-163093568 AAGCTTTTACAGCTGGAATATGG + Intronic
1018685736 6:166302929-166302951 CAGCCTTTACAGCAGGCACTAGG + Intergenic
1019017754 6:168892144-168892166 CAGGTTTTCCACCTGGATCTTGG + Intergenic
1019017768 6:168892223-168892245 CAGGTTTTCCACCTGGACCTTGG + Intergenic
1019017782 6:168892301-168892323 CAGGTTTTCCACCTGGACCTTGG + Intergenic
1019017798 6:168892380-168892402 CAGGTTTTCCACCTGGATCTGGG + Intergenic
1019017811 6:168892459-168892481 CAGGTTTTCCACCTGGATCTCGG + Intergenic
1019017826 6:168892538-168892560 CAGGTTTTCCATCTGGATCTGGG + Intergenic
1019017840 6:168892618-168892640 CAGGTTTTCCACCTGGATCTGGG + Intergenic
1019017880 6:168892856-168892878 CAGGTTTTCCACCTGGATCTGGG + Intergenic
1019500343 7:1361345-1361367 CAGCCTTTGAGGCTGGATCTTGG - Intergenic
1019605525 7:1908166-1908188 AGGCTGCTGCAGCTGGAACTGGG + Intronic
1021088566 7:16453139-16453161 CAGATGTTGGAGCTGGAACAAGG - Intergenic
1022104715 7:27189570-27189592 CAGCTTTGCCAGTTGGAGCTGGG - Intergenic
1023699511 7:42878472-42878494 CAGCTTCTACAGCTGGCACCAGG - Intergenic
1023983649 7:45083152-45083174 CAGCTTCTGCAGCTGGCTGTGGG + Exonic
1025000844 7:55313341-55313363 GAGCATCTGCAGCTGGATCTAGG + Intergenic
1031282185 7:119818626-119818648 CAGCTGTAGCAGCTGGAAACAGG - Intergenic
1031645820 7:124223559-124223581 CACCTTTTGCTGATGGAGCTTGG - Intergenic
1032703346 7:134401063-134401085 CAGCTTTGCCATCTGGAAATAGG + Intergenic
1033035063 7:137867540-137867562 CAGCTTATGCAGCCAAAACTGGG - Intergenic
1033409646 7:141105643-141105665 CATCTTTAGCAGCTCGAACTTGG - Intronic
1034189069 7:149199733-149199755 CAGCTAATGCAGCTGGAATTTGG - Intronic
1034206983 7:149325755-149325777 CAGCATTTTCAACTGAAACTAGG - Intergenic
1036122058 8:6029405-6029427 CAGCCTTTGCAGCAGAGACTTGG + Intergenic
1036915361 8:12799214-12799236 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1037424836 8:18744270-18744292 CAGCTTCCTCATCTGGAACTTGG - Intronic
1037630433 8:20650816-20650838 TGGCTTTTGCACCTGGAGCTGGG + Intergenic
1038108344 8:24464025-24464047 CAGCTTGTACAGCTAGAACAGGG - Intronic
1039678842 8:39706005-39706027 CATCTTTAGCAGTTGGAAATGGG + Intronic
1039783926 8:40815728-40815750 GAGGTTTTCCAGTTGGAACTTGG - Intronic
1039805543 8:40994540-40994562 CAGCTTTTTCACTTGGGACTCGG - Intergenic
1040709431 8:50170715-50170737 CTGTGTTTGCATCTGGAACTTGG + Intronic
1040817960 8:51528744-51528766 CTGGTTTTGAAGCTGGAAATGGG + Intronic
1044771558 8:95641015-95641037 CACCCTCTGCAGCTGGAAGTGGG - Intergenic
1047355596 8:124118867-124118889 CAGCTTCTTCTGCTGTAACTAGG - Exonic
1049098714 8:140564067-140564089 CATCTTTTGCAGATGGTCCTCGG - Intronic
1049560040 8:143305587-143305609 CAGGCCCTGCAGCTGGAACTGGG - Intronic
1052374174 9:27698976-27698998 CAGCTATTGCTGCTGGTAATCGG + Intergenic
1053128308 9:35600326-35600348 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1056906299 9:90651455-90651477 CAGAGTTTGCAGCAGAAACTTGG + Intergenic
1057736307 9:97664752-97664774 CAGCTAGTCCAGATGGAACTCGG + Intronic
1062682546 9:137789532-137789554 CAGGTTTGGCAGCCGGACCTTGG + Intronic
1188023988 X:25189140-25189162 CAACCTTTGTAGCTTGAACTTGG + Intergenic
1188859760 X:35243379-35243401 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1192633920 X:72800923-72800945 CAGGTTTTGCAGCTGCTCCTTGG + Intronic
1192647790 X:72919878-72919900 CAGGTTTTGCAGCTGCTCCTTGG - Intronic
1192866710 X:75141576-75141598 CAGCTTTTGTATCTGACACTGGG - Intronic
1194932204 X:99901625-99901647 TTGCTTTTGCAGCTGGAAGTTGG - Intergenic
1196020322 X:110984477-110984499 CAGCTGAGGCAGCTGGAAGTGGG - Intronic
1197609451 X:128622579-128622601 CAGCTTCTACAGCTGGCACCAGG + Intergenic
1198434107 X:136598565-136598587 CAGATTTTGTTGTTGGAACTAGG - Intergenic
1198494762 X:137180907-137180929 CAGCTTTAACTGCTGGAACATGG - Intergenic
1200292627 X:154886880-154886902 CAGCTGGGGCAGCTGGAGCTGGG - Exonic
1200339471 X:155382620-155382642 CAGCTGGGGCAGCTGGAGCTGGG - Exonic
1200346999 X:155458073-155458095 CAGCTGGGGCAGCTGGAGCTGGG + Exonic
1202135737 Y:21659095-21659117 CAGCTTCTACAGCTGATACTGGG - Intergenic