ID: 1013648264

View in Genome Browser
Species Human (GRCh38)
Location 6:112167419-112167441
Sequence TTTAGAAAACAAACTTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 0, 2: 1, 3: 66, 4: 552}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013648264_1013648266 1 Left 1013648264 6:112167419-112167441 CCCACTTAAGTTTGTTTTCTAAA 0: 1
1: 0
2: 1
3: 66
4: 552
Right 1013648266 6:112167443-112167465 CACAGAGTCAAATTCCAGTAAGG 0: 1
1: 0
2: 1
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013648264 Original CRISPR TTTAGAAAACAAACTTAAGT GGG (reversed) Intronic
900281190 1:1870326-1870348 TTTAAAAAACAAAATTAGCTGGG - Intronic
901970641 1:12905119-12905141 TTTAGAATATATACTTAAGATGG + Intronic
902014524 1:13296651-13296673 TTTAGAATATATACTTAAGATGG - Intergenic
902706733 1:18210593-18210615 GTAAGAAAACAAACTTCAGGGGG - Intronic
903573114 1:24321104-24321126 TTTAGCCAGCAAATTTAAGTGGG - Intronic
903731021 1:25495351-25495373 TAAAGAAATCAAACTTAAATCGG + Intronic
904887077 1:33747135-33747157 TTTAAACAACAAACTCAAGTAGG + Intronic
905543510 1:38779193-38779215 TTTAAAAAAGAAACTTCAGCCGG - Intergenic
905676467 1:39829128-39829150 TAAAGAAAACAAACTTCAGATGG - Intergenic
907403348 1:54239111-54239133 ATTAGAAAGCAGACTTACGTTGG + Exonic
907591352 1:55675267-55675289 TTTAAAAAAAAATCTTAAATGGG - Intergenic
907940619 1:59083913-59083935 TTTAGAAAAGAAAAATAAATTGG - Intergenic
908146071 1:61245532-61245554 GTTAGAAAACATAATTACGTAGG + Intronic
908189380 1:61686009-61686031 TTTAAATAACCAAATTAAGTCGG + Intronic
908211413 1:61904151-61904173 TTCAAAAAACAAAATTTAGTTGG - Intronic
908557419 1:65270175-65270197 ATTAGAAAACATAATTAAGTAGG - Intronic
908587036 1:65581026-65581048 TTGTGAAAACAAAGTAAAGTAGG - Intronic
909246764 1:73296247-73296269 TGAAAAAAACAAACTTAAGATGG + Intergenic
910254656 1:85235777-85235799 TTTAAAAAATAAATTTAATTGGG - Intergenic
911029929 1:93475956-93475978 TTAAAAAAACAAAATTGAGTCGG - Intronic
911766399 1:101680733-101680755 TTTAAAAAGAAAAATTAAGTTGG - Intergenic
911946178 1:104112368-104112390 TTTAGAAACCAAAATTCAGGTGG + Intergenic
912022330 1:105120808-105120830 TTAAGAAAACAAACCTAGGCCGG + Intergenic
912196497 1:107403195-107403217 TCTTTAAAACAAACGTAAGTGGG + Intronic
915569946 1:156739328-156739350 TTTAGAGAACATACTTAGTTGGG - Intronic
915775180 1:158476245-158476267 TTTTTAAAAAAAATTTAAGTAGG + Intergenic
915848225 1:159291815-159291837 TGTAAAAAGCAAACTGAAGTGGG - Intronic
916762708 1:167831740-167831762 TTTAAAATTCAAACTTAATTGGG - Intronic
916778378 1:167994518-167994540 TTTACAAAATAAATATAAGTGGG + Intronic
917606003 1:176630112-176630134 TCTAGGACACAAAGTTAAGTGGG + Intronic
918205482 1:182304608-182304630 TTAAGAAATCAAACTAGAGTAGG - Intergenic
918743920 1:188173889-188173911 TTTAGAATAGGAACTTAGGTGGG - Intergenic
921896366 1:220406067-220406089 TATATAAAACAAACATAAGATGG + Intergenic
922494448 1:226045083-226045105 TTTATAATACAAACCTAAGTTGG + Intergenic
922561575 1:226573368-226573390 GTTAGAAAACCAACTCAAGCTGG + Intronic
922950791 1:229557524-229557546 TTTAGAAACAAAATTTAAATAGG - Intronic
923904036 1:238362716-238362738 TTTATAGAACAATCTTTAGTTGG + Intergenic
924001082 1:239553255-239553277 TTTTGAAAATAAAATTAATTTGG + Intronic
924210853 1:241765732-241765754 TTTGGAATACAAAGTCAAGTAGG - Intronic
924287242 1:242500323-242500345 TTTAGAAAACACAGTTTATTTGG + Intronic
924479655 1:244416925-244416947 ATTAGATAACAAACTAAATTTGG + Intronic
1063051151 10:2449470-2449492 TTTTTGAAACAAATTTAAGTTGG + Intergenic
1063427823 10:5963568-5963590 TTTGAAAAAGAAAATTAAGTTGG + Intronic
1064019597 10:11798526-11798548 TTTAGAAAACAAAAATGAGCTGG + Intergenic
1064594708 10:16931883-16931905 CTTTGAAAAAAATCTTAAGTAGG - Intronic
1064852143 10:19720512-19720534 TCTAGAAATCAAATTTAAGCAGG - Intronic
1065027327 10:21551223-21551245 CTTAGAAATCAAAGATAAGTTGG - Intronic
1065853070 10:29806672-29806694 TTTAGTAAACCAATTTAAGTGGG + Intergenic
1066553105 10:36581178-36581200 TTCAGAAACCAAAATTGAGTTGG - Intergenic
1066694328 10:38064460-38064482 TTTTGAAACCAAATCTAAGTGGG + Intronic
1066998190 10:42582716-42582738 TTTTGAAACCAAATCTAAGTGGG - Intronic
1067129753 10:43552358-43552380 CTTAGAAGAAAAAATTAAGTTGG - Intergenic
1068280233 10:54858712-54858734 TTTATAAAACAAACCTAGGTAGG - Intronic
1068311392 10:55281114-55281136 TACAGAAAACAAACATAAGGGGG - Intronic
1068342486 10:55724911-55724933 GTTAGAAAAAAACCTAAAGTAGG - Intergenic
1068516983 10:58036980-58037002 TTTAGCAAACAAACCTATATTGG - Intergenic
1068753594 10:60624776-60624798 TATAGAAAACAAACAAAAATGGG + Intronic
1068799643 10:61125427-61125449 TTTTTAAAAAAAATTTAAGTAGG - Intergenic
1069278570 10:66624760-66624782 ATAAGAAAACAAAATTAAGCAGG + Intronic
1069864826 10:71495534-71495556 TTTAGAAAAGAATCTTAAGCCGG + Intronic
1071355485 10:84789487-84789509 TTTATTAAACAGACTTAATTAGG + Intergenic
1071892608 10:90028104-90028126 TTTGGAAAATAAACCTGAGTGGG + Intergenic
1072146947 10:92649739-92649761 TTTAGAAGACAAGATTAATTAGG + Intronic
1072439662 10:95442744-95442766 TTTTGGAAAAAAACTCAAGTTGG - Intronic
1073077290 10:100832112-100832134 TGGAGAAAACAAACTGAAGCAGG - Intergenic
1073539141 10:104304073-104304095 TTCAGAAAACAAACTAAGCTAGG - Intronic
1073783430 10:106864096-106864118 TATAGAAAAAAATCTAAAGTTGG + Intronic
1074868916 10:117561984-117562006 TTTAGAAATCAAACAGAACTTGG - Intergenic
1075154146 10:119960041-119960063 TTTAAAAAACAATTTCAAGTTGG + Intergenic
1075606081 10:123810683-123810705 TTTAAAAGACATACATAAGTGGG + Intronic
1075928830 10:126275975-126275997 TTTAGAAAACAAACACTAGCAGG + Intronic
1076101366 10:127781826-127781848 TTTAGAAAACAAAATTGATTTGG - Intergenic
1076492196 10:130869477-130869499 TTTAGAAAAGTAATTTAAGAGGG - Intergenic
1076605606 10:131687318-131687340 ATTGGAAAACAAAATGAAGTAGG + Intergenic
1078323382 11:10357440-10357462 TAGAGAAAACCATCTTAAGTGGG + Intronic
1078865315 11:15291832-15291854 TTTTGTAAACAAAATTAAATAGG + Intergenic
1079015254 11:16863311-16863333 TTTGGAAAAGAAACACAAGTTGG - Intronic
1079665979 11:23105718-23105740 TGTAGAAAACACATTTTAGTGGG + Intergenic
1080422651 11:32125447-32125469 TTTAGCAAACATTCTTAAATAGG + Intergenic
1080530006 11:33165337-33165359 ATTAGAAAAAAATCATAAGTAGG + Intergenic
1080977018 11:37355487-37355509 TTTAGTAAACACACTGAACTTGG - Intergenic
1081014977 11:37865915-37865937 TTCAGCAAGCAAAATTAAGTAGG - Intergenic
1082965072 11:58958901-58958923 GTTAGAAAACAAAATTAGATGGG - Intronic
1083288869 11:61679070-61679092 TTTAGAAAGCAAACTCACGTAGG - Intergenic
1083831664 11:65237444-65237466 TTTCTAAAACAAACTCAAGAGGG + Intergenic
1086001992 11:81995438-81995460 TTCAGAAAATAAACTAAGGTTGG - Intergenic
1087134499 11:94702491-94702513 TTGAAAAAAGAAATTTAAGTTGG + Intergenic
1087219425 11:95530315-95530337 TCTAGGAAACAGACTCAAGTGGG + Intergenic
1088100350 11:106147541-106147563 TTTCAAAAACAAACCTAAGCTGG - Intergenic
1088724696 11:112623666-112623688 GTAAGAAAATAAGCTTAAGTTGG - Intergenic
1090146414 11:124327921-124327943 TTTAGAAAACAAACCTGAGAGGG - Intergenic
1090795957 11:130135785-130135807 TTTCGAAAACCAAATTGAGTTGG + Intronic
1092664743 12:10783490-10783512 TTTAGGAAACGTACTTCAGTAGG - Intergenic
1093745913 12:22740977-22740999 GTTAGAAAAAAAAGTTAATTGGG - Intergenic
1094135908 12:27125873-27125895 TTGAGAAAACACACTTAATTTGG - Intergenic
1094185452 12:27637603-27637625 TTGAGAAAACACACTTAATTTGG - Intronic
1094189679 12:27684497-27684519 TTTAAACAGCCAACTTAAGTAGG + Intronic
1094448019 12:30553645-30553667 GTTAGTAAAAAAACTTAAGAAGG - Intergenic
1094549693 12:31438994-31439016 TTTTGAAAATAAAATTAAGTAGG - Intronic
1094762385 12:33549281-33549303 TTGAGAAAAGAAAATTAATTGGG - Intergenic
1095410933 12:41921762-41921784 TTTAAAAAACAAACTTTACATGG - Intergenic
1095862017 12:46927800-46927822 TTTAAGAAACAGACTTAAATTGG + Intergenic
1096534161 12:52260202-52260224 TAGAGAAAACAAACCTAAGAGGG + Intronic
1097146838 12:56947254-56947276 TCTAGAAAACAGACTTAAAAGGG - Intergenic
1098043937 12:66380683-66380705 TTTAGACAACAACTTTTAGTAGG + Intronic
1098927651 12:76369126-76369148 TTTTGAAACCAAATTTTAGTTGG + Intronic
1098934337 12:76461076-76461098 TTTTACAAACAAACTAAAGTTGG + Intronic
1099321073 12:81149650-81149672 TTTAAAAAATAAAAGTAAGTGGG + Intronic
1100048525 12:90414011-90414033 TTTTTAAAACAATCTTAATTAGG - Intergenic
1101154311 12:101913300-101913322 TTTAAAAAACAGACTTCTGTTGG - Intronic
1101211298 12:102537795-102537817 TTTAAAAAAAAAATTTAAGATGG - Intergenic
1101380356 12:104208859-104208881 ATTAAAAAAAAAACTTAGGTGGG - Intergenic
1101452686 12:104794503-104794525 ATTTGAAAACAGACTTAAGCTGG - Intergenic
1101478462 12:105073978-105074000 TTTCAAAAACAAGCTGAAGTTGG - Exonic
1103344006 12:120237407-120237429 TGGAGAAAATAAACTGAAGTGGG + Intronic
1103709698 12:122902874-122902896 TTTAAAAAAAAAAAGTAAGTGGG - Intergenic
1105368384 13:19781925-19781947 TTTGGAAAGGAAGCTTAAGTCGG - Intronic
1105893654 13:24700001-24700023 TTGAGAAATCAAACGCAAGTGGG - Intronic
1106569004 13:30909866-30909888 ATTAGAAAATGAACCTAAGTAGG - Intronic
1106621043 13:31371352-31371374 TTTAGAAAGAAAACTTAAGGTGG + Intergenic
1107180847 13:37457252-37457274 TTTATAAAACAAAATTCTGTGGG - Intergenic
1107356053 13:39568298-39568320 TATAGAATATAAACTTAAGCAGG + Intronic
1107406701 13:40121430-40121452 TTTAGCAAACAAACTGTGGTAGG + Intergenic
1107623213 13:42255307-42255329 TTTAAAAAACCAACTTAAATGGG + Intronic
1108566939 13:51709189-51709211 TAAATAAAACAAACTTTAGTTGG - Intronic
1108930943 13:55817796-55817818 TTTATAAAAAAAACTTAACTGGG - Intergenic
1109547947 13:63852574-63852596 TTTAGAAAAAAAATTTAAAAAGG - Intergenic
1109684327 13:65794425-65794447 TTTGGAAAACAAATATTAGTAGG + Intergenic
1109889013 13:68582775-68582797 TAGAGAAAACAAACCTAAGATGG + Intergenic
1110170514 13:72495169-72495191 TTTAAAAAAAAAACTTAAAAAGG + Intergenic
1110511803 13:76359614-76359636 ATTAGAAAAGAAAATTAAGATGG - Intergenic
1110846849 13:80199404-80199426 TTCAAAAAACAAAATTCAGTAGG + Intergenic
1111062249 13:83037381-83037403 TTGAAAAAAAAAACTGAAGTAGG - Intergenic
1111109645 13:83689958-83689980 TTTAAAATACATACTTAAGTTGG + Intergenic
1111140746 13:84114837-84114859 TTAAGAAAAAAAAATTAAGCAGG - Intergenic
1111489308 13:88950008-88950030 TTTAGAAAACACAGCTAATTTGG - Intergenic
1111543400 13:89698316-89698338 TTTAGAAGAGAAAGTTAAATTGG - Intergenic
1112072127 13:95865342-95865364 ATTAGAAAACAAACTGAAGGCGG + Intronic
1112114686 13:96339221-96339243 TTAAGAAAACAGTATTAAGTTGG + Intronic
1112723206 13:102270475-102270497 CTAAGAAAACAAACCTAAGTAGG - Intronic
1112811989 13:103229216-103229238 TTTAGAAAAAAAAAATAAGAAGG - Intergenic
1112935305 13:104790168-104790190 TTTAGAAACAAAACTTATGAGGG + Intergenic
1113281089 13:108788672-108788694 TTTAGAAACTGAACTTCAGTGGG - Intronic
1113449902 13:110401408-110401430 TTGAGAAAACCTAATTAAGTGGG + Intronic
1113599521 13:111558573-111558595 TTTAGAAACCAAACTCAACCAGG - Intergenic
1113971695 13:114196167-114196189 TTTAAAAGACAGAATTAAGTGGG - Intergenic
1114198059 14:20496344-20496366 TTTACGAAGCAAACTTAAGAAGG - Intergenic
1115022097 14:28694209-28694231 TTAAGAAAACAAACCTAGCTGGG - Intergenic
1115183107 14:30653090-30653112 TTTAAAAAACAAATTTAACGTGG - Intronic
1116384762 14:44316616-44316638 TTAAGAAAACAAAAATTAGTGGG - Intergenic
1116591245 14:46777097-46777119 TATAGAAAATAAATTTTAGTAGG - Intergenic
1117671600 14:58112677-58112699 TTTAGAAAAGGAACTTATGAAGG - Intronic
1118233572 14:63977597-63977619 TTTAAAAAACAAAATTAGCTGGG + Intronic
1118356198 14:65015880-65015902 TTTAGAAAACTAATGTAAGCTGG + Intronic
1118549794 14:66937702-66937724 TTTGTAAAACAAACTTAAGGAGG - Intronic
1118952884 14:70450432-70450454 AATAGAAAACAAACATAAGAAGG - Intergenic
1120431952 14:84430165-84430187 TTTAAATAAGAAACTTGAGTTGG - Intergenic
1120496705 14:85247080-85247102 TTCAAAAAACCAACTTTAGTGGG - Intergenic
1120613858 14:86676938-86676960 ATTAGGCAACAAACTGAAGTTGG + Intergenic
1121368377 14:93335018-93335040 TTTAAAAAACAAAATTAAAATGG + Intronic
1122101654 14:99416009-99416031 TTTAGAAACCAAATCTTAGTTGG - Intronic
1202885053 14_KI270722v1_random:97808-97830 TTAAAAAAAAAAACTTAAGAGGG - Intergenic
1123454598 15:20409080-20409102 TTCAGAAAACCATCTTAACTGGG - Intergenic
1123462361 15:20484913-20484935 TTTTGAAAAACAACTTAAATTGG + Intergenic
1123655699 15:22515492-22515514 TTTTGAAAAACAACTTAAATTGG - Intergenic
1123684728 15:22788646-22788668 TTTAGAAAACTAACTAAAGCTGG - Intronic
1124066603 15:26349913-26349935 TTAAGAAAACCAACTCAAGATGG + Intergenic
1124273050 15:28300895-28300917 TTTTGAAAAACAACTTAAATTGG + Intronic
1124309608 15:28610685-28610707 TTTTGAAAAACAACTTAAATTGG - Intergenic
1124429549 15:29594658-29594680 TTTAAAAAATAAACTTTTGTGGG + Intergenic
1124470600 15:29981904-29981926 GTTAGAAAATAAACTAAAATAGG + Intergenic
1125052718 15:35320198-35320220 TTGGGAAAACAAAATTAAGTTGG - Intronic
1125098113 15:35878123-35878145 TTTAAAAAACAAAGTTAAGATGG + Intergenic
1125182312 15:36891434-36891456 TGGACAAAACAATCTTAAGTTGG - Exonic
1126681093 15:51202850-51202872 TTTAGGAAACAAATATAAGGAGG + Intergenic
1126917392 15:53481425-53481447 TTTGTAAAACAAATTTATGTTGG - Intergenic
1127739610 15:61889544-61889566 TTTAAAAATCACACTTAATTTGG - Intronic
1128375606 15:67072845-67072867 ATTAGAAACCAAACTTCTGTAGG - Intronic
1128435245 15:67641149-67641171 CTTAGAAAACAAACAATAGTGGG - Intronic
1128508150 15:68293795-68293817 TTTTTAAAAAAAAATTAAGTTGG - Exonic
1128590921 15:68896231-68896253 TTTAGGAAACAAACTCAAAGAGG + Intronic
1129022121 15:72529749-72529771 CTCAGAAAACAAAACTAAGTGGG + Intronic
1129102412 15:73278403-73278425 TTTAGGAATTAATCTTAAGTTGG - Intronic
1130292514 15:82615636-82615658 TAAAGAAAACAAAATCAAGTTGG + Intronic
1130357423 15:83146246-83146268 TTTTGAAAGCAAAATTATGTAGG + Intronic
1130614238 15:85389272-85389294 TTTAGAAAACAAACATAGCTTGG - Intronic
1133251489 16:4484755-4484777 TTTATATAAGAAACTTAAGCTGG - Intronic
1133841516 16:9414137-9414159 TTTGGAATGCAAACTTAACTGGG - Intergenic
1135204638 16:20472904-20472926 TCTAGAAAACCATCTTAAATTGG - Intronic
1135652821 16:24221763-24221785 TTTAGAAAACAAAAATACCTGGG + Intergenic
1136122419 16:28147402-28147424 TTTAGAAAAAAAATTAAAATAGG + Intronic
1136181616 16:28556645-28556667 TTTCTAAAAAAAACATAAGTAGG - Intronic
1137244974 16:46694855-46694877 CTTAGAAAACAAAATGTAGTTGG + Intronic
1137645682 16:50071281-50071303 CTTAGAATACAAGATTAAGTTGG + Intronic
1138027752 16:53535942-53535964 TTTTTAAAACAAATTTAAATGGG + Intergenic
1138903217 16:61299527-61299549 TTGAGGAAACAATCTTAATTTGG - Intergenic
1139013751 16:62664780-62664802 TTGAGTAAACAAAATTAGGTTGG - Intergenic
1139048327 16:63090870-63090892 TTTTGAAAACAAACTTTTATTGG + Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1140534486 16:75696930-75696952 TTTTTAAACCAAACCTAAGTAGG + Intronic
1140932332 16:79639476-79639498 TTAAGAAAACAAACTTCAAATGG - Intergenic
1141023845 16:80524702-80524724 TTTAGAAAAAATACGTAAGTGGG - Intergenic
1141251994 16:82367746-82367768 TTTAGAAAATAAACATGAGTTGG + Intergenic
1141401624 16:83752413-83752435 TTTAGAAAGCCAACTAAATTTGG - Intronic
1143740143 17:8946542-8946564 TTGAGTAAACACACTTAGGTTGG - Intronic
1143908936 17:10231582-10231604 TTTTGAAAAAAAAATTGAGTTGG + Intergenic
1144226755 17:13156698-13156720 TTTGGAAAGCAAAGTAAAGTGGG + Intergenic
1145070063 17:19797382-19797404 TTTAATAAACAAACCTTAGTAGG + Exonic
1145232982 17:21188390-21188412 CTTAGGAAACAAACTGAAATAGG - Intronic
1146347561 17:32069902-32069924 TTTAAAAAAAAAAAATAAGTTGG - Intergenic
1147411732 17:40257989-40258011 TTATGAAAACAAACAGAAGTGGG - Intronic
1148077278 17:44945593-44945615 TTTTAAAAATACACTTAAGTAGG - Intronic
1149161985 17:53705045-53705067 TTTGGAAAACAAACTGAAATTGG - Intergenic
1150238526 17:63612926-63612948 TTTAGAATATAACATTAAGTGGG + Intergenic
1150678165 17:67262806-67262828 TTTAGATAACAAAATCAGGTGGG - Intergenic
1153187436 18:2500910-2500932 TTTAAAAAACAAAATTAAAGGGG - Intergenic
1153590117 18:6665026-6665048 ATTAGAAAACAAACTTATCCAGG + Intergenic
1153612841 18:6904416-6904438 TTTAAAAAATAAAATTATGTGGG + Intronic
1154153440 18:11925724-11925746 TTTGGAAAATAAACTTGAGAGGG + Intergenic
1155754749 18:29477936-29477958 TTTGCAAAGCAAACTTAAGGAGG + Intergenic
1155799722 18:30085998-30086020 TTTAGAAAACAACCATACTTAGG - Intergenic
1155830032 18:30503833-30503855 TTTTGAAGACAAACTTGAGGTGG - Intergenic
1155942613 18:31815045-31815067 TTTAGAAAACAGACTGTAGTTGG + Intergenic
1155949754 18:31898686-31898708 TTTACAAAAAAAACTAAAATTGG - Intronic
1157000667 18:43519604-43519626 TTGAAAAAACAAACCTATGTTGG - Intergenic
1157034986 18:43960814-43960836 TTTAGAAAACACGCTTATATAGG - Intergenic
1157438903 18:47695235-47695257 TTTAGATACCTAACATAAGTAGG + Intergenic
1158384252 18:56971395-56971417 TTTATAAAACAAACTTATGATGG + Intronic
1158983396 18:62788153-62788175 TAAAGAAAACAAACTTAAAAGGG - Intronic
1158986414 18:62822183-62822205 TTTAGAAAAAAAAGATAACTTGG + Intronic
1159530536 18:69650276-69650298 TTTATAAAGTAATCTTAAGTGGG + Intronic
1159723015 18:71916915-71916937 TTTAGAAACCAAACTGAAACAGG - Intergenic
1159764922 18:72477770-72477792 ATTAGAAATCAAACCTAATTAGG + Intergenic
1160076012 18:75678436-75678458 TTAAAAAAACAAATTTTAGTAGG + Intergenic
1160177522 18:76607964-76607986 TTTTTAAAAAAAATTTAAGTTGG + Intergenic
1160289365 18:77576803-77576825 TTTAGAAAACATACTTTAAATGG + Intergenic
1163767351 19:19170923-19170945 TTTAGAAAACAGCCTTTAGCGGG - Intronic
1165623602 19:37268095-37268117 TTTAAAAATCAACCTTAAGAAGG - Intergenic
1166196915 19:41212722-41212744 TTTAAAAAATAAACTTTAATGGG - Intergenic
1167422494 19:49412470-49412492 TTTAGAAAACAATGGCAAGTTGG + Intronic
1168082037 19:54017174-54017196 TTTAAAAAAAAAATTTAAATTGG - Intergenic
1168444604 19:56401124-56401146 TTAAAAAAAAAAAATTAAGTGGG + Intronic
1168619447 19:57866254-57866276 TTTAAAAAATAATCTTGAGTTGG - Intronic
1202660461 1_KI270708v1_random:64833-64855 CTTAAAAAAAAAACTTAAGAGGG - Intergenic
926982698 2:18588040-18588062 TTTAGAAATCAAACTAATATTGG - Intronic
927027639 2:19086063-19086085 GTTAGCAAACAAACTCAACTTGG + Intergenic
927602247 2:24454246-24454268 TTTAGAAAAGAAACTTAGGGAGG - Intergenic
928058594 2:28085157-28085179 TTTAAATAACAAATTTCAGTTGG + Intronic
928687372 2:33762773-33762795 TTTAGATAGCAAAATTAAGGAGG + Intergenic
929071149 2:38031873-38031895 TTTGGGCAAGAAACTTAAGTTGG - Intronic
930811119 2:55542115-55542137 TATATAAAACAAAGTTAATTTGG - Intronic
930842496 2:55863088-55863110 TTTAAAAAACATAGTTAAATTGG + Intergenic
930861291 2:56076332-56076354 GTTAAAAGACAAGCTTAAGTTGG - Intergenic
930863649 2:56101993-56102015 TTTAGAAACTAAACAAAAGTTGG - Intergenic
932517020 2:72361576-72361598 TGGAGAAAACAAAATTAAGTAGG + Intronic
933769602 2:85734663-85734685 CTTAGATAACAATCATAAGTAGG + Intergenic
934051848 2:88217938-88217960 TTTAAAAATCAAAGTTAATTGGG - Intergenic
934803413 2:97192012-97192034 TTTAGAAATAAAAATTATGTTGG + Intronic
934894794 2:98106319-98106341 TTTTGAAAAAAAAATAAAGTAGG - Intronic
935252502 2:101275861-101275883 TTTAGCAGACAACCTCAAGTAGG - Intronic
935381805 2:102459992-102460014 TTTGGAAAAGAAAATAAAGTTGG + Intergenic
935388743 2:102528429-102528451 TTTAGAAAAAAATCTTAAAAAGG + Intronic
936182138 2:110276115-110276137 TTTAGAAAACAAACCTAGGAGGG + Intergenic
936230430 2:110695558-110695580 TTTAGAAAACAAACCTAGGAGGG - Intergenic
937632183 2:124115477-124115499 TTTTGAAAACAAAATCGAGTGGG + Intronic
939059490 2:137402908-137402930 TTTGGAAAAAAAAATTAACTTGG + Intronic
939077218 2:137618169-137618191 TCTGGAAAGCAAATTTAAGTAGG + Intronic
939197916 2:138995903-138995925 TTAAGAAATCAAACCTCAGTGGG - Intergenic
939598043 2:144152270-144152292 TTAAGAAAACAGCCTTATGTTGG - Intronic
939604235 2:144233868-144233890 TTTAAAAAACAGACTTAAAAAGG + Intronic
939898129 2:147817518-147817540 TTTAAAAAATAAACATAAGCAGG + Intergenic
939922862 2:148138578-148138600 TATAGAACACAAAATGAAGTGGG + Intronic
940601731 2:155871592-155871614 TTTAGAAAAAGCACTTATGTTGG - Intergenic
940689227 2:156894404-156894426 TTTAAAAATGAAACTGAAGTTGG + Intergenic
940829888 2:158456330-158456352 TGCAGAGAACAAACATAAGTAGG + Intronic
941462087 2:165783683-165783705 TTTTGAAAACAAAGTTTAATTGG - Intronic
942458658 2:176154573-176154595 TTTAAAAAATATATTTAAGTGGG + Intronic
943520147 2:188939109-188939131 TTTAAAAAACAAACTTCACAAGG - Intergenic
943655829 2:190507786-190507808 TTTAGAAAAACTACTTAATTTGG + Exonic
943878857 2:193112601-193112623 TTTAAAACACAACCTGAAGTTGG + Intergenic
943953005 2:194155024-194155046 TTGGGAAATAAAACTTAAGTGGG - Intergenic
944305101 2:198170036-198170058 TCTAGAAAACATACTTCAATGGG - Intronic
944518363 2:200536530-200536552 TTTAGAAAACAGTATAAAGTAGG - Intronic
944617834 2:201481145-201481167 TTAAGAAAATCAACTGAAGTAGG - Intergenic
944648863 2:201808383-201808405 TTTATAGAAGAAACTGAAGTTGG + Intronic
945371229 2:209020481-209020503 TCTTGAAAACAATTTTAAGTTGG - Intergenic
945636223 2:212354813-212354835 TTTCCAAACCCAACTTAAGTTGG - Intronic
945638089 2:212384733-212384755 TTTAGAAAACTAACTTTAGGTGG - Intronic
946479047 2:220036147-220036169 TTTAGAACACAGATTTAACTTGG - Intergenic
947188810 2:227479665-227479687 ATTAGAAAACACATTCAAGTGGG - Intronic
947783237 2:232789842-232789864 TTTAGAAAAATATCTTAAGTAGG + Intronic
948198613 2:236113433-236113455 TTTAAAAAACAAACTCCAGCCGG - Intronic
1170468914 20:16648824-16648846 TTCAGAATACAAACTTTAGAGGG + Intergenic
1170477663 20:16731914-16731936 TTTAAAAAACAAAAATAGGTAGG + Intronic
1171248331 20:23631095-23631117 TTTAGAAAACAAAATTTTGGGGG + Intronic
1173037916 20:39430325-39430347 TTTAGGAAAAAAAATTAACTTGG + Intergenic
1173380275 20:42533550-42533572 TTAAGAGAAAAAACTCAAGTTGG + Intronic
1173694161 20:44993339-44993361 TTTATAATACAAATCTAAGTGGG + Intronic
1175547170 20:59785873-59785895 GTTGGAAAACAAAATGAAGTAGG - Intronic
1176988689 21:15467768-15467790 TTTAGATTATGAACTTAAGTTGG + Intergenic
1177070754 21:16503886-16503908 TTTCAAAAACAACCTCAAGTGGG - Intergenic
1177103533 21:16925318-16925340 TATAGAAAAAAAAATTAAGTAGG + Intergenic
1177325940 21:19588915-19588937 TTTTTAAAACAAATTAAAGTTGG + Intergenic
1177396486 21:20542075-20542097 ATTAGAAAAAAAAGTTGAGTTGG - Intergenic
1177613100 21:23479597-23479619 TTTAGAAAGCAAAATAAAATAGG + Intergenic
1177626853 21:23673393-23673415 TTTGGAAGACTAACTTAAGAGGG - Intergenic
1177756493 21:25354887-25354909 TTTAAAAAAAAATCTTAAATAGG + Intergenic
1178128007 21:29536723-29536745 TTTAGAACACAAAGATAAATTGG + Intronic
1178229765 21:30768444-30768466 CTTAGAAAACAAACTATAATTGG - Intergenic
1178331762 21:31701972-31701994 TTTAGCAAAGAAGCTTAATTAGG - Intronic
1179339979 21:40497766-40497788 TTTAAAAAATAAAGTTAATTGGG + Intronic
1179401995 21:41092902-41092924 TTTTTAAAACAAACTTAAAGAGG + Intergenic
1180013155 21:45064670-45064692 TCTAGAAAACAAAAATAGGTGGG + Intergenic
1180327943 22:11448425-11448447 TTAAAAAAAAAAACTTAAGAGGG - Intergenic
1180912354 22:19460087-19460109 TTTAAAAAAAAAACCTAAGCAGG + Intronic
1181592193 22:23892368-23892390 TTTGGAAAACAAACTTGAGAGGG + Intronic
1181595585 22:23912448-23912470 TTTAGAAAATAAACTTGAGAGGG - Intergenic
1182224820 22:28789074-28789096 TTTAGGAAAATAACTAAAGTAGG + Exonic
1183389674 22:37538352-37538374 TTTAAAAAATATACTTAACTGGG - Intergenic
1183764712 22:39861880-39861902 TTTAGAAAACAATATAGAGTGGG + Exonic
1183809475 22:40242589-40242611 TTTAAAATACAAAATTAGGTGGG - Intronic
1183838601 22:40478460-40478482 TTTTGAAAATAAACTTTATTTGG - Intronic
1184952926 22:47858009-47858031 TAGAGAAAACAAACTCATGTGGG - Intergenic
1184969791 22:48008785-48008807 TTTAGAAAAAAATAATAAGTTGG - Intergenic
949625013 3:5855375-5855397 TTTAGATAAAAAACATAAATTGG - Intergenic
949759785 3:7457542-7457564 TCTAGAAAACAAATTGGAGTAGG + Intronic
949810002 3:7996865-7996887 TTTAGAGAAAACCCTTAAGTAGG - Intergenic
949913935 3:8941881-8941903 TTCAGAAAACAAGGTTAATTGGG - Intronic
950157557 3:10734635-10734657 TTTAAAAAACCAGCTTAATTGGG - Intergenic
950597290 3:13995859-13995881 GTTAGAAAACAATCTTCAGGAGG - Intronic
950803419 3:15574662-15574684 TAGAGAAAAGAGACTTAAGTAGG - Intronic
951687024 3:25355924-25355946 ATTAGAAAAAAAAGTTAAGCAGG + Intronic
953454527 3:43031116-43031138 TTTAGTAAGTAAACTTAATTTGG + Intronic
953567020 3:44041464-44041486 TTTATAAAAGAAACTTTTGTAGG + Intergenic
954719215 3:52545962-52545984 TTTTTAAAAAAAACTTAATTAGG + Intronic
955702857 3:61699253-61699275 TTTTCAAAACAAATTTTAGTTGG + Intronic
955952894 3:64260053-64260075 TTTGGAAAACAATGTTAAGTGGG + Intronic
956530082 3:70208701-70208723 TTCAGAAACCAATCTTAAGATGG + Intergenic
956832856 3:73070379-73070401 TTTAGTAAACAAAATTAAGTGGG - Intergenic
957093844 3:75759229-75759251 CTTAAAAAAAAAACTTAAGAGGG + Intronic
957790950 3:84940844-84940866 TTTAGAAAAAAAAATTAGGCCGG + Intergenic
958043681 3:88256916-88256938 TTTAGAAAAAAAAGTTTAGATGG + Intergenic
958784994 3:98588222-98588244 ATAAGAAAACAAACAAAAGTTGG - Intronic
959541755 3:107548046-107548068 TTTAAAACACCAACTTAATTAGG - Intronic
959596517 3:108134977-108134999 TTTAGTAAACAAATTCAGGTAGG + Intergenic
959950893 3:112178773-112178795 TCTAGGAAACAACCTTCAGTTGG - Intronic
960513162 3:118574843-118574865 TTTAAAAAATCAACTTAATTGGG - Intergenic
960824640 3:121770023-121770045 TTTAGAAAAAAATATTTAGTTGG + Exonic
961224809 3:125233546-125233568 TTTTGAGAACTAACTTAGGTGGG + Exonic
961255691 3:125549640-125549662 TTTAAAAAAAAAAATTAACTGGG - Intronic
961709913 3:128820215-128820237 TTTAAAAGACAAACTAGAGTTGG - Intergenic
962074351 3:132065128-132065150 TTTAAAAAACAAAACTAACTTGG + Intronic
962641408 3:137390487-137390509 TTTGCAAAACAAATTTAAGGTGG + Intergenic
963526353 3:146419584-146419606 TTAAGAAATCAAACTTGAATCGG + Intronic
964002633 3:151794926-151794948 TTAAGAAAATAACCTTAAGCTGG + Intergenic
964780352 3:160330506-160330528 TTTCAAACATAAACTTAAGTAGG + Intronic
964895325 3:161589130-161589152 TTTAAAAATAAAACTTAAGATGG - Intergenic
965075853 3:163974562-163974584 TGCAGAAAACAAACTGAAATGGG + Intergenic
965641509 3:170833624-170833646 TTTAGGAAATAAACTTATTTAGG - Intronic
966046416 3:175556255-175556277 TTTAAAAAAAAAACTGAAGTAGG + Intronic
966295010 3:178409289-178409311 CTTAGAAAAGAATATTAAGTAGG - Intergenic
966551497 3:181209483-181209505 TTAGGAAAAAAAATTTAAGTGGG + Intergenic
967246904 3:187496994-187497016 TTTATAAAACAAACAAAAGAAGG + Intergenic
967487770 3:190054172-190054194 TTTAGAAAATAAACTATAGGTGG - Intronic
967522168 3:190445488-190445510 TGTTGAAAACAAATTTAAATAGG + Intronic
967660793 3:192107018-192107040 CTTAGAAGACAGACTGAAGTTGG + Intergenic
967750337 3:193107368-193107390 TTTAGCAAACAATTTTAATTTGG - Intergenic
967789624 3:193533331-193533353 TATAGAAAACAAACATAAGAAGG + Intronic
968011038 3:195276144-195276166 TTTAAAATACAAACTTAAATTGG + Exonic
968038289 3:195567396-195567418 GTTAAAAAACAAACTCAAGGAGG + Intergenic
969203353 4:5622999-5623021 TTCAGAAAAGAAAATTAAGTGGG + Intronic
969719796 4:8887312-8887334 TTCAGAGAACTAACTTAATTAGG + Intergenic
971081513 4:23217680-23217702 TATATAACACAAAATTAAGTGGG - Intergenic
971643751 4:29169004-29169026 TTTAAAAAATAAAGTTAATTAGG + Intergenic
972180703 4:36461970-36461992 TTCAGAGAACAAAATTCAGTAGG + Intergenic
972850770 4:43047631-43047653 TTTAGAGAACACAGTTGAGTTGG + Intergenic
973007955 4:45036129-45036151 TTTAAAAAAAAAAATTAAGCCGG - Intergenic
973329856 4:48902065-48902087 TTTAAAAAAAAAACTTAATGGGG - Intronic
974329618 4:60461190-60461212 CTTATAAAACAAAGTTAGGTTGG + Intergenic
974583711 4:63841025-63841047 TTTAAAAAACAAAATTTAGATGG + Intergenic
974679559 4:65143740-65143762 TTTAAGAAACAAAAATAAGTTGG + Intergenic
974816989 4:67018010-67018032 TGTAGAAAACAAACCTATTTAGG + Intergenic
975011494 4:69359894-69359916 TTTAGAGAACAAACCTGAGCAGG - Intronic
975368901 4:73561040-73561062 TTTAAAAATCAAGCTTAAATAGG + Intergenic
975411459 4:74056084-74056106 TTTATAAGAAAAAATTAAGTAGG - Intergenic
975486807 4:74942777-74942799 TGTAGAAAACAGACCTAAGAGGG - Intronic
975789023 4:77927857-77927879 TCTAGAAAACAAGCTTAGATTGG - Intronic
975909991 4:79256097-79256119 TTTAAAAACCCAACTGAAGTAGG - Intronic
975962025 4:79921333-79921355 CTTAGAAACCTAACTTAACTAGG - Intronic
976477247 4:85498411-85498433 TTTAGAATACCAAAGTAAGTAGG - Intronic
976622601 4:87144068-87144090 TTTAAAAAAAAAATTTAAGTCGG + Intergenic
977121072 4:93102875-93102897 TTTAGAAAACAACTTTATCTAGG - Intronic
977417100 4:96747941-96747963 TATACAAAACAAACTCAAGATGG + Intergenic
977459125 4:97302063-97302085 TTTGGAAATCAAAGTAAAGTTGG + Intronic
977659534 4:99566852-99566874 TTTTGAAATCAAACTTACGGAGG - Intronic
977968465 4:103184544-103184566 TTTGGGAAAAAAAATTAAGTCGG - Intronic
978262062 4:106772155-106772177 TTTAAAAAAGAAACTTTATTAGG + Intergenic
979567274 4:122168583-122168605 GTTAAAAAAAAAACTTAAGAGGG + Intronic
980460029 4:133097469-133097491 ATTAGAAAATAGGCTTAAGTAGG + Intergenic
981445028 4:144825978-144826000 TTTAAAAAACAATTTTAAGTTGG + Intergenic
981826459 4:148947559-148947581 TTCAGAAAACAACATTCAGTAGG + Intergenic
982285612 4:153730690-153730712 TTTAAAATAAAAACTTGAGTTGG + Intronic
982766043 4:159349732-159349754 ATTAGAAACCAAATTTGAGTTGG - Intronic
983136483 4:164089286-164089308 TTTAGAAATCAAATATAAATTGG + Intronic
983287904 4:165762333-165762355 TTTTTAAAACATACTTAACTGGG - Intergenic
983787833 4:171757031-171757053 TTTATTTAACAAACTTAAATTGG - Intergenic
984106924 4:175559000-175559022 TTGAGAAAGAAAAATTAAGTTGG - Intergenic
984481272 4:180306150-180306172 TACAGAAAACATACTTATGTAGG + Intergenic
984658859 4:182351251-182351273 TTTAGCAAAGAAATGTAAGTGGG + Intronic
987008094 5:13731657-13731679 TTTGGAAAAAAAAAGTAAGTTGG + Intronic
987052965 5:14163502-14163524 TTTAGAAAATACCCTTTAGTTGG - Intronic
987241990 5:16009523-16009545 TTTTGAAATGAAACTTATGTTGG + Intergenic
987449789 5:18068537-18068559 TTTAAAATACAAACTCATGTAGG + Intergenic
987450924 5:18083250-18083272 TTTAGTAAACAACATTAAGGAGG + Intergenic
987968007 5:24901677-24901699 GTGGGAAAACAAACTTAAGAAGG - Intergenic
988118653 5:26930199-26930221 TTAAAAAAACAAACTTGATTGGG - Intronic
988132345 5:27121138-27121160 TTGGGAAAACAGACTTAACTGGG - Intronic
988364888 5:30284784-30284806 TTCAGAAAACACAATTAATTGGG + Intergenic
988376402 5:30440790-30440812 TATAGAAAATAAACTTAAAAGGG + Intergenic
988499794 5:31775079-31775101 ATTAGAAAACAAAATGTAGTTGG - Intronic
989523806 5:42429421-42429443 TTTAGAAAACACACATTAGGAGG - Intronic
990106248 5:52265693-52265715 TTTGGAAAAAAAAATTAGGTTGG + Intergenic
990225098 5:53641544-53641566 TTTAACAAACAAACAAAAGTTGG + Intronic
990555846 5:56934893-56934915 TTTTGAAAACCAACTACAGTTGG + Intronic
990773488 5:59277952-59277974 TGGCAAAAACAAACTTAAGTGGG + Intronic
991423723 5:66468542-66468564 TTTGAAAAACAAATTTAATTTGG - Intergenic
991449236 5:66733757-66733779 TTTAAAAAAAAAACACAAGTTGG - Intronic
992121996 5:73603594-73603616 ATCAAAAAACAACCTTAAGTGGG + Intergenic
992243626 5:74794960-74794982 TTAAGAAAACAAAATTAGCTGGG + Intronic
992489423 5:77227819-77227841 TTAAGAATACAAAGTTGAGTAGG + Intronic
992939101 5:81744890-81744912 TTTTAAAGACAAACTTCAGTTGG - Intronic
993302997 5:86237252-86237274 TTTTGAAATAAAACATAAGTTGG - Intergenic
993717260 5:91287979-91288001 AGTAGAAAACAAACTTCTGTAGG - Intergenic
993765667 5:91854497-91854519 TTTAGAAACCAATCAAAAGTGGG + Intergenic
993850889 5:93007212-93007234 TTTGGAGCAAAAACTTAAGTAGG + Intergenic
994200652 5:96971949-96971971 ATTAGAAAGCAATCTTAAGGTGG - Intronic
994222374 5:97210696-97210718 TTTCAAAAAGATACTTAAGTTGG + Intergenic
994612857 5:102067158-102067180 GTTAGAAAACAAAGTTAAAGTGG + Intergenic
995213330 5:109566106-109566128 TTTAGAAAAGAAAATTAATTTGG + Intergenic
995615829 5:113962351-113962373 TTTAAAAAAAAAACTCATGTAGG - Intergenic
995657675 5:114444989-114445011 TTTAGAACACAAAGTTTAGATGG + Intronic
995697031 5:114890972-114890994 TTTTGAAAACAAACAAAATTAGG - Intergenic
995759788 5:115551134-115551156 TTAAGTAAATAACCTTAAGTGGG - Intergenic
995783321 5:115801198-115801220 TTTAGAAAACAAAAGTATGTGGG - Intergenic
996842029 5:127857473-127857495 TGTAGACAATAAATTTAAGTAGG - Intergenic
997423465 5:133787231-133787253 TTTAGAACTCAAATTTAATTGGG + Intergenic
999101908 5:149032508-149032530 TTTTGAAAACAAAATTAACTTGG + Intronic
999505196 5:152187343-152187365 AATAGAAAACAAACTAATGTTGG + Intergenic
1000184966 5:158850703-158850725 TTCAGCATAAAAACTTAAGTAGG + Intronic
1000585302 5:163090004-163090026 TTTGGAGATAAAACTTAAGTTGG + Intergenic
1000613397 5:163400259-163400281 TTTTGAAGAAAAACCTAAGTGGG - Intergenic
1000857959 5:166422952-166422974 TTTAGAACACTGACTAAAGTTGG + Intergenic
1001361887 5:171094629-171094651 GTTAGAAGACAAGCTTAGGTGGG - Intronic
1002146972 5:177191624-177191646 TTTTGAAAATAAAATTAAGCTGG - Intronic
1002970164 6:2008132-2008154 TTTAGAAATAAAATATAAGTAGG + Intronic
1004030929 6:11868812-11868834 TTTAGAAAACAAAGAGAAATTGG - Intergenic
1004067438 6:12262519-12262541 ATTAGTAAACAAACTAAAATAGG + Intergenic
1005662446 6:28012649-28012671 CTTAGAAAAAAATCTTTAGTTGG - Intergenic
1006676432 6:35767398-35767420 TTTAGTAAACAAACTCAAAGTGG + Intergenic
1006725026 6:36193067-36193089 TTTATTAAACTCACTTAAGTTGG + Intergenic
1007997140 6:46320260-46320282 TTTGGAAGAGAAACTTAGGTGGG - Intronic
1008191050 6:48457900-48457922 TTTAGATAAAATAATTAAGTTGG + Intergenic
1008418430 6:51269932-51269954 TTTGAAAATCAAATTTAAGTGGG + Intergenic
1008458722 6:51742715-51742737 TTTAGAACACAAACTTCATGAGG - Intronic
1008756716 6:54804474-54804496 ATAAGAAAACAATTTTAAGTAGG + Intergenic
1009732346 6:67624096-67624118 GATAGAAAAAAAAATTAAGTTGG - Intergenic
1010969569 6:82248890-82248912 TTTTGAAAATAAGCTTAAGTTGG + Intergenic
1011472565 6:87722321-87722343 TTTTTAAAAGAAACTTGAGTAGG + Intergenic
1011875852 6:91960577-91960599 TTTGGAAAACAAAATAATGTAGG - Intergenic
1012159725 6:95868991-95869013 TTTAAAAAACAAACTTTATTGGG + Intergenic
1012275651 6:97272169-97272191 TTTAAAAACCAAACTTCAGAGGG + Intronic
1012509111 6:99982325-99982347 TATATAAAACAATCTTAATTGGG + Intronic
1012717186 6:102690242-102690264 TTGACAAAACAAAATAAAGTGGG - Intergenic
1013530369 6:111014090-111014112 TGTATAAAACAAACACAAGTGGG - Intronic
1013648264 6:112167419-112167441 TTTAGAAAACAAACTTAAGTGGG - Intronic
1013649136 6:112175867-112175889 TTTATATAACATACTTAACTTGG + Intronic
1013711508 6:112905768-112905790 TTTAGAAAAGAAACTTTGTTAGG - Intergenic
1013930452 6:115524606-115524628 TTTAAAAAATAATTTTAAGTAGG + Intergenic
1014038676 6:116798583-116798605 TTTTGAAAACAGACTGAAGGGGG + Intronic
1014147769 6:118017721-118017743 CTTAGAAAACAAAATTAAAAGGG - Intronic
1014401805 6:120999053-120999075 TTTAAAGAACAAACTTAAACAGG + Intergenic
1014577003 6:123086010-123086032 TTTTGAAAAAAAAATTAAATTGG + Intergenic
1014708832 6:124782118-124782140 TTTTGAAAATACAGTTAAGTAGG - Intronic
1014947072 6:127511324-127511346 TATAGAAAAAAAAGTAAAGTAGG - Intronic
1015929286 6:138341032-138341054 TTTAGAAAACTCACTGAATTAGG + Exonic
1016157846 6:140835201-140835223 TTTAGATAACAATATTCAGTGGG + Intergenic
1016223108 6:141699994-141700016 ATTAGAAAACAAAATTAGCTGGG - Intergenic
1016226186 6:141741331-141741353 TTTACAAAATTAACTTAAGATGG + Intergenic
1016326211 6:142904997-142905019 TTAAGAAAATATAATTAAGTCGG - Intronic
1016582018 6:145638816-145638838 TTTGGAAAACAAACTGAAATAGG - Intronic
1016885821 6:148958725-148958747 CTTAGAAAACAAACAAAATTGGG - Intronic
1016895581 6:149048601-149048623 TGTTTAAAACATACTTAAGTTGG + Intronic
1018717897 6:166548394-166548416 TTTTGAAAAAACACTAAAGTGGG + Intronic
1019844681 7:3485787-3485809 ATAAGAAAACACACTTACGTGGG - Intronic
1020234596 7:6346063-6346085 TTTAAAAAACAAACTTTGGCTGG - Intronic
1020398075 7:7740562-7740584 TTTAGTGAACAAATTCAAGTAGG + Intronic
1020537044 7:9412898-9412920 TTTAGAAATCAGACTGAAGAAGG - Intergenic
1020872647 7:13651280-13651302 TTTAAAAAAGCAATTTAAGTTGG - Intergenic
1020951773 7:14688258-14688280 TTTATAAAACAAAAATAAGCAGG + Intronic
1020953761 7:14713334-14713356 TTTAGAAAAGGCACTTAAGCTGG + Intronic
1021908504 7:25360661-25360683 TTAAGAAAACACACTTAGGAAGG + Intergenic
1023634305 7:42194489-42194511 CTTAGAAAAGAGACTTGAGTTGG - Intronic
1024057290 7:45670073-45670095 TTTAGAAAATACTCTTGAGTAGG + Intronic
1024341892 7:48273395-48273417 TTCAGTAAAAAAACTTAACTTGG + Exonic
1024739937 7:52342488-52342510 TTTCAAAAACAAACTTAGGCCGG - Intergenic
1024857941 7:53803174-53803196 TTTATAAAACAAACATATTTTGG + Intergenic
1025217016 7:57065762-57065784 TTTAGAAAATAAAGCCAAGTGGG - Intergenic
1025654371 7:63504980-63505002 TTTAGAAAATAAAGCCAAGTGGG + Intergenic
1026242810 7:68591806-68591828 TTTGGAAAAAAAACTTAAATAGG + Intergenic
1027604164 7:80279589-80279611 ATTAGAAAACAAAGTCAACTTGG - Intergenic
1027828455 7:83147412-83147434 TTTGGAAAACAAAGTTTATTGGG - Intronic
1028267960 7:88751351-88751373 TATAGAAAAAATACTTAAGTTGG - Intergenic
1028312472 7:89356097-89356119 TTAAGAAATAAAACTTAAGGAGG - Intergenic
1028617688 7:92788043-92788065 ATTAGAAAACACACTGCAGTTGG + Intronic
1028662387 7:93294485-93294507 TTTGGAAAACAAACACAAATTGG + Intronic
1029295120 7:99534377-99534399 TTTAAAAAACATACTTTAGCTGG + Intronic
1031216751 7:118902499-118902521 TTTAGAAAACAAACATAAAATGG - Intergenic
1031386914 7:121162577-121162599 TTTAAAAAACAAATCAAAGTAGG - Intronic
1031399218 7:121311668-121311690 TTAAGAAAAGAAAACTAAGTGGG + Intergenic
1031715253 7:125101301-125101323 TTTAGAAAAAAATATTAAATTGG - Intergenic
1032331836 7:130987637-130987659 TTTACAAAAGAAAATTTAGTGGG + Intergenic
1032567506 7:132961948-132961970 TTAGGAAAATAAACTTAAATTGG - Intronic
1034051642 7:147990322-147990344 TTTGGAGAACAAACCTAAGAGGG + Intronic
1034218836 7:149429051-149429073 TTTAAAAAACAAATTTCAGATGG + Intergenic
1036417345 8:8563107-8563129 TTTAGAAAACAAAGTGTATTTGG + Intergenic
1036598270 8:10234395-10234417 TTTGGAAAACATAGTGAAGTGGG + Intronic
1036957235 8:13201460-13201482 TTGAGAAAATAAATTTAAGAAGG + Intronic
1037405196 8:18534991-18535013 TTTAGCAAACAAAATTAACTGGG + Exonic
1039214675 8:35256823-35256845 TTTGGAAAACAAACTACAGCTGG - Intronic
1039557854 8:38489556-38489578 TTTAAAAAACATCCTGAAGTTGG + Intergenic
1039866344 8:41506906-41506928 TGGAGAAAGCAAACTTAAGTAGG + Intronic
1040357115 8:46629414-46629436 TTTAAAAAATAAAATAAAGTTGG + Intergenic
1041921883 8:63191464-63191486 TTAAGAAAACAGAGTTAAGAGGG - Intronic
1041924107 8:63218337-63218359 TTTAGACACCAAGGTTAAGTGGG - Intergenic
1042071227 8:64937213-64937235 TTTAAAAATCATACTTTAGTAGG + Intergenic
1042149520 8:65767054-65767076 TTTAAAAAACAAGATTCAGTTGG - Intronic
1042297093 8:67232364-67232386 TTTAGAAAACAAACTAAAAATGG + Intronic
1042591198 8:70401496-70401518 TTTTGCAAACAAAATGAAGTTGG - Intronic
1042691953 8:71509454-71509476 TTTAGAAAGCATGCTTAAGTAGG + Intronic
1042734107 8:71968575-71968597 TTTAGAAAGTAAAATTAATTAGG + Intronic
1042927227 8:73978392-73978414 TTTTAAAAATAAACTTAAGCTGG + Intronic
1043578218 8:81682214-81682236 TTTAGAACACAAATATATGTTGG - Intronic
1043582327 8:81728264-81728286 TTTAGAAATCAACTTTAAGTAGG + Intronic
1043949314 8:86290543-86290565 CTTTTAAAACAAACTTGAGTGGG + Intronic
1044071808 8:87770168-87770190 TTTTGAAAACACACTTAAAACGG - Intergenic
1044434342 8:92144713-92144735 TTTTGCAAACAAACATAAATAGG - Intergenic
1044544339 8:93442959-93442981 TGTAGTAAACACACTTAAGAAGG - Intergenic
1044796925 8:95910960-95910982 TTTAGAAAAAAAACTAAATTTGG + Intergenic
1046133116 8:109992912-109992934 TTTAGAGAAAAAAATTAAGGAGG - Intergenic
1046301467 8:112297822-112297844 TTTAGATAAACAACTTTAGTTGG + Intronic
1046981836 8:120344999-120345021 TTTAGAAAAGAAAAATAACTTGG + Intronic
1047368512 8:124235071-124235093 TTTAAAAAACAATCTTGAGAAGG - Intergenic
1048089271 8:131221147-131221169 TATAGAAAACAAATATATGTGGG + Intergenic
1048792426 8:138116145-138116167 CTTTAAAAAAAAACTTAAGTTGG + Intergenic
1049882553 8:145076121-145076143 TTAAGAAATCATACTTAAGATGG - Intergenic
1050195761 9:3082106-3082128 TTTAGAGAACACAAATAAGTGGG + Intergenic
1050976035 9:11939812-11939834 TATTTAAAACAAACTTAAGAAGG + Intergenic
1051088233 9:13376967-13376989 TTTATAAAACAGATTAAAGTAGG - Intergenic
1051273622 9:15378676-15378698 TTTAAAAATCTAACTTAACTAGG - Intergenic
1051805461 9:20987822-20987844 TTTAAAAAACAAAATTAAAAGGG + Intronic
1051930111 9:22374783-22374805 TTTTAAAAATAAAATTAAGTAGG + Intergenic
1052312336 9:27081022-27081044 TTGGGAAATCAAACTTAAGCTGG + Intergenic
1052599512 9:30606404-30606426 TTTAGAAAACAAATTAATCTAGG + Intergenic
1052664687 9:31479887-31479909 TTTAGAAAACCAAAATAAGGTGG + Intergenic
1053113814 9:35484805-35484827 TTTAGAAATCTCACTTCAGTAGG - Intergenic
1053601584 9:39616221-39616243 TATATAAAACTAAGTTAAGTAGG + Intergenic
1053859231 9:42369989-42370011 TATATAAAACTAAGTTAAGTAGG + Intergenic
1054251949 9:62726225-62726247 TATATAAAACTAAGTTAAGTAGG - Intergenic
1054566064 9:66760726-66760748 TATATAAAACTAAGTTAAGTAGG - Intergenic
1054757100 9:68969759-68969781 ATAAGTAAACAAACTTCAGTGGG + Intronic
1055086815 9:72322950-72322972 TTTAGAAAACAAACCTGAGAGGG + Intergenic
1055222915 9:73959594-73959616 AGTAGAAAACAAACTTAGGTTGG - Intergenic
1055719836 9:79160602-79160624 TTCAGATGAGAAACTTAAGTAGG + Intergenic
1056527754 9:87459168-87459190 TTCAGAAAACAAACCAAAGTTGG - Intergenic
1057841837 9:98492327-98492349 ACTAGGAAACAAACTTAAGCGGG - Intronic
1057890383 9:98865375-98865397 TTAAGAAAACAGCCTTGAGTTGG - Intergenic
1058345089 9:103951450-103951472 TTTAGAAAAGAAACAAAAGTAGG - Intergenic
1058476454 9:105338888-105338910 TATATAATTCAAACTTAAGTGGG + Intronic
1060776951 9:126381727-126381749 TTTAAAAAAAAAACCTTAGTAGG - Intronic
1060843534 9:126815599-126815621 TTTAAAAAACAAACATACATTGG - Intronic
1061530237 9:131205977-131205999 TTTAAAAAACAAATTTAGGCTGG - Intronic
1061605006 9:131703153-131703175 TTTAAAAAATAAAATTAACTGGG - Intronic
1062321403 9:135992196-135992218 TTTAAAATAGAAACTTAGGTGGG - Intergenic
1203428808 Un_GL000195v1:69437-69459 ATTAAAAAACAAACATAAGATGG + Intergenic
1203368347 Un_KI270442v1:278326-278348 TTAAGAAATCAAACTTTAGATGG + Intergenic
1203541992 Un_KI270743v1:97503-97525 CTTAAAAAAAAAACTTAAGAGGG - Intergenic
1185969923 X:4651042-4651064 AGTAGAAATCAAACATAAGTGGG - Intergenic
1186217079 X:7311864-7311886 TTTAAAAAACAAAATTAACCAGG + Intronic
1187551223 X:20307458-20307480 TTAAGAAAATAAACTTAAGGAGG + Intergenic
1187715315 X:22096644-22096666 TTTGACAATCAAACTTAAGTTGG - Intronic
1187896752 X:23989155-23989177 TGTAGAAAACAAAAGAAAGTAGG - Intronic
1187950924 X:24469491-24469513 TTAAAAAAAAAAACTTAGGTGGG + Intronic
1188398141 X:29710940-29710962 TTTAAAAAATAAATTTCAGTAGG - Intronic
1188551206 X:31366538-31366560 AAAAGAAAAAAAACTTAAGTAGG + Intronic
1189609655 X:42718823-42718845 TTTAGAACACACACCTAAATAGG - Intergenic
1190130722 X:47746372-47746394 TTTAGAAAAAAAGATTAAATTGG + Intergenic
1190268354 X:48843299-48843321 TTTAGAAAAAAAAATTAGGCTGG + Intergenic
1190990748 X:55547875-55547897 TTTATAAAACAAACATAATATGG - Intergenic
1191020333 X:55852347-55852369 TTTAGAAAAAAAACTAAGGTGGG + Intergenic
1191941668 X:66487580-66487602 TTTAAAAAACACATTTAACTGGG + Intergenic
1192111151 X:68366322-68366344 TTTAGAAAAAAAAGTCAAATAGG - Intronic
1192409062 X:70916292-70916314 TTTAGAAAGAAAACTTAATGTGG + Intergenic
1193821666 X:86172658-86172680 TTGAGCAAACAAATTTAATTAGG + Intronic
1193904846 X:87229701-87229723 TTTACAAAGAAAACTTTAGTTGG + Intergenic
1193930751 X:87547865-87547887 TTTAGAAAATAAATTTAAAAGGG + Intronic
1195054847 X:101134389-101134411 TTTAGAGAATAGAATTAAGTAGG + Intronic
1195111172 X:101651514-101651536 TTTAAAATACAAATTTCAGTGGG + Intergenic
1195406324 X:104518007-104518029 TTTAGAAAATCAAATCAAGTGGG - Intergenic
1195568852 X:106377034-106377056 TTTAGAAAACATACATATGGTGG - Intergenic
1196383849 X:115125847-115125869 TTTAGAAAACAATTTAAATTAGG - Intronic
1196771801 X:119301716-119301738 TATATAAAACAAACATAAGAAGG - Intergenic
1196884717 X:120232824-120232846 TTTGAAAAACAAATTTAATTGGG + Intergenic
1196918447 X:120562026-120562048 CTTAGAATACACACTTAATTTGG - Intronic
1198710410 X:139495526-139495548 TTTTGAAAACAGACTGAAGGGGG - Intergenic
1199404323 X:147438812-147438834 TTTAAAAAAAAAACTGAATTAGG - Intergenic
1200822477 Y:7601169-7601191 TTTAGAAAACAAACCTGATAGGG + Intergenic
1200906465 Y:8488118-8488140 TTAACATAACAAACTTAAGTAGG + Intergenic
1201070353 Y:10141983-10142005 TTAAGAAATCATACTTTAGTTGG - Intergenic
1201309104 Y:12578714-12578736 TGTAGAAAACTAACTCAAGATGG - Intergenic
1202237826 Y:22732848-22732870 TTTAGAAAACAAACCTGATAGGG - Intergenic