ID: 1013649601

View in Genome Browser
Species Human (GRCh38)
Location 6:112181203-112181225
Sequence TCTTCTCTAGACCACTGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013649601 Original CRISPR TCTTCTCTAGACCACTGTGG CGG Intronic
901185325 1:7369095-7369117 CCTTCTCCAGGCCCCTGTGGTGG - Intronic
901188464 1:7389722-7389744 TCCTGTCCAGACCACTGTGAAGG - Intronic
902601550 1:17543084-17543106 TCTTCTCTCTACCTCAGTGGAGG + Intronic
902986087 1:20155139-20155161 TATCCTCTTAACCACTGTGGGGG - Intergenic
903484105 1:23676828-23676850 TAGACTCTTGACCACTGTGGAGG + Intergenic
904478726 1:30781217-30781239 TCTACTCCACTCCACTGTGGAGG - Intergenic
906275003 1:44508765-44508787 TCTTCTTTAGACCCTCGTGGTGG + Intronic
906499511 1:46331246-46331268 TATTCTCTTGACTGCTGTGGGGG + Intergenic
906528163 1:46508490-46508512 GGTTCTCTGGACCAGTGTGGAGG + Intronic
906638781 1:47428457-47428479 TCTTGTTTAGACCACTGATGTGG - Intergenic
909209456 1:72805564-72805586 TCTTCTTTTGCTCACTGTGGTGG + Intergenic
912815853 1:112827445-112827467 TGTTCTCTCAACCACTGTGGGGG - Intergenic
915142082 1:153774193-153774215 TCTGCTCTAGACAAAAGTGGGGG - Intergenic
915348499 1:155210282-155210304 TCTTCTTGATACCACTGTGGGGG + Intronic
918647724 1:186921835-186921857 TGTCCTCTTGACCACTGTGGGGG + Intronic
919896463 1:202012490-202012512 TCATCTCTAGCACTCTGTGGAGG - Intronic
921521182 1:216156017-216156039 TCTTTATAAGACCACTGTGGAGG - Intronic
923068840 1:230544543-230544565 TCTTCTCCAGCTCACAGTGGTGG + Intergenic
1062815002 10:492894-492916 TATTTTCAAGACCACTGCGGTGG - Intronic
1066656803 10:37704559-37704581 GCTTCTCTGGGCAACTGTGGAGG - Intergenic
1071275171 10:84047779-84047801 TCTTATCCAGACCATTGTGGTGG + Intergenic
1076013315 10:127007485-127007507 TCCTCTCAAGTCCAGTGTGGCGG + Intronic
1076476382 10:130756506-130756528 TCTTTTCTTGACCATTGTGCTGG - Intergenic
1080006343 11:27411584-27411606 TCTTCTCTAGAATACTATGAGGG + Intronic
1081569420 11:44280340-44280362 TCTTCTCTACCCCAGTGTGGTGG - Intronic
1083591342 11:63897100-63897122 GCTTGTCTAGACCCCTGAGGGGG - Intronic
1083643169 11:64156567-64156589 TCCTCTCTAGAACAAGGTGGTGG - Intronic
1086973644 11:93109571-93109593 TGTTCTCTCAACCACTGTGTGGG + Intergenic
1087504534 11:99002656-99002678 TATTCTCTAAATCACTGTGGTGG - Intergenic
1087684317 11:101245824-101245846 AGTTCTCTCAACCACTGTGGAGG - Intergenic
1087894603 11:103573325-103573347 TGTTCTCTTAACCACTGTGGCGG - Intergenic
1089284439 11:117396454-117396476 CCTTGTCTAGACCACTGGGAGGG + Intronic
1090045235 11:123326108-123326130 TCTACTCCAGACCCCTCTGGTGG + Intergenic
1091012383 11:132014959-132014981 TCTTGTCTAGACCACTGTCCTGG + Intronic
1091097923 11:132841400-132841422 TGATCTCTAGCCCACTGTAGAGG + Intronic
1091756301 12:3054545-3054567 TCTTTTCACGAGCACTGTGGAGG - Intergenic
1093266503 12:17009801-17009823 TCTTGTCAATCCCACTGTGGTGG + Intergenic
1093288751 12:17298123-17298145 TGTCCTCTTAACCACTGTGGTGG - Intergenic
1095951352 12:47783594-47783616 TGTTCTCGAGAGCCCTGTGGGGG + Exonic
1098248192 12:68541511-68541533 TGTTCTCTCAGCCACTGTGGCGG - Intergenic
1098639571 12:72823339-72823361 TGTTCTCTTAACTACTGTGGGGG + Intergenic
1098898153 12:76085205-76085227 TTTCCTCTAGACCACTTCGGCGG + Intergenic
1100260425 12:92928535-92928557 TCTCCTTTGGACCACAGTGGAGG - Intronic
1100610184 12:96185532-96185554 ACTTCTGTAGGCCACTGTGAGGG - Intergenic
1101029780 12:100647338-100647360 TGTCCTCTTAACCACTGTGGGGG + Intergenic
1101948595 12:109156940-109156962 TCTTCAAAATACCACTGTGGGGG + Intronic
1104993728 12:132641471-132641493 TATTGTCTTTACCACTGTGGGGG - Intronic
1107152462 13:37128096-37128118 ACTTCTCTAGCCTTCTGTGGAGG + Intergenic
1114453013 14:22838626-22838648 TTTTCTCCAGGCCAATGTGGAGG + Intronic
1116753305 14:48914241-48914263 TCTATTCTACACCACTGGGGAGG + Intergenic
1117955480 14:61120259-61120281 TGTCCTCTCAACCACTGTGGGGG + Intergenic
1119484226 14:74977752-74977774 TCTCCTCGAGACCACCCTGGTGG - Intergenic
1120046575 14:79814292-79814314 TCTTGTCTTGTCCACTGTCGTGG + Intronic
1122281192 14:100623372-100623394 CCTTCTCGAGACCACTGGGGAGG + Intergenic
1122838709 14:104444000-104444022 TCTTCTCTAGGCCCTTGGGGGGG - Intergenic
1122941195 14:104982158-104982180 TCTTCCCTGGACCACTGAGATGG + Intergenic
1123410741 15:20056776-20056798 TCAGCTCTAGCACACTGTGGAGG - Intergenic
1123520070 15:21063482-21063504 TCAGCTCTAGCACACTGTGGAGG - Intergenic
1125135221 15:36333412-36333434 TTTTCTGTAGACCAGTGTGGGGG - Intergenic
1135758355 16:25116584-25116606 TCTTCTCTTTTCCACAGTGGAGG + Intronic
1137041792 16:35620044-35620066 TGTTCTCTCAACCACTGTGGTGG + Intergenic
1138185803 16:54976661-54976683 TCCTCTGTAGTTCACTGTGGAGG + Intergenic
1140584488 16:76273797-76273819 TCCTCCATGGACCACTGTGGTGG + Intergenic
1142868401 17:2805218-2805240 TCTTCTCCAGTCCGCTCTGGGGG + Intronic
1143589123 17:7870082-7870104 TCTTCGATTGACCACTGTGATGG - Intronic
1146763943 17:35501887-35501909 TGTTCTCTCAACCACTGTGGGGG - Intronic
1146824948 17:36013896-36013918 TCTCCTCCAGAGCACTGTGGAGG + Exonic
1147414471 17:40278584-40278606 CCTTCTCCTGTCCACTGTGGGGG + Exonic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1150895498 17:69205616-69205638 ACTTCTCTAGATCACTGTTTTGG + Intronic
1152453495 17:80398613-80398635 TGTTCTCTCAACCACTGTTGGGG - Exonic
1153063508 18:1018729-1018751 TATTCTCTGGACTGCTGTGGAGG + Intergenic
1153830183 18:8914930-8914952 TGTTCTCTCAACCACTTTGGTGG - Intergenic
1155517724 18:26640065-26640087 TCTTCTCTGGACCATTGCCGTGG - Intronic
1156167085 18:34434895-34434917 TCTTCCCTAAACCCCTGTTGTGG - Intergenic
1157032491 18:43929401-43929423 TCTTCTTTACACCATTTTGGTGG + Intergenic
1158291707 18:55951669-55951691 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1159172927 18:64796442-64796464 TATTCTCTATAGCACTGGGGAGG - Intergenic
1160969452 19:1760977-1760999 TCTAGTCTAAACCACTATGGTGG + Intronic
1161542410 19:4860012-4860034 TCTCCTGTAGCCCAGTGTGGTGG - Exonic
1162633442 19:11946504-11946526 TGTCCTCTCAACCACTGTGGGGG + Intronic
1163060464 19:14757296-14757318 GAGTCTCTAGACCACTTTGGGGG - Intronic
1163916478 19:20244951-20244973 TGTCCTCTCAACCACTGTGGGGG - Intergenic
1163991601 19:21003658-21003680 TGTTCTCTCAACCACTGTGGGGG - Intergenic
1164217536 19:23162971-23162993 TGTTCTCTCAACCACTGTGGGGG + Intergenic
1165269049 19:34689045-34689067 GCTTCTCCAGCCCACTGAGGAGG + Intergenic
1166136007 19:40777723-40777745 TCCTCTCTAGACCAGTGGGAGGG + Intronic
1166936289 19:46335131-46335153 TCTTCTCATGGGCACTGTGGAGG + Intronic
1167453093 19:49583755-49583777 TCTTCTCTATACCTGTGGGGAGG + Intronic
927937418 2:27083557-27083579 TGAGCTCCAGACCACTGTGGAGG + Exonic
929417584 2:41759413-41759435 TTTTCTGTATACCACTGGGGAGG + Intergenic
930235672 2:48886821-48886843 CCTTCTCTAGACCATTGTGTAGG - Intergenic
930517965 2:52432045-52432067 TGTCCTCTTAACCACTGTGGGGG - Intergenic
937603704 2:123771574-123771596 TCTTCTTTCTACCACTGTGGTGG - Intergenic
937941599 2:127290563-127290585 TCTTCTCTAGACTAGGGTGGGGG - Intronic
938306833 2:130262399-130262421 GCTTCTCAAGAGCCCTGTGGGGG - Intergenic
938809512 2:134840267-134840289 TCCTCTAGAGACCACCGTGGTGG - Intronic
939433519 2:142142669-142142691 TCATCTCTAGTCCACTCAGGTGG - Intergenic
941651334 2:168095424-168095446 TGTTCTTTAGACCTCTTTGGAGG - Intronic
944350077 2:198716022-198716044 TCTTCTCAGGTCTACTGTGGGGG - Intergenic
945155067 2:206829580-206829602 TCCTATCTAGACCACTGTAATGG - Intergenic
948256674 2:236573662-236573684 TCTTATCTATACCACTGTAGAGG + Intronic
1170709260 20:18775353-18775375 GGTTCTCTACTCCACTGTGGTGG + Intergenic
949118313 3:355806-355828 TCATCTGTAGAGCACTGTGATGG + Intronic
949157592 3:847883-847905 TGTCCTCTTAACCACTGTGGTGG - Intergenic
950399467 3:12759403-12759425 TCTTCCCTACAACACTGCGGAGG + Exonic
950931329 3:16791824-16791846 TCTTCTCTAGATGAATGTGAGGG - Intergenic
951275871 3:20685243-20685265 CTTTCTCTTGACCACTGTGTTGG - Intergenic
952185512 3:30963640-30963662 TTTTCTCTCCACCTCTGTGGAGG + Intergenic
953456375 3:43045588-43045610 TCTGCACTAAACCACTGTGTTGG + Intronic
958054358 3:88389986-88390008 TGTTCTCCAGACCATTGTGAGGG - Intergenic
961621463 3:128228024-128228046 TCTTCTCTAGTCCTCAGTGGTGG - Intronic
965329358 3:167351610-167351632 ACCTCTCTAGGCCAGTGTGGAGG - Intronic
966252461 3:177881599-177881621 ACTTCTTTAGAGCACTGTAGTGG + Intergenic
967488678 3:190063667-190063689 TCTCCTCACGCCCACTGTGGTGG + Intronic
967925753 3:194645345-194645367 TCTTCTCAAGACCACATCGGTGG - Intronic
968834640 4:2954646-2954668 ACTTTTCCAGACCACTATGGGGG - Intronic
969923245 4:10560354-10560376 TCTTGTCTAGACCCCTTAGGTGG - Intronic
971027286 4:22600666-22600688 TGTTCTCTTAACTACTGTGGAGG - Intergenic
971179349 4:24314288-24314310 ACTTCTCAATACCACTGTGATGG - Intergenic
975205452 4:71639586-71639608 TGTTCTCTCAACCACTGTAGGGG - Intergenic
977043783 4:92044904-92044926 TGTTCTCTTAACCACTGTTGGGG + Intergenic
977972161 4:103224891-103224913 TATTCTCTCAACCACTGTGGTGG - Intergenic
980072807 4:128261291-128261313 TGTTCTCTCAACCACTGTGGTGG - Intergenic
980423182 4:132591785-132591807 TTTTCTCTAGAGCACTGTTCCGG + Intergenic
981179529 4:141723498-141723520 TCTTCTCTAGACCCCTCAGAAGG + Intronic
985423705 4:189808823-189808845 TCTTCTCAATACCACTTGGGGGG - Intergenic
986195993 5:5536770-5536792 TACTCACCAGACCACTGTGGGGG + Intergenic
987930697 5:24396759-24396781 AGTTCTCTCAACCACTGTGGAGG + Intergenic
988145431 5:27299854-27299876 TCTCCTCTTCACCACTGTGAAGG + Intergenic
988783968 5:34549026-34549048 CCTTCTGTAGACCACAGTTGTGG - Intergenic
989757453 5:44973040-44973062 TCTTCTCTAGGGCACTGTGGTGG - Intergenic
989776017 5:45207531-45207553 TGTTCTCTTAACTACTGTGGTGG - Intergenic
992989719 5:82272303-82272325 TGTTCTCTTAACTACTGTGGTGG + Intronic
995473316 5:112525163-112525185 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1000162881 5:158617366-158617388 CCTTCTCTAGAGCACTGAGTAGG - Intergenic
1000236629 5:159367461-159367483 TGTTCTCTCAACCACTGTTGGGG - Intergenic
1005477321 6:26220283-26220305 TCTTGTCTGGACCACCATGGAGG - Intergenic
1006570573 6:34999768-34999790 TGTTCTCTTAACTACTGTGGCGG - Intronic
1007381051 6:41490387-41490409 GATGCTCTAGACCTCTGTGGTGG - Intergenic
1008123263 6:47641668-47641690 TGTTCTCTCAACCACTGTGGGGG - Intergenic
1009576194 6:65464771-65464793 GATTCTCTAGTCTACTGTGGTGG - Intronic
1013649601 6:112181203-112181225 TCTTCTCTAGACCACTGTGGCGG + Intronic
1014547272 6:122747968-122747990 TGTCCTCTTAACCACTGTGGGGG + Intergenic
1028420507 7:90627582-90627604 TCTTTTCTAGGCCACTTTGATGG - Intronic
1031781763 7:125977036-125977058 TTTTCTGCAGACCAGTGTGGAGG + Intergenic
1032170430 7:129579680-129579702 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1032782264 7:135172771-135172793 TGTTCTCTTAACTACTGTGGTGG - Intergenic
1033899814 7:146122996-146123018 TCTTCTTTAGTTCACTTTGGAGG + Intronic
1037666978 8:20978367-20978389 TCTCCTCTAAACGACTCTGGAGG + Intergenic
1038661512 8:29501509-29501531 GCTTCCCTGGACCACAGTGGAGG - Intergenic
1039794168 8:40898011-40898033 TCTCCTCCAGCCCAATGTGGGGG + Intergenic
1039877041 8:41595895-41595917 TGTTCTCTCAACCACTGTGGCGG + Intronic
1040496127 8:47967034-47967056 TTTTCTCTAAGCCACTTTGGGGG - Intronic
1042761094 8:72272201-72272223 TCTTCTATGGGCCAATGTGGAGG + Intergenic
1042846941 8:73177731-73177753 GCTGCTCTAGACAGCTGTGGAGG + Intergenic
1043739613 8:83794024-83794046 TCTCATCTAGACAACTGAGGGGG + Intergenic
1049582822 8:143420553-143420575 TCTTCTCTGGAGCAGGGTGGGGG - Intronic
1051288231 9:15518180-15518202 TCTTCTACCAACCACTGTGGAGG - Intergenic
1056568171 9:87793182-87793204 TCTTCTAGAGACCACTCTAGTGG + Intergenic
1056623969 9:88238503-88238525 TCATCACCAGACCACTGTGAGGG + Intergenic
1057450291 9:95152531-95152553 GCTTCTGTAGATCACTGTAGGGG + Intronic
1060252411 9:121996977-121996999 TGTTCTCAAGTTCACTGTGGAGG + Intronic
1185909437 X:3968690-3968712 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1186170434 X:6871115-6871137 TGGTCTCTAGTCCACTGCGGTGG - Intergenic
1186558769 X:10588731-10588753 TGTTCTCTTAACTACTGTGGGGG + Intronic
1186758342 X:12696998-12697020 TCTTCCAAAGACCACTGAGGTGG - Intronic
1188963246 X:36518922-36518944 TCATCTCAAGATCACTGTGAAGG - Intergenic
1190417235 X:50191975-50191997 TCCTCTCTAGAGTACTTTGGGGG + Intronic
1190426368 X:50337420-50337442 TGTCCTCTTAACCACTGTGGGGG + Intronic
1190685213 X:52867542-52867564 ACTTCTCAACTCCACTGTGGAGG - Intronic
1190771006 X:53513959-53513981 TGTTTTCTCAACCACTGTGGTGG - Intergenic
1191918176 X:66224983-66225005 TGCTCTCTCAACCACTGTGGTGG + Intronic
1192023864 X:67427232-67427254 TCTACTTCAGACCACTGTGCTGG + Intergenic
1195403280 X:104484716-104484738 GCTTCCCTGGACCACTTTGGAGG - Intergenic
1195413045 X:104589572-104589594 TTTTCTCAATACCACTGTGATGG - Intronic
1196460300 X:115922931-115922953 TGTTCTCTCAACCACCGTGGGGG + Intergenic
1201260265 Y:12152525-12152547 TGTTCTCTCAACCACTGTGAGGG + Intergenic
1201270195 Y:12246769-12246791 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1202152580 Y:21856721-21856743 TCCTCTCTTGTCTACTGTGGTGG + Intergenic