ID: 1013650991

View in Genome Browser
Species Human (GRCh38)
Location 6:112194255-112194277
Sequence GGCTGGGAATCTTAAGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013650984_1013650991 16 Left 1013650984 6:112194216-112194238 CCGACTGAAATGAGACTCAGATC 0: 1
1: 0
2: 2
3: 20
4: 140
Right 1013650991 6:112194255-112194277 GGCTGGGAATCTTAAGGTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 322
1013650988_1013650991 -9 Left 1013650988 6:112194241-112194263 CCAGCTCAATGTGTGGCTGGGAA No data
Right 1013650991 6:112194255-112194277 GGCTGGGAATCTTAAGGTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013650991 Original CRISPR GGCTGGGAATCTTAAGGTCT GGG Intronic