ID: 1013650991

View in Genome Browser
Species Human (GRCh38)
Location 6:112194255-112194277
Sequence GGCTGGGAATCTTAAGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013650988_1013650991 -9 Left 1013650988 6:112194241-112194263 CCAGCTCAATGTGTGGCTGGGAA 0: 1
1: 0
2: 1
3: 18
4: 151
Right 1013650991 6:112194255-112194277 GGCTGGGAATCTTAAGGTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 322
1013650984_1013650991 16 Left 1013650984 6:112194216-112194238 CCGACTGAAATGAGACTCAGATC 0: 1
1: 0
2: 2
3: 20
4: 140
Right 1013650991 6:112194255-112194277 GGCTGGGAATCTTAAGGTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013650991 Original CRISPR GGCTGGGAATCTTAAGGTCT GGG Intronic
905110751 1:35592725-35592747 GGCTGGGAAGTTCAAGGTCAAGG + Intronic
905696817 1:39980722-39980744 GGCTGGGCCTCTTTAGGGCTTGG - Intergenic
909711586 1:78656117-78656139 GGCTGGGAATTTCAAGATCAAGG - Intronic
910090808 1:83461792-83461814 GGCTGGGAAGGTCAAGGTCAAGG + Intergenic
910424979 1:87112687-87112709 GACTAGGAATCTTGAGGGCTGGG - Intronic
911264582 1:95727954-95727976 GGCTGGGAATTCTAAGATCAAGG + Intergenic
911267173 1:95755366-95755388 GGCAGGGAATTTCAAGATCTAGG + Intergenic
911713159 1:101098194-101098216 GGCTGAGAAGTTTAAGGGCTTGG - Intergenic
915699491 1:157777538-157777560 GGCTGGGAAGTTTAAGATCAAGG + Intergenic
917015228 1:170522967-170522989 GGCTGGGAAATATAAGGTCAAGG - Intergenic
918297423 1:183170164-183170186 GGCTGGGAAGTTCAAGGTCAAGG + Intergenic
920399454 1:205668115-205668137 GGCTGGGAAGAGTAAAGTCTGGG - Intronic
921925603 1:220707895-220707917 GGCTGGGAATTCCAAGGTCAAGG + Intergenic
922254978 1:223885872-223885894 GGCTGGGGAGCCTAAGGTCAAGG + Intergenic
924181876 1:241446972-241446994 GGCTGGGAAGTTCAAGGTCACGG - Intergenic
1062819539 10:523888-523910 GGCTGCGAATTTTTAGGTCTAGG - Intronic
1062907779 10:1190550-1190572 GGCTGGAAGTCTGAAGGTGTGGG + Intronic
1065333293 10:24626541-24626563 GGCTGGGAAGCCCAAGGTCAAGG - Intronic
1065785524 10:29209826-29209848 GGCAAGCCATCTTAAGGTCTAGG - Intergenic
1066210385 10:33231559-33231581 GGCTGTGAATATTTAGGTATTGG + Intronic
1066757055 10:38721853-38721875 GGCTGGGAATGTCAAGATCAAGG + Intergenic
1067155366 10:43776814-43776836 GGCTCAGAGCCTTAAGGTCTAGG - Intergenic
1069273521 10:66560959-66560981 GGCTGGGAAGTTTAAGATCAAGG - Intronic
1070332661 10:75429487-75429509 GGCTGGGAAGCTGAAGATCATGG - Intergenic
1071127950 10:82357501-82357523 GGCTGGGAAGTCTAAGGTCAAGG + Intronic
1071463352 10:85919095-85919117 TTCTGTGAATCTGAAGGTCTGGG + Intronic
1071880064 10:89887735-89887757 GGCTGGGAAGCTCAAGATCAAGG + Intergenic
1072469343 10:95697732-95697754 GGCTGGGAAGCCCAAGGTCAAGG - Intergenic
1072760272 10:98051019-98051041 GGCTGGGAAGCTCAAGATCAAGG + Intergenic
1073110725 10:101061715-101061737 GGCTGGGAAGCTCAAAGTGTTGG - Intergenic
1073784928 10:106878556-106878578 GGCTGGGAAGTTTAAGATCAAGG - Intronic
1074111120 10:110423441-110423463 GGCTGGGGTTCTTCAGGTTTGGG + Intergenic
1074194782 10:111173918-111173940 GGCTGGAAGTCTTAAGTTGTTGG + Intergenic
1075263864 10:120984424-120984446 GGCTTGGACTCTTATGGACTTGG - Intergenic
1075316362 10:121456839-121456861 GGCTGGGAAGTCTAAGGTTTAGG - Intergenic
1078892557 11:15570468-15570490 GGCTGGGAAGTTCAAGGTCAGGG - Intergenic
1079382375 11:19949244-19949266 GGCTGTGAGTCTGAAGGCCTGGG + Intronic
1081192574 11:40121921-40121943 GGTTTGGAATCTTAGGGTCCAGG - Intronic
1081314801 11:41618972-41618994 GGCTGGGAAATTTAAAGTCAAGG - Intergenic
1081397425 11:42603314-42603336 GGCTGGGAAGTTTAAGATCAAGG + Intergenic
1081417730 11:42835916-42835938 GGCTGGGAAATTGAAGGTCAGGG + Intergenic
1081704895 11:45176955-45176977 GGCTGGGAATCCCAAGCCCTGGG - Intronic
1083010477 11:59392944-59392966 GGCTGGGAATTCTAAGATCAAGG + Intergenic
1084829786 11:71760143-71760165 GGCTGGGAAGCATAGTGTCTGGG - Intergenic
1085503649 11:77043207-77043229 GGCTGGGAAGTCTAAGGTCAAGG + Intergenic
1085776506 11:79371379-79371401 GGCTGGGAATGTTGTGGGCTTGG + Intronic
1087046485 11:93847849-93847871 GGCTGGGAAGCTCAAGATCAAGG + Intronic
1087602663 11:100336809-100336831 GGCCGGGAAGGTTAGGGTCTGGG - Intronic
1087632373 11:100665434-100665456 GGCTGGTAATCCTGAGGTCTAGG - Intergenic
1088925507 11:114297257-114297279 TGCCAGGAATTTTAAGGTCTAGG - Intronic
1088971162 11:114775731-114775753 GGCTGGGAAGTTCAAGGTCATGG + Intergenic
1089571223 11:119411675-119411697 GGCTGGGAAGTCTAAGCTCTAGG + Intergenic
1089809813 11:121122386-121122408 GGCTGGGAAGTATAAGGTCAGGG - Intronic
1091197369 11:133743343-133743365 GGCTGGGAAGTTTAAGATATAGG - Intergenic
1091368179 11:135038936-135038958 GGGTGGGACTCTGCAGGTCTGGG - Intergenic
1091734830 12:2912134-2912156 GGCTGGGAATCAGAAGGCTTTGG + Intronic
1091958252 12:4667058-4667080 GGCTGGGAATCTCAAGATCCAGG + Intronic
1092413447 12:8271535-8271557 GGCTGGGAAGCATAGTGTCTGGG + Intergenic
1095353267 12:41240648-41240670 GGCTGGGAAGTTCAAGGTCAAGG + Intronic
1095547728 12:43391064-43391086 GGCTGGGAATTTCAAGATCAAGG + Intronic
1096896560 12:54826511-54826533 GACTGGGAATCTTTAGACCTGGG + Intergenic
1097544540 12:60982556-60982578 GGCTGGGAAGCATAACCTCTGGG + Intergenic
1097927103 12:65141040-65141062 GGCTGGGAATTCTAAGGTCAAGG + Intergenic
1098209378 12:68147509-68147531 GGCTGGGAAACCTAAGGCCAAGG + Intergenic
1100123882 12:91399698-91399720 GTCTGGGTATCATAAGGTCTTGG + Intergenic
1105381462 13:19891342-19891364 AGCTGGGAAGTTTAAGGTCAAGG - Intergenic
1106946026 13:34828610-34828632 GGCTGGGAATTCTCAGGACTGGG - Intergenic
1108568014 13:51720704-51720726 GGCTGGGAATTCTAAGATCAAGG + Intronic
1109851838 13:68075706-68075728 CTCTGGGAATCACAAGGTCTGGG - Intergenic
1110607017 13:77444949-77444971 GGCTGGGAAGCTTAAGGGCATGG + Intergenic
1111258063 13:85698296-85698318 GGCTGGGAAGTATAAGGTCAAGG - Intergenic
1111553798 13:89852508-89852530 GGCTGGGAATTCTAAGGTTGAGG + Intergenic
1111567311 13:90032818-90032840 CTCAGGGAATCCTAAGGTCTGGG - Intergenic
1111686422 13:91507147-91507169 GGCTGGGAATTTCAAGATCAAGG + Intronic
1111901735 13:94207731-94207753 GGCTGGGAATCTGGTGGTTTGGG + Intronic
1112224046 13:97519866-97519888 GGCTGGGAAGCCCAAGGTCAAGG - Intergenic
1112266792 13:97931834-97931856 GGCTGGGAAGCCTCAGGTCAAGG + Intergenic
1112698893 13:101981406-101981428 GGCTGGGAAGTTTAAGATCAAGG - Intronic
1113451618 13:110413981-110414003 GCCTGTGAATCTTAAGTGCTTGG + Intronic
1113816250 13:113173119-113173141 GGCTGGGAAGTTCAAGATCTGGG - Intergenic
1115952547 14:38737391-38737413 GGCTGGGAATTTCAAGATCAAGG - Intergenic
1116987394 14:51236152-51236174 GGCTGGGAAGCTCAAGGGCATGG + Intergenic
1117332019 14:54722275-54722297 GGCTGGGATTTTCCAGGTCTGGG - Intronic
1118844473 14:69536522-69536544 GGCTGGGGATCTGAAGGCCTGGG + Intergenic
1122211849 14:100178613-100178635 GCCTGGGAGTGTTGAGGTCTGGG + Intergenic
1122264078 14:100538599-100538621 GGCCGGGAAGCGGAAGGTCTCGG + Exonic
1124558612 15:30750014-30750036 GGCTGGGAAGTCTAAGGTCAGGG + Intronic
1125146909 15:36481681-36481703 GGCTGGGAAGTTTAAGATCAAGG + Intergenic
1125753615 15:42047303-42047325 GGCTGGGAAGTCTAAGGTCAAGG + Intronic
1127883044 15:63174818-63174840 GGCAGGGAATCCTGAGTTCTGGG + Intergenic
1127993003 15:64134503-64134525 AGCTGGGAAGTTTAATGTCTAGG - Intronic
1128146334 15:65334324-65334346 GGCTGGGATTTTTAGGGACTTGG + Intronic
1130439048 15:83932754-83932776 TTGTGGGAATTTTAAGGTCTGGG - Intronic
1131350163 15:91692521-91692543 GGCCGGGACTCTTAAGGACTGGG - Intergenic
1132406850 15:101546981-101547003 GGCTGGAAATTCTAAGGTCAAGG - Intergenic
1133354660 16:5127040-5127062 GGCTGGGAAGCATAGTGTCTGGG + Intergenic
1136294951 16:29296238-29296260 GGCTGGGAGGCTGAAGGTCAGGG - Intergenic
1138263717 16:55644272-55644294 GGCTGGGAAACTTGAGGCCATGG - Intergenic
1138323640 16:56141992-56142014 GGCTGGGAAGTTTTAGGTCAGGG + Intergenic
1141496891 16:84416627-84416649 GCCTGGAAATCTGAAGGTCACGG - Intronic
1141720841 16:85754411-85754433 GGCTGGGATTCTTCAGGTGCGGG + Intergenic
1143579970 17:7819707-7819729 GGTTGGGATTCTGCAGGTCTGGG + Intronic
1144153095 17:12470156-12470178 GGCTGGGAACTTCAAGGTCAAGG + Intergenic
1146030348 17:29360743-29360765 GGCTGGGAAGGTTAAGTTCTAGG - Intergenic
1146543444 17:33717968-33717990 CTCTGGGTTTCTTAAGGTCTGGG - Intronic
1146549075 17:33764487-33764509 GGCTGGGAGGTTTAAGGTCAAGG + Intronic
1148858875 17:50593740-50593762 GGCTGGGATGCTTCAGGCCTGGG + Intronic
1148981705 17:51582047-51582069 GGCTGGGAAGTTCAAGGTCAGGG - Intergenic
1152102408 17:78309841-78309863 GGCTGGGAAGTTCAAGGTCAAGG + Intergenic
1153432003 18:5027941-5027963 GGCTGGGAAGCCTAAGATCAAGG - Intergenic
1154079793 18:11244901-11244923 GGCTGGAAAGCTTAAGATCAAGG + Intergenic
1155830363 18:30509275-30509297 GGCTGGGAAATCCAAGGTCTAGG - Intergenic
1156807931 18:41209318-41209340 GGCTGGGAAGTTTAAGATCAAGG - Intergenic
1157438177 18:47689100-47689122 GGCTGGGAATTTGAAGAGCTGGG - Intergenic
1157451278 18:47790997-47791019 GGCTGGAAGTCTTAAGATCAAGG + Intergenic
1157512605 18:48288792-48288814 GGCTGGGAAGTTTAAGATCAAGG - Intronic
1158578837 18:58663507-58663529 GGCGGGGAATCATGAGGTCAAGG + Intergenic
1158617549 18:59001991-59002013 GGCTGGCAATGGTAAGGCCTGGG + Intergenic
1160281193 18:77492672-77492694 AGCTGGGAAACTTACAGTCTGGG + Intergenic
1161139815 19:2640572-2640594 GGCTGGGGAACTTAGGGGCTTGG + Intronic
1162025078 19:7889063-7889085 GGCTGGGAATCCGCAGGCCTGGG + Intronic
1162243461 19:9378410-9378432 GGCTGTGAAGCTTCAGGTCAGGG - Intronic
1163050843 19:14682565-14682587 GGTTGGGATTCTTGAGGTTTTGG + Intronic
1163628379 19:18403757-18403779 GTCTGGGAGTCTTGGGGTCTGGG + Intergenic
1164936790 19:32220920-32220942 GGCAGGGAATGTTCAGGACTGGG + Intergenic
1165282437 19:34808872-34808894 GGCTGGGATTTTTAAGATCATGG - Intergenic
1165533226 19:36421503-36421525 AGCGGGGAATCTTAAGGTCGAGG - Intergenic
1166848164 19:45743126-45743148 GGATGGGAATCCCAATGTCTTGG - Intronic
1168309722 19:55454426-55454448 GCCTGGGAATGTCAAGGTCTGGG + Intronic
1168646463 19:58062117-58062139 GGCTGGGAAGCCTAAGATCAAGG + Intronic
925431983 2:3802542-3802564 GGCTGGGAAGTGTAAGGTCAGGG + Intronic
925585252 2:5458677-5458699 GGCTGGGAAGTCTAAGGTCAAGG - Intergenic
926387383 2:12350147-12350169 GGCTGTGAGTCTGAAGGGCTGGG + Intergenic
928474167 2:31608027-31608049 GTCTGGGAATCCAAAGGTCAAGG - Intergenic
928538775 2:32264699-32264721 GAATGGGATTTTTAAGGTCTGGG - Intronic
929051263 2:37838858-37838880 GGCAAGGAATCTGAAGGCCTAGG + Intergenic
931162181 2:59704274-59704296 GGCATGGACTCCTAAGGTCTTGG + Intergenic
933583104 2:84149661-84149683 GGCTGGGAAGTTCAAGGTCAAGG + Intergenic
933759866 2:85665810-85665832 GGGTGGGAGTGTTAGGGTCTGGG + Intronic
934320362 2:91966294-91966316 GGCTGGGAATGTCAAGATCAAGG + Intergenic
936853285 2:116927761-116927783 GGCTAGGAATCATCAGGTATAGG + Intergenic
942201372 2:173574668-173574690 GGCTCAGAATATTAAGGTCTGGG + Intergenic
942556316 2:177175638-177175660 GGCTGGGTATATTGAGGACTTGG + Intergenic
942784068 2:179679728-179679750 GGGTGGGAATCTTTAGGGGTGGG - Intronic
943542401 2:189232849-189232871 GGCTGGGAAGTTTAAGATCAAGG - Intergenic
944224634 2:197337719-197337741 GGCTGGGAAATTTAAGATCAAGG - Intergenic
945666069 2:212744224-212744246 GGCTGGGAAGCCTAAGATCAAGG - Intergenic
946080426 2:217113921-217113943 GGCTGGGCATCTTTTGGTTTGGG + Intergenic
946366412 2:219251898-219251920 GGCTAGGAATTTTCAGGGCTAGG + Intronic
947507442 2:230719643-230719665 GCCTGGGAATCGAAAGATCTGGG + Intronic
947868644 2:233419574-233419596 GGCTGGAATTTTTAAGGTATAGG + Intronic
949064015 2:241978691-241978713 GGCTGGGAAGCTCAAGGTGCTGG + Intergenic
1169281162 20:4268009-4268031 GGCTGGGAAGTTCAAGGTCAAGG + Intergenic
1169655085 20:7914096-7914118 GACTGGGAATGTTAGGGTCTGGG - Intronic
1169791174 20:9412334-9412356 GGCTGGGAGTCTAAAGATCAGGG + Intronic
1172908763 20:38389693-38389715 GGCTGGGAAGCTCAAGATCAAGG + Intergenic
1173160234 20:40646913-40646935 GCCTGGGAAACTTCAGCTCTAGG + Intergenic
1173745325 20:45432280-45432302 GGCTGGGAAGCCCAAGGTCAAGG - Intergenic
1173773566 20:45684478-45684500 GGCTGGGCATCCTGAGGGCTGGG + Intergenic
1174162669 20:48562860-48562882 GGCTGGGATTCTTAGTGACTTGG + Intergenic
1175359614 20:58398520-58398542 GGCTGGAAACTTTAAGGGCTAGG - Intronic
1176953557 21:15073664-15073686 GGCTGGGAAGTTTAAGGGCATGG + Intergenic
1178041358 21:28643704-28643726 GGCTGGGAAGTCTAAGGTCAAGG - Intergenic
1179282451 21:39945451-39945473 GGCTGGGAAGTCCAAGGTCTAGG - Intergenic
1179357851 21:40677862-40677884 GGCTGGGAATTCTAAGATCAAGG - Intronic
1179521012 21:41944558-41944580 TGCTGGAAAACTTAAGGTCAAGG + Intronic
1180096696 21:45558660-45558682 GGCTGGGAATCTGAGGGAGTCGG + Intergenic
1180308608 22:11150350-11150372 GGCTGGGAATGTCAAGATCAAGG + Intergenic
1180547085 22:16512161-16512183 GGCTGGGAATGTCAAGATCAAGG + Intergenic
1180868528 22:19133370-19133392 GGCTGGGACTCTTAAGGGGTGGG - Exonic
1182232119 22:28846223-28846245 GGTTGGGAAGCTGAAGCTCTGGG + Intergenic
1182932519 22:34188779-34188801 GGCTGGGAAATCTAAGGTCAAGG + Intergenic
950455012 3:13087760-13087782 GGCTGGGAAGTCTAAGGTCAAGG + Intergenic
951634656 3:24759921-24759943 GGCTGGGAAGTTTAAGATCAAGG + Intergenic
952182705 3:30935249-30935271 GGCTAGGCATCTGAAGGTTTAGG - Intergenic
954216863 3:49129469-49129491 GGCTGAGAAGCCTCAGGTCTGGG - Intronic
954235843 3:49256619-49256641 CACTGGGAATCTTATGGCCTGGG - Exonic
954522578 3:51242592-51242614 GGTTGGGACACTGAAGGTCTGGG + Intronic
956255960 3:67283578-67283600 GGCTGGGAAATTCAAGGTCAAGG + Intergenic
956382555 3:68680653-68680675 GGCTGGGAAGTCCAAGGTCTAGG + Intergenic
956887956 3:73579265-73579287 GGCTGGGAAGTTCAAGGTCAAGG - Intronic
957058547 3:75462738-75462760 GGCTGGGAAGCATAGTGTCTGGG + Intergenic
957180816 3:76875256-76875278 GGCTGGGAAGCTCAAGATCAAGG - Intronic
957654713 3:83060049-83060071 GGCTGTGAATTCCAAGGTCTAGG - Intergenic
958100110 3:88998578-88998600 GGCTGGGAATTTCAAGATCAAGG - Intergenic
959000101 3:100954345-100954367 GGCTGGGAATCATGAAATCTTGG + Intronic
959008805 3:101050480-101050502 GGTTGAGAACCTTAAGGTGTTGG - Intergenic
959022676 3:101205699-101205721 GGCTGGGGATCTTAACATTTTGG - Intergenic
960006400 3:112785603-112785625 GGCTGGGAAGTCCAAGGTCTTGG - Intronic
960695670 3:120393939-120393961 GGCTGGGAAGCCTAAGATCAAGG - Exonic
961294899 3:125876964-125876986 GGCTGGGAAGCATAGTGTCTGGG - Intergenic
961891001 3:130130185-130130207 GGCTGGGAAGCATAGTGTCTGGG + Intergenic
961993196 3:131214082-131214104 GGCTGGGAAGTCTAAGGTCAAGG - Intronic
962088264 3:132214472-132214494 GGCTGGGAAGTTTAAGATCAAGG - Intronic
962620988 3:137178703-137178725 GGCTGGGAATTCTAAGATCAAGG + Intergenic
964885129 3:161473293-161473315 GGCTGGGAATCCCAAGATCAAGG + Intergenic
964964307 3:162472075-162472097 GGCTGGGAAGCTCAAGATCAAGG + Intergenic
965115340 3:164481207-164481229 GGCTGGGAAGCCTAAGATCAAGG - Intergenic
965265447 3:166537143-166537165 GGCTGGGAATCCCAAGATCAAGG + Intergenic
966229963 3:177640990-177641012 AGCTGGGAAGCTCATGGTCTGGG - Intergenic
966306975 3:178547228-178547250 GGCTGGGAAGTTCAAGGTCAAGG - Intronic
967092917 3:186150577-186150599 GGCTGGGAATCTGAAGAACTGGG - Intronic
967395252 3:189001390-189001412 GGCTGGGAATTCTAAGATCAAGG + Intronic
967463438 3:189774752-189774774 GGCCGGGAGTCAAAAGGTCTGGG - Intronic
967774752 3:193374985-193375007 GGCTGGGAAGTTCAAGGTCAAGG - Intronic
968921882 4:3526596-3526618 GGCTGGGCCTCCTGAGGTCTCGG - Intronic
969002388 4:3992609-3992631 GGCTGGGAAGCATAGTGTCTGGG + Intergenic
969050704 4:4370860-4370882 GGGTGGGAATCTTAACCTCATGG + Intronic
969569205 4:7998679-7998701 GGCTGGGAGTCTGCAGGTCTGGG + Intronic
969751619 4:9115909-9115931 GGCTGGGAAGCATAGTGTCTGGG - Intergenic
969811536 4:9652203-9652225 GGCTGGGAAGCATAGTGTCTGGG - Intergenic
969975261 4:11093146-11093168 GGCTGGGAAGCCTAAGATCAAGG - Intergenic
970086636 4:12355146-12355168 GGCTGGGAAGTTCAAGATCTAGG - Intergenic
970371246 4:15408895-15408917 GGCTGGGAATTCTAAGATCAAGG - Intronic
971968098 4:33588666-33588688 GCCTAGGAATCTAAAGGTGTAGG - Intergenic
972111006 4:35559891-35559913 GTCTGGGAGTCTAGAGGTCTGGG - Intergenic
972226273 4:37016515-37016537 GGCTGGGAAGCTCAAGATCAAGG - Intergenic
972907562 4:43769408-43769430 GGCTGGGAAGTTCAAGGTCAAGG + Intergenic
973952250 4:56027928-56027950 AGCTGGGAAGGTTAAGGTCTGGG - Intronic
974095773 4:57362212-57362234 GGCTGGGAAGTTCAAGGTCAAGG + Intergenic
977489214 4:97691253-97691275 AGCTGGGAGTCTTATGGCCTGGG + Intronic
977503647 4:97874906-97874928 GGCTGGGAAGTTCAAGGTCAAGG - Intronic
977982014 4:103335550-103335572 GGCTGGGAAGTTTAAGATCAAGG + Intergenic
980282335 4:130737573-130737595 CTCAGGGAATCTTGAGGTCTGGG - Intergenic
981077178 4:140603346-140603368 AGCAGGGAATCTTATGGCCTGGG - Intergenic
982303433 4:153903647-153903669 GCCAGGGAATCTGAAGTTCTGGG - Intergenic
982985997 4:162207103-162207125 GGCTGGGAAGTTCAAGGTCATGG + Intergenic
983459914 4:168015134-168015156 GGTTTGGAATGTAAAGGTCTGGG - Intergenic
983496595 4:168449233-168449255 GCCTCTTAATCTTAAGGTCTTGG - Intronic
984260298 4:177436688-177436710 GGCTGGGAAGTTCAAGGTCAAGG - Intronic
984330067 4:178303228-178303250 GGCTGGGAAGCTCAAGGGCATGG + Intergenic
984585520 4:181560122-181560144 GGCTGGGAAGTTCAAGGTTTAGG + Intergenic
984787987 4:183586941-183586963 GGCTTTGAATCTTATGGTCCTGG - Intergenic
985664570 5:1175374-1175396 GGCTGGGATTCATAGAGTCTGGG + Intergenic
986105255 5:4653668-4653690 GGCTGGGAAGTCTAAGATCTAGG + Intergenic
986255327 5:6098237-6098259 GGCTGGGAAGCCTAAGATCCAGG + Intergenic
986532893 5:8757864-8757886 GGCTGGGAATTCCAAGGTCAAGG - Intergenic
986970296 5:13326711-13326733 GGCTGGGAAGGTCAAGGTCAGGG - Intergenic
987472135 5:18345267-18345289 GGCTGGGAATTCCAAGGTCGGGG + Intergenic
989562837 5:42871141-42871163 AGCAGGGAAGCTTATGGTCTGGG - Intronic
993259024 5:85634668-85634690 GGCTGGGAAGCCTAAGGTTGAGG + Intergenic
993748312 5:91630354-91630376 GGCTGGGAAGTCTAAGGTCAAGG - Intergenic
996516275 5:124373025-124373047 GGCTGGGAAGTTCAAGATCTAGG + Intergenic
997195346 5:131975438-131975460 GGCAGGGATTCAGAAGGTCTTGG + Intronic
999200631 5:149813795-149813817 GGCTGGGAAGCCTAAGATCGAGG + Intronic
999420778 5:151440539-151440561 GGCTGGTACTCTTGAGGGCTTGG + Intronic
999903424 5:156112459-156112481 GGATGGGAAGCATAAGGTTTTGG + Intronic
1001441572 5:171747852-171747874 GGCTGGGAATTCCAAGGTCAAGG + Intergenic
1002053491 5:176585081-176585103 GGCTGGAACTCACAAGGTCTGGG + Intronic
1002421074 5:179149338-179149360 GGCTGGGAAGCCCAAGGTCAGGG - Intronic
1003183550 6:3811668-3811690 GGCTGGGAAGCCCAAGGTCAAGG + Intergenic
1004373879 6:15075439-15075461 GGCTGGGAAGCCTAAGATCAAGG + Intergenic
1006283956 6:33078953-33078975 GGCCTGGAATTTTAGGGTCTGGG + Intronic
1007492125 6:42231273-42231295 GGCTGGGAAGTTCAAGGTCAAGG - Intronic
1012198338 6:96373663-96373685 GGCTGGGAAGCCCAAGGTCAAGG + Intergenic
1012243510 6:96900529-96900551 GGGTGGGAATCATTAGTTCTCGG + Intergenic
1013175553 6:107673639-107673661 GGCTGGGAAGTCCAAGGTCTAGG + Intergenic
1013650991 6:112194255-112194277 GGCTGGGAATCTTAAGGTCTGGG + Intronic
1014317847 6:119889779-119889801 GGCTGGGAAGTCTAAGATCTAGG - Intergenic
1014406441 6:121057807-121057829 GGCTGGGAAATGTAAGGTATGGG - Intergenic
1014997831 6:128173652-128173674 GGCTTGGAACATTAAGGTATAGG - Intronic
1015361205 6:132341333-132341355 GGCTGGGAAGTTCAAGGTCAAGG - Intronic
1016051114 6:139531315-139531337 GGCAGGGACTCTGAAGTTCTAGG - Intergenic
1016310468 6:142728070-142728092 GGCTGGGAAGTTTAAGATGTAGG - Intergenic
1016915558 6:149241155-149241177 GGCTGGGAAGCTCAAGATCAAGG - Intronic
1017287652 6:152695253-152695275 GGCTGGGAAGTTTAAGATCAAGG - Intergenic
1017363238 6:153602065-153602087 GGCTGGGAATTCTAAGATCAAGG + Intergenic
1018318610 6:162583189-162583211 GGCTGGGAAGTCTAAGGTCAAGG - Intronic
1019065281 6:169291176-169291198 GGCTGGGAATTTCAAGATCAAGG + Intergenic
1019337154 7:490926-490948 GGCTGGGAATCTTTCCATCTAGG - Intergenic
1020321392 7:6941080-6941102 GGCTGGGAAGCATAGTGTCTGGG + Intergenic
1021330361 7:19330837-19330859 GGCTGGCAATCTGGTGGTCTGGG - Intergenic
1022610101 7:31862502-31862524 GGCTAGGAAGCTTAAGATCAAGG + Intronic
1022897836 7:34770807-34770829 GGCTGGGAAGTCTAAGGTCCAGG + Intronic
1025260045 7:57412707-57412729 GGCTTGGCATCTGTAGGTCTGGG + Intergenic
1027307654 7:76918259-76918281 GGCTGGGAAGGTCAAGGTCAAGG + Intergenic
1028509842 7:91612181-91612203 AGCTGTGAATCTTAAGATGTTGG + Intergenic
1028597135 7:92557543-92557565 GGCTGGGAAGCCCAAGGTCGAGG - Intergenic
1028635450 7:92984271-92984293 GGCTGGGAAGATCAAGATCTAGG + Intergenic
1028980958 7:96967702-96967724 GGCTGGGAATTTTGAGACCTGGG - Intergenic
1030508414 7:110453830-110453852 GGCTGGGAAGTTTAAGATCAAGG + Intergenic
1030533043 7:110733918-110733940 GGCTGGGAAGTTAAAGGTCAGGG - Intronic
1033495854 7:141894936-141894958 GGCTGGGAAGTTTAAGATCAAGG + Intergenic
1033971712 7:147049045-147049067 GGCTGGGGAGCTCAAGGTCAAGG + Intronic
1034139619 7:148803556-148803578 GGCCAGGAATCTGAAGGTGTGGG - Intergenic
1034145369 7:148866453-148866475 GGCTGGGAAGTTTAAGATCAAGG - Intronic
1034369472 7:150582385-150582407 GGCTGGGAATGCAGAGGTCTTGG + Intergenic
1034490184 7:151389014-151389036 GGCTGGGAAATCCAAGGTCTAGG - Intronic
1034717841 7:153260153-153260175 GGCTGGGAAGTTTAAGGTTGAGG + Intergenic
1034862570 7:154612136-154612158 GGCTGGAAAGCTTAAGATCAAGG - Intronic
1035793922 8:2335929-2335951 GGCTGGGAAGCTCAACGTCAAGG - Intergenic
1035798879 8:2385779-2385801 GGCTGGGAAGCTCAACGTCAAGG + Intergenic
1036374830 8:8191334-8191356 GGCTGGGAAGCATAGTGTCTGGG - Intergenic
1037271376 8:17134340-17134362 GGCTGGCAGGCTTAAGATCTAGG + Intergenic
1037604474 8:20425763-20425785 GGCTGGGGAGCCAAAGGTCTGGG + Intergenic
1038359737 8:26865045-26865067 AGCCGGGAATCAAAAGGTCTCGG + Exonic
1039698634 8:39940048-39940070 GGCTGGGAATTTTGGCGTCTTGG - Intronic
1040879888 8:52193071-52193093 GGCAGAGAATCTGAAGGTCATGG + Intronic
1041718268 8:60951599-60951621 GGCTGGGAAGCCCAAGGTCAAGG + Intergenic
1046414365 8:113892382-113892404 GGCTGGGAAGTCTAAGGTCAAGG - Intergenic
1048272723 8:133042372-133042394 GGCTGGGAAAATCAAGGGCTGGG - Intronic
1048874643 8:138827427-138827449 GGCTGGGAAGTCTAAGGTCAGGG - Intronic
1048933002 8:139330965-139330987 GGCTGGGAAGCCCAAGGTCAAGG + Intergenic
1049700082 8:144006824-144006846 GGCTGGGAAGTCTAAGGTCAAGG - Intronic
1050974708 9:11922891-11922913 GGCTGGGAAATTTAAGATCAAGG - Intergenic
1051694937 9:19758013-19758035 GGCTGGGAATTTCAAGGTCATGG - Intronic
1053039918 9:34861973-34861995 GGCTGGGAAGTTCAAGATCTGGG + Intergenic
1053272280 9:36758658-36758680 GGCTAGGAAGCTGAAGGTCAAGG - Intergenic
1053319286 9:37080596-37080618 GGCTGGGAATCAGGAGGCCTGGG + Intergenic
1053323603 9:37121223-37121245 GGCTGGGAATCAGGAGGCCTGGG + Intronic
1056103499 9:83323630-83323652 GGCGTGGAAGTTTAAGGTCTGGG - Intronic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1057720268 9:97526785-97526807 GGCTGGGGACATTGAGGTCTAGG - Intronic
1057811525 9:98260745-98260767 GGCTGGGAAGTGTAAGGTCCAGG + Intergenic
1059793366 9:117664403-117664425 GGCTGGGAAGTTCAAGGTCAAGG + Intergenic
1060045092 9:120333542-120333564 GGCTTGGAATACGAAGGTCTGGG - Intergenic
1062681437 9:137784113-137784135 GGCTGGGAAGCCCAAGGTCGAGG + Intronic
1187273792 X:17801485-17801507 GGCTGGGGATCCTCAGGTCCAGG + Exonic
1187948353 X:24448145-24448167 GGCTGGGAATTCCAAGGTCAAGG + Intergenic
1188235776 X:27729564-27729586 GGCTGGGAAGCCCAAGGTCAAGG + Intronic
1190369829 X:49730027-49730049 GGCTGGGAAGCCCAAGGTCAAGG - Intergenic
1191937579 X:66441722-66441744 GTCTGGGCAGCTTAAAGTCTAGG - Intergenic
1192220563 X:69195017-69195039 GGCTGGGAGTCTGGAGGTCTGGG - Intergenic
1192463513 X:71338382-71338404 GGCTGGGAAGTTTAAGGGCATGG - Intergenic
1192628637 X:72756951-72756973 GGCTACAAATCTTAAGGTCAAGG - Intergenic
1192653071 X:72963863-72963885 GGCTACAAATCTTAAGGTCAAGG + Intergenic
1193937073 X:87636549-87636571 AGCTGGGAGTCTTATGGCCTGGG + Intronic
1194181382 X:90715368-90715390 AGCGGGGAATCTTATGGCCTGGG + Intergenic
1194642677 X:96421812-96421834 GGCTGAGAATTCCAAGGTCTAGG + Intergenic
1195286830 X:103393922-103393944 GTCTGGGTGTCTTACGGTCTGGG + Intergenic
1197034804 X:121860365-121860387 GGCTGAGAATGTCAGGGTCTTGG - Intergenic
1197836754 X:130702736-130702758 CTCTAGGAATCTTAAGATCTTGG + Intronic
1198502646 X:137267261-137267283 GGCTCGGATTCTGTAGGTCTAGG + Intergenic
1198546765 X:137700798-137700820 GTCTGGGAATTTGAAGGCCTGGG - Intergenic
1198818293 X:140616827-140616849 GGCTGGGAAGTTGAAGATCTAGG + Intergenic
1198820294 X:140640105-140640127 GGCTGAGAAACTCAAGGCCTAGG - Intergenic
1200002262 X:153068154-153068176 GGCTGGGAAGCTCAAAGTCAAGG - Intergenic
1200005471 X:153081871-153081893 GGCTGGGAAGCTCAAAGTCAAGG + Intergenic
1200178528 X:154135847-154135869 GGCTGGGTGTCTTAGAGTCTTGG - Intergenic
1201187870 Y:11421400-11421422 GGCTGGGAATGTCAAGATCAAGG + Intergenic
1201481450 Y:14443812-14443834 GGCTGGGAAGTCTAAGGTCAGGG - Intergenic
1202194152 Y:22278906-22278928 GGCTGGTAACCTTGAGATCTGGG - Intergenic