ID: 1013657800

View in Genome Browser
Species Human (GRCh38)
Location 6:112263663-112263685
Sequence TTGAATGAATGGATGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013657800_1013657803 22 Left 1013657800 6:112263663-112263685 CCATTCACCATCCATTCATTCAA No data
Right 1013657803 6:112263708-112263730 TTTGCAACCTGCATTTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013657800 Original CRISPR TTGAATGAATGGATGGTGAA TGG (reversed) Intergenic
No off target data available for this crispr