ID: 1013657803

View in Genome Browser
Species Human (GRCh38)
Location 6:112263708-112263730
Sequence TTTGCAACCTGCATTTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013657801_1013657803 15 Left 1013657801 6:112263670-112263692 CCATCCATTCATTCAACAAATAT 0: 9
1: 73
2: 290
3: 877
4: 2045
Right 1013657803 6:112263708-112263730 TTTGCAACCTGCATTTTTCTAGG No data
1013657800_1013657803 22 Left 1013657800 6:112263663-112263685 CCATTCACCATCCATTCATTCAA No data
Right 1013657803 6:112263708-112263730 TTTGCAACCTGCATTTTTCTAGG No data
1013657802_1013657803 11 Left 1013657802 6:112263674-112263696 CCATTCATTCAACAAATATTTTT No data
Right 1013657803 6:112263708-112263730 TTTGCAACCTGCATTTTTCTAGG No data
1013657799_1013657803 26 Left 1013657799 6:112263659-112263681 CCATCCATTCACCATCCATTCAT No data
Right 1013657803 6:112263708-112263730 TTTGCAACCTGCATTTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013657803 Original CRISPR TTTGCAACCTGCATTTTTCT AGG Intergenic
No off target data available for this crispr