ID: 1013658590

View in Genome Browser
Species Human (GRCh38)
Location 6:112271266-112271288
Sequence CAGGGTGGTCCGTGAGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013658590_1013658594 -5 Left 1013658590 6:112271266-112271288 CCTTATTCTCACGGACCACCCTG No data
Right 1013658594 6:112271284-112271306 CCCTGGCTTCTGCTTTATTGAGG No data
1013658590_1013658596 6 Left 1013658590 6:112271266-112271288 CCTTATTCTCACGGACCACCCTG No data
Right 1013658596 6:112271295-112271317 GCTTTATTGAGGCACATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013658590 Original CRISPR CAGGGTGGTCCGTGAGAATA AGG (reversed) Intergenic
No off target data available for this crispr