ID: 1013659515

View in Genome Browser
Species Human (GRCh38)
Location 6:112280691-112280713
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013659513_1013659515 26 Left 1013659513 6:112280642-112280664 CCAAAGTTGGGTGAGTCTGGACA No data
Right 1013659515 6:112280691-112280713 CTTCTAAGCAGCCTTCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013659515 Original CRISPR CTTCTAAGCAGCCTTCAAGG AGG Intergenic
No off target data available for this crispr