ID: 1013668102

View in Genome Browser
Species Human (GRCh38)
Location 6:112368055-112368077
Sequence CAGATTTTGTAACTGGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013668102_1013668105 -10 Left 1013668102 6:112368055-112368077 CCAATGTCCAGTTACAAAATCTG No data
Right 1013668105 6:112368068-112368090 ACAAAATCTGTAACTTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013668102 Original CRISPR CAGATTTTGTAACTGGACAT TGG (reversed) Intergenic
No off target data available for this crispr