ID: 1013668823

View in Genome Browser
Species Human (GRCh38)
Location 6:112376151-112376173
Sequence GAGGAGAAGGAAAATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013668817_1013668823 -8 Left 1013668817 6:112376136-112376158 CCCTCCTGGTGTTGAGAGGAGAA No data
Right 1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG No data
1013668813_1013668823 10 Left 1013668813 6:112376118-112376140 CCTTCTTTCCTGCACTTGCCCTC No data
Right 1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG No data
1013668815_1013668823 2 Left 1013668815 6:112376126-112376148 CCTGCACTTGCCCTCCTGGTGTT No data
Right 1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG No data
1013668818_1013668823 -9 Left 1013668818 6:112376137-112376159 CCTCCTGGTGTTGAGAGGAGAAG No data
Right 1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013668823 Original CRISPR GAGGAGAAGGAAAATGAGGG AGG Intergenic
No off target data available for this crispr