ID: 1013674295

View in Genome Browser
Species Human (GRCh38)
Location 6:112440317-112440339
Sequence AGCTATTAGGGTCCACTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013674288_1013674295 10 Left 1013674288 6:112440284-112440306 CCCTTGGTCTGGTCTTTCCCTTC No data
Right 1013674295 6:112440317-112440339 AGCTATTAGGGTCCACTTTATGG No data
1013674290_1013674295 -7 Left 1013674290 6:112440301-112440323 CCCTTCTTTGCCTTGAAGCTATT No data
Right 1013674295 6:112440317-112440339 AGCTATTAGGGTCCACTTTATGG No data
1013674291_1013674295 -8 Left 1013674291 6:112440302-112440324 CCTTCTTTGCCTTGAAGCTATTA No data
Right 1013674295 6:112440317-112440339 AGCTATTAGGGTCCACTTTATGG No data
1013674289_1013674295 9 Left 1013674289 6:112440285-112440307 CCTTGGTCTGGTCTTTCCCTTCT No data
Right 1013674295 6:112440317-112440339 AGCTATTAGGGTCCACTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013674295 Original CRISPR AGCTATTAGGGTCCACTTTA TGG Intergenic
No off target data available for this crispr