ID: 1013675113

View in Genome Browser
Species Human (GRCh38)
Location 6:112450794-112450816
Sequence ACAACTAGGCTGAAAGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013675113_1013675115 22 Left 1013675113 6:112450794-112450816 CCTTTTACTTTCAGCCTAGTTGT No data
Right 1013675115 6:112450839-112450861 TCTTGTAGACAACACACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013675113 Original CRISPR ACAACTAGGCTGAAAGTAAA AGG (reversed) Intergenic
No off target data available for this crispr