ID: 1013675993

View in Genome Browser
Species Human (GRCh38)
Location 6:112463793-112463815
Sequence CATGAGAGGGACCCAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013675987_1013675993 -6 Left 1013675987 6:112463776-112463798 CCATAATTCCCGTGTGTCATGAG No data
Right 1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG No data
1013675983_1013675993 21 Left 1013675983 6:112463749-112463771 CCCAAATCTCACCTTGAATTGTA 0: 1257
1: 8964
2: 10159
3: 8288
4: 7147
Right 1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG No data
1013675980_1013675993 26 Left 1013675980 6:112463744-112463766 CCCCACCCAAATCTCACCTTGAA 0: 1231
1: 9508
2: 11048
3: 8658
4: 6483
Right 1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG No data
1013675985_1013675993 10 Left 1013675985 6:112463760-112463782 CCTTGAATTGTAGCTCCCATAAT 0: 115
1: 225
2: 223
3: 274
4: 373
Right 1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG No data
1013675986_1013675993 -5 Left 1013675986 6:112463775-112463797 CCCATAATTCCCGTGTGTCATGA No data
Right 1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG No data
1013675982_1013675993 24 Left 1013675982 6:112463746-112463768 CCACCCAAATCTCACCTTGAATT 0: 1258
1: 9618
2: 11033
3: 8774
4: 7969
Right 1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG No data
1013675984_1013675993 20 Left 1013675984 6:112463750-112463772 CCAAATCTCACCTTGAATTGTAG 0: 250
1: 5448
2: 9006
3: 8554
4: 8035
Right 1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG No data
1013675981_1013675993 25 Left 1013675981 6:112463745-112463767 CCCACCCAAATCTCACCTTGAAT 0: 1285
1: 9579
2: 10700
3: 9355
4: 7118
Right 1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013675993 Original CRISPR CATGAGAGGGACCCAGTGGA AGG Intergenic
No off target data available for this crispr