ID: 1013676309

View in Genome Browser
Species Human (GRCh38)
Location 6:112466927-112466949
Sequence GTCTATTTATATATCCTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013676309_1013676311 11 Left 1013676309 6:112466927-112466949 CCTAACAGGATATATAAATAGAC No data
Right 1013676311 6:112466961-112466983 CTCATACCAATCACTGAGTTTGG No data
1013676309_1013676313 25 Left 1013676309 6:112466927-112466949 CCTAACAGGATATATAAATAGAC No data
Right 1013676313 6:112466975-112466997 TGAGTTTGGCCAATCAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013676309 Original CRISPR GTCTATTTATATATCCTGTT AGG (reversed) Intergenic
No off target data available for this crispr