ID: 1013694123

View in Genome Browser
Species Human (GRCh38)
Location 6:112681290-112681312
Sequence CTAACAAGGGCAGAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013694123_1013694135 28 Left 1013694123 6:112681290-112681312 CCTTCCTTCTCTGCCCTTGTTAG No data
Right 1013694135 6:112681341-112681363 CATCCCACTGGCTTTTGGCTTGG No data
1013694123_1013694134 23 Left 1013694123 6:112681290-112681312 CCTTCCTTCTCTGCCCTTGTTAG No data
Right 1013694134 6:112681336-112681358 TGTCTCATCCCACTGGCTTTTGG No data
1013694123_1013694129 -5 Left 1013694123 6:112681290-112681312 CCTTCCTTCTCTGCCCTTGTTAG No data
Right 1013694129 6:112681308-112681330 GTTAGGACTCCCCATGGACATGG No data
1013694123_1013694133 16 Left 1013694123 6:112681290-112681312 CCTTCCTTCTCTGCCCTTGTTAG No data
Right 1013694133 6:112681329-112681351 GGTAAAGTGTCTCATCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013694123 Original CRISPR CTAACAAGGGCAGAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr