ID: 1013694128

View in Genome Browser
Species Human (GRCh38)
Location 6:112681304-112681326
Sequence GTCCATGGGGAGTCCTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013694128_1013694135 14 Left 1013694128 6:112681304-112681326 CCTTGTTAGGACTCCCCATGGAC No data
Right 1013694135 6:112681341-112681363 CATCCCACTGGCTTTTGGCTTGG No data
1013694128_1013694134 9 Left 1013694128 6:112681304-112681326 CCTTGTTAGGACTCCCCATGGAC No data
Right 1013694134 6:112681336-112681358 TGTCTCATCCCACTGGCTTTTGG No data
1013694128_1013694133 2 Left 1013694128 6:112681304-112681326 CCTTGTTAGGACTCCCCATGGAC No data
Right 1013694133 6:112681329-112681351 GGTAAAGTGTCTCATCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013694128 Original CRISPR GTCCATGGGGAGTCCTAACA AGG (reversed) Intergenic
No off target data available for this crispr