ID: 1013694130

View in Genome Browser
Species Human (GRCh38)
Location 6:112681317-112681339
Sequence GACACTTTACCATGTCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013694130_1013694134 -4 Left 1013694130 6:112681317-112681339 CCCCATGGACATGGTAAAGTGTC No data
Right 1013694134 6:112681336-112681358 TGTCTCATCCCACTGGCTTTTGG No data
1013694130_1013694139 30 Left 1013694130 6:112681317-112681339 CCCCATGGACATGGTAAAGTGTC No data
Right 1013694139 6:112681370-112681392 GACTTGCTTTGACAAATGGAAGG No data
1013694130_1013694135 1 Left 1013694130 6:112681317-112681339 CCCCATGGACATGGTAAAGTGTC No data
Right 1013694135 6:112681341-112681363 CATCCCACTGGCTTTTGGCTTGG No data
1013694130_1013694138 26 Left 1013694130 6:112681317-112681339 CCCCATGGACATGGTAAAGTGTC No data
Right 1013694138 6:112681366-112681388 ACATGACTTGCTTTGACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013694130 Original CRISPR GACACTTTACCATGTCCATG GGG (reversed) Intergenic
No off target data available for this crispr