ID: 1013694134

View in Genome Browser
Species Human (GRCh38)
Location 6:112681336-112681358
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013694127_1013694134 10 Left 1013694127 6:112681303-112681325 CCCTTGTTAGGACTCCCCATGGA No data
Right 1013694134 6:112681336-112681358 TGTCTCATCCCACTGGCTTTTGG No data
1013694123_1013694134 23 Left 1013694123 6:112681290-112681312 CCTTCCTTCTCTGCCCTTGTTAG No data
Right 1013694134 6:112681336-112681358 TGTCTCATCCCACTGGCTTTTGG No data
1013694130_1013694134 -4 Left 1013694130 6:112681317-112681339 CCCCATGGACATGGTAAAGTGTC No data
Right 1013694134 6:112681336-112681358 TGTCTCATCCCACTGGCTTTTGG No data
1013694132_1013694134 -6 Left 1013694132 6:112681319-112681341 CCATGGACATGGTAAAGTGTCTC No data
Right 1013694134 6:112681336-112681358 TGTCTCATCCCACTGGCTTTTGG No data
1013694131_1013694134 -5 Left 1013694131 6:112681318-112681340 CCCATGGACATGGTAAAGTGTCT No data
Right 1013694134 6:112681336-112681358 TGTCTCATCCCACTGGCTTTTGG No data
1013694128_1013694134 9 Left 1013694128 6:112681304-112681326 CCTTGTTAGGACTCCCCATGGAC No data
Right 1013694134 6:112681336-112681358 TGTCTCATCCCACTGGCTTTTGG No data
1013694125_1013694134 19 Left 1013694125 6:112681294-112681316 CCTTCTCTGCCCTTGTTAGGACT No data
Right 1013694134 6:112681336-112681358 TGTCTCATCCCACTGGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013694134 Original CRISPR TGTCTCATCCCACTGGCTTT TGG Intergenic