ID: 1013694136

View in Genome Browser
Species Human (GRCh38)
Location 6:112681344-112681366
Sequence TGACCAAGCCAAAAGCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013694136_1013694138 -1 Left 1013694136 6:112681344-112681366 CCCACTGGCTTTTGGCTTGGTCA No data
Right 1013694138 6:112681366-112681388 ACATGACTTGCTTTGACAAATGG No data
1013694136_1013694139 3 Left 1013694136 6:112681344-112681366 CCCACTGGCTTTTGGCTTGGTCA No data
Right 1013694139 6:112681370-112681392 GACTTGCTTTGACAAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013694136 Original CRISPR TGACCAAGCCAAAAGCCAGT GGG (reversed) Intergenic
No off target data available for this crispr