ID: 1013694139

View in Genome Browser
Species Human (GRCh38)
Location 6:112681370-112681392
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013694132_1013694139 28 Left 1013694132 6:112681319-112681341 CCATGGACATGGTAAAGTGTCTC No data
Right 1013694139 6:112681370-112681392 GACTTGCTTTGACAAATGGAAGG No data
1013694131_1013694139 29 Left 1013694131 6:112681318-112681340 CCCATGGACATGGTAAAGTGTCT No data
Right 1013694139 6:112681370-112681392 GACTTGCTTTGACAAATGGAAGG No data
1013694136_1013694139 3 Left 1013694136 6:112681344-112681366 CCCACTGGCTTTTGGCTTGGTCA No data
Right 1013694139 6:112681370-112681392 GACTTGCTTTGACAAATGGAAGG No data
1013694137_1013694139 2 Left 1013694137 6:112681345-112681367 CCACTGGCTTTTGGCTTGGTCAC No data
Right 1013694139 6:112681370-112681392 GACTTGCTTTGACAAATGGAAGG No data
1013694130_1013694139 30 Left 1013694130 6:112681317-112681339 CCCCATGGACATGGTAAAGTGTC No data
Right 1013694139 6:112681370-112681392 GACTTGCTTTGACAAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013694139 Original CRISPR GACTTGCTTTGACAAATGGA AGG Intergenic