ID: 1013695039

View in Genome Browser
Species Human (GRCh38)
Location 6:112692112-112692134
Sequence GCTTCCATGAAGAGAATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013695034_1013695039 0 Left 1013695034 6:112692089-112692111 CCTTCCGAATATAGGGATGTGGG No data
Right 1013695039 6:112692112-112692134 GCTTCCATGAAGAGAATGGATGG No data
1013695029_1013695039 15 Left 1013695029 6:112692074-112692096 CCTAGGAAAAGTCCACCTTCCGA No data
Right 1013695039 6:112692112-112692134 GCTTCCATGAAGAGAATGGATGG No data
1013695032_1013695039 3 Left 1013695032 6:112692086-112692108 CCACCTTCCGAATATAGGGATGT No data
Right 1013695039 6:112692112-112692134 GCTTCCATGAAGAGAATGGATGG No data
1013695037_1013695039 -4 Left 1013695037 6:112692093-112692115 CCGAATATAGGGATGTGGGGCTT No data
Right 1013695039 6:112692112-112692134 GCTTCCATGAAGAGAATGGATGG No data
1013695028_1013695039 26 Left 1013695028 6:112692063-112692085 CCTGGTGAAAGCCTAGGAAAAGT No data
Right 1013695039 6:112692112-112692134 GCTTCCATGAAGAGAATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013695039 Original CRISPR GCTTCCATGAAGAGAATGGA TGG Intergenic
No off target data available for this crispr