ID: 1013697285

View in Genome Browser
Species Human (GRCh38)
Location 6:112718712-112718734
Sequence CTGCTGTTCTATAGCACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013697285_1013697286 -7 Left 1013697285 6:112718712-112718734 CCTTCAGTGCTATAGAACAGCAG No data
Right 1013697286 6:112718728-112718750 ACAGCAGTCGCCACCCTTTTTGG No data
1013697285_1013697288 1 Left 1013697285 6:112718712-112718734 CCTTCAGTGCTATAGAACAGCAG No data
Right 1013697288 6:112718736-112718758 CGCCACCCTTTTTGGCACCAGGG No data
1013697285_1013697292 14 Left 1013697285 6:112718712-112718734 CCTTCAGTGCTATAGAACAGCAG No data
Right 1013697292 6:112718749-112718771 GGCACCAGGGACTAGTTTCATGG 0: 13
1: 601
2: 1127
3: 1466
4: 1357
1013697285_1013697287 0 Left 1013697285 6:112718712-112718734 CCTTCAGTGCTATAGAACAGCAG No data
Right 1013697287 6:112718735-112718757 TCGCCACCCTTTTTGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013697285 Original CRISPR CTGCTGTTCTATAGCACTGA AGG (reversed) Intergenic
No off target data available for this crispr