ID: 1013703671

View in Genome Browser
Species Human (GRCh38)
Location 6:112806269-112806291
Sequence TGTGGGTTCTGATTCATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013703671_1013703672 -7 Left 1013703671 6:112806269-112806291 CCTTTAATGAATCAGAACCCACA No data
Right 1013703672 6:112806285-112806307 ACCCACAGTTTGAAAAACATTGG No data
1013703671_1013703675 5 Left 1013703671 6:112806269-112806291 CCTTTAATGAATCAGAACCCACA No data
Right 1013703675 6:112806297-112806319 AAAAACATTGGTGTAGTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013703671 Original CRISPR TGTGGGTTCTGATTCATTAA AGG (reversed) Intergenic
No off target data available for this crispr