ID: 1013703771

View in Genome Browser
Species Human (GRCh38)
Location 6:112807416-112807438
Sequence TGCACTCTGAATCTCCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013703771_1013703773 -8 Left 1013703771 6:112807416-112807438 CCCTCTGGGAGATTCAGAGTGCA No data
Right 1013703773 6:112807431-112807453 AGAGTGCAAATCAGCATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013703771 Original CRISPR TGCACTCTGAATCTCCCAGA GGG (reversed) Intergenic
No off target data available for this crispr