ID: 1013709642

View in Genome Browser
Species Human (GRCh38)
Location 6:112881300-112881322
Sequence GCCGCCTGTCAGTCACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013709642_1013709643 11 Left 1013709642 6:112881300-112881322 CCAGGGTGTGACTGACAGGCGGC No data
Right 1013709643 6:112881334-112881356 TAGCATTTTTTCACTTGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013709642 Original CRISPR GCCGCCTGTCAGTCACACCC TGG (reversed) Intergenic
No off target data available for this crispr