ID: 1013718678

View in Genome Browser
Species Human (GRCh38)
Location 6:112995467-112995489
Sequence AAGTTTTGAAAACCTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013718675_1013718678 25 Left 1013718675 6:112995419-112995441 CCTCAGGTCTGCAACACATCAAT No data
Right 1013718678 6:112995467-112995489 AAGTTTTGAAAACCTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013718678 Original CRISPR AAGTTTTGAAAACCTGTTCC AGG Intergenic
No off target data available for this crispr